THE JOURNAL OF BIOLOGICAL CHEMISTRY
`© 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
`
`Vol. 274, No. 48, Issue of November 26, pp. 34053–34058, 1999
`Printed in U.S.A.
`
`Sequence, Purification, and Cloning of an Intracellular Serine
`Protease, Quiescent Cell Proline Dipeptidase*
`
`(Received for publication, April 5, 1999, and in revised form, September 13, 1999)
`
`Robert Underwood, Murali Chiravuri, Henry Lee, Tracy Schmitz, Alisa K. Kabcenell‡,
`Kurt Yardley§, and Brigitte T. Huber¶
`From the Department of Pathology, Program in Immunology, Tufts University School of Medicine,
`Boston, Massachusetts 02111 and the ‡Department of Immunological Diseases,
`Boehringer Ingelheim Pharmaceuticals, Inc., Ridgefield, Connecticut 06877
`
`We recently observed that specific inhibitors of post-
`proline cleaving aminodipeptidases cause apoptosis in
`quiescent lymphocytes in a process independent of
`CD26/dipeptidyl peptidase IV. These results led to the
`isolation and cloning of a new protease that we have
`termed quiescent cell proline dipeptidase (QPP). QPP
`activity was purified from CD262 Jurkat T cells. The
`protein was identified by labeling with [3H]diisopropy-
`lfluorophosphate and subjected to tryptic digestion and
`partial amino acid sequencing. The peptide sequences
`were used to identify expressed sequence tag clones.
`The cDNA of QPP contains an open reading frame of
`1476 base pairs, coding for a protein of 492 amino acids.
`The amino acid sequence of QPP reveals similarity with
`prolylcarboxypeptidase. The putative active site resi-
`dues serine, aspartic acid, and histidine of QPP show an
`ordering of the catalytic triad similar to that seen in the
`post-proline cleaving exopeptidases prolylcarboxypep-
`tidase and CD26/dipeptidyl peptidase IV. The post-pro-
`line cleaving activity of QPP has an unusually broad pH
`range in that it is able to cleave substrate molecules at
`acidic pH as well as at neutral pH. QPP has also been
`detected in nonlymphocytic cell lines, indicating that
`this enzyme activity may play an important role in other
`tissues as well.
`
`There are relatively few enzymes that have the ability to
`cleave proline-containing peptide bonds. These include exopep-
`tidases such as dipeptidyl peptidase IV (CD26/DPPIV),1 dipep-
`tidyl peptidase II (DPPII), and prolylcarboxypeptidase (PCP,
`angiotensinase C; Ref. 1). CD26/DPPIV is a ubiquitously ex-
`pressed molecule found on the cell membrane and in a secreted
`
`form (2, 3). CD26 was recently shown to cleave dipeptides off
`the amino terminus of chemokines such as regulated on acti-
`vation, normal T cell expressed and secreted, stromal-derived
`factor 1, and macrophage derived chemokine, altering the bio-
`logical activity of these molecules (4–6). DPPII and PCP are
`both found in lysosomes. DPPII has a similar substrate speci-
`ficity to CD26/DPPIV but is only active at acidic pH (7). PCP,
`however, is a post-proline cleaving activity that liberates amino
`acids from the carboxyl terminus of proteins (8).
`We recently observed that inhibitors of post-proline cleaving
`aminodipeptidases cause apoptosis in quiescent lymphocytes
`but not activated or transformed lymphocytes (9). This apopto-
`sis is not mediated by CD26, because CD262 and CD261 cells
`both undergo apoptosis in response to the addition of these
`inhibitors (9). Closer analysis revealed an intracellular post-
`proline cleaving aminodipeptidase activity that was functional
`at neutral and acidic pH.
`In this paper we report the purification and sequence of a
`post-proline cleaving aminodipeptidase that we have termed
`quiescent cell proline dipeptidase (QPP), according to its func-
`tional properties. The post-proline cleaving activity was puri-
`fied 1000-fold by following the cleavage of the reporter sub-
`strates Ala-Pro-7-amino-4-trifluoromethylcoumarin (AFC) and
`Gly-Pro-paranitroanilide (pNA). The active-site serine contain-
`ing protein was identified by labeling with [3H]diisopropylflu-
`orophosphate (DFP). Peptide sequencing of this protein pro-
`vided us with four peptides, which were used to identify cDNAs
`from the Expressed Sequence Tag (EST) data base. The QPP
`cDNA contains an open reading frame of 1476 base pairs coding
`for a 492-amino acid protein. This protein has strong sequence
`homology with PCP but little similarity to CD26/DPPIV. We
`show that the QPP cDNA codes for a fully functional enzyme
`with Ala-Pro-AFC cleaving activity. Unlike the reported activ-
`ity of DPPII and DPPIV (7), however, QPP is active at both
`acidic and neutral pH. This enzyme may play a role in the
`regulation of the large number of proteins that contain a con-
`served amino-terminal Xaa-Pro motif (1).
`
`* This work was supported by National Institutes of Health Research
`Grants AI36696 and AI43469 (to B.T.H.). The costs of publication of this
`article were defrayed in part by the payment of page charges. This
`article must therefore be hereby marked “advertisement” in accordance
`with 18 U.S.C. Section 1734 solely to indicate this fact.
`The nucleotide sequence(s) reported in this paper has been submitted
`to the GenBankTM/EBI Data Bank with accession number(s) AF154502.
`‡ Supported by National Institutes of Health Training Grant
`T32AR07570.
`§ To whom correspondence should be addressed: Dept. of Pathology,
`Tufts University School of Medicine, 136 Harrison Ave., Boston, MA
`02111. Tel.: 617-636-6905; Fax: 617-636-0449; E-mail: bhuber@
`opal.tufts.edu.
`1 The abbreviations used are: DPPIV, dipeptidyl peptidase IV; DPPII
`dipeptidyl peptidase II; QPP, quiescent cell proline dipeptidase; VbP,
`Val-boro-Pro; PCP, prolylcarboxypeptidase; PBMC, peripheral blood
`mononuclear cell; AFC, amino-4-trifluoromethylcoumarin; pNA, para-
`nitroanilide; DFP, diisopropylfluorophosphate; EST, Expressed Se-
`quence Tag; RACE, rapid amplification of cDNA ends; S-110, 110,000 3
`g supernatant; PAGE, polyacrylamide gel electrophoresis; HEPBS,
`N-(2-hydroxyethyl)piperazine-N9-(4-butanesulfonic acid).
`
`This paper is available on line at http://www.jbc.org
`
`EXPERIMENTAL PROCEDURES
`Materials—The peptidase inhibitors Lys-thiazolidide, Lys-piperi-
`dide, and Val-boro-Pro (VbP) were provided by R. Snow (Boehringer
`Ingelheim Pharmaceuticals, Ridgefield, CT). L-125 was provided by
`J. T. Welch (State University New York, Albany, NY; see Fig. 1). Frozen
`pellets of Jurkat cells were provided by R. Barton (Boehringer In-
`gelheim). All chromatography media and Ficoll-Hypaque were pur-
`chased from Amersham Pharmacia Biotech. Aim V cell culture medium
`was purchased from Life Technologies. [3H]DFP and [3H]Enhance were
`purchased from NEN Life Science Products. Ala-Pro-AFC and AFC
`were purchased from Enzyme Systems Products (Dublin, CA). Protein
`concentrations were determined using the Coomassie Plus protein as-
`say reagent purchased from Pierce, and centrifugal concentrators were
`purchased from Ambion (Austin, TX). Rapid amplification of cDNA
`ends (RACE) polymerase chain reaction was performed using the Mar-
`34053
`
`AstraZeneca Exhibit 2167
`Mylan v. AstraZeneca
`IPR2015-01340
`
`Page 1 of 6
`
`

`

`34054
`
`QPP, an Amino-terminal Proline-specific Dipeptidase
`
`athon cDNA amplification kit, and human leukocyte Marathon-Ready
`cDNA was purchased from CLONTECH. DNA sequencing and oligonu-
`cleotide synthesis was performed at the protein analysis facility (Tufts
`University). The TA cloning vector pCR2.1 was purchased from Invitro-
`gen (Carlsbad, CA). All EST clones were purchased from ATCC. All
`additional reagents were purchased from Sigma.
`Preparation of a Soluble Fraction of Ala-Pro-AFC Cleaving Activity—
`Human peripheral blood mononuclear cells (PBMCs; ;4.3 3 108 cells)
`were isolated from 450 ml of whole blood by Ficoll-Hypaque gradient.
`The PBMCs were washed three times in cold phosphate-buffered saline
`and resuspended in 7 ml of ice-cold lysis buffer (0.02 M Tris, pH 7.8, 4
`mg/ml aprotinin, 8 mg/ml leupeptin, 8 mg/ml antipain, 5 mM EDTA) and
`lysed by Dounce homogenization. The homogenate was centrifuged at
`1000 3 g for 10 min at 4 °C. The supernatant was removed and centri-
`fuged at 45,000 3 g for 20 min at 4 °C. The resulting supernatant was
`removed and centrifuged at 110,000 3 g for 1 h at 4 °C. The110,000 3
`g supernatant (S-110) was used as a source of soluble cellular proteins.
`For preparation of S-110 from Jurkat cells, a 68 g (wet weight) frozen
`pellet of these cells was subjected to the same homogenization and
`centrifugation procedure used to prepare S-110 from PBMCs. For prep-
`aration of S-110 from 293T human fibroblasts expressing QPP cDNA,
`;1.8 3 108 cells were lysed in 5 ml of ice-cold lysis buffer containing
`0.02 M phosphate-buffered saline, pH 7.4, instead of 0.02 M Tris and
`then subjected to the same homogenization and centrifugation proce-
`dure used to prepare S-110 from PBMCs.
`Purification of the Soluble Ala-Pro-AFC-Cleaving Activity—30 ml of
`Jurkat S-110 (corresponding to 17 g of cells) was dialyzed (molecular
`mass cutoff, 2 kDa) overnight at 4 °C against 4 liters of 50 mM acetic
`acid, titrated to pH 4.5 with NaOH. The protein sample was clarified by
`centrifugation at 1000 3 g for 10 min at 4 °C. The clarified supernatant
`was concentrated on a Centricon 50 membrane to ;10 ml. The concen-
`trated sample was loaded onto a 3-ml HiTrap SP-Sepharose column and
`equilibrated with 50 mM acetate, pH 4.5 (start buffer). The column was
`washed with 10 column volumes of start buffer and eluted with a linear
`0–300 mM NaCl gradient in start buffer. 0.5-ml fractions were collected
`and assayed for cleavage of Gly-Pro-pNA. Active fractions were pooled
`and concentrated to ;1 ml on a Centricon 50 membrane and then to
`;0.2 ml on a Microcon 30 membrane. The concentrated material was
`loaded onto a Superdex 12 gel filtration column and equilibrated with
`50 mM acetate, pH 4.5, 150 mM NaCl. The column was eluted with the
`same buffer, and 0.5-ml fractions were collected and assayed for Gly-
`Pro-pNA cleavage. Active fractions were pooled and used as a purified
`preparation of the activity. The soluble Ala-Pro-AFC cleaving activity of
`the QPP cDNA-transfected 293T human fibroblasts was partially puri-
`fied by using a gel filtration column and then an ion exchange column,
`in a similar manner as above. CD26/DPPIV was purified from pig
`kidney as described previously (10).
`[3H]DFP Labeling—5 mg (total protein) of purified Ala-Pro-AFC
`cleaving activity was mixed with [3H]DFP (specific activity 8.4, Ci/
`mmol) at a final concentration of 12 mM in 50 mM HEPES, pH 7.5, and
`incubated at room temperature for 60 min. SDS loading buffer was
`added, and the reaction was boiled and separated by SDS-polyacryl-
`amide gel electrophoresis (PAGE). A control reaction without [3H]DFP
`was run in parallel on the same gel. The control lane was silver-stained,
`and the labeled lane was equilibrated first in [3H]Enhance and then 3%
`glycerol. The gels were dried, and the labeled gel was exposed to film.
`Enzymatic Assays—DPPIV-like activity was assayed by fluorogenic
`or chromogenic assays. In the fluorescence assay, peptidase activity was
`measured by monitoring the accumulation of AFC liberated from the
`substrate Ala-Pro-AFC for 1 min, using a Perkin-Elmer fluorescence
`spectrometer (excitation, 400 nm; emission, 505 nm). Assays were car-
`ried out in 50 mM HEPES, pH 7.5, containing 10 mM Ala-Pro-AFC. In
`the chromogenic assay, pNA liberated from the substrate Gly-Pro-pNA
`(1 mM) was measured by absorbance at 410 nm. Plates were read on an
`MR700 plate reader (Dynatech Inc.). The Km for the cleavage of Ala-
`Pro-AFC was determined by assaying a standard amount of activity at
`several concentrations of substrate in 50 mM HEPES, pH 7.5. Km was
`calculated by standard transformation of the Henri-Michaelis-Menten
`equation. The Ki for VbP was determined by assaying a standard
`amount of Ala-Pro-AFC cleaving activity and several concentrations of
`inhibitor.
`pH profile—Purified QPP was added to 150 ml of 20 mM Ala-Pro-AFC
`in one of the following buffers: 170 mM cacodylate buffer (pH range,
`4.0–7.0, in increments of 0.5), 50 mM HEPES (pH range, 6.5–8.5, in
`increments of 0.5), and 50 mM HEPBS (pH range, 7.5–9.0, in increments
`of 0.5). The liberation of AFC from the substrate Ala-Pro-AFC was
`measured using a fluorescent plate reader at excitation 390 nm and
`emission 510 nm (Molecular Devices, Sunnyvale, CA).
`
`Preparative SDS-PAGE—To prepare QPP for tryptic digestion and
`amino acid sequence analysis, the active fractions from the Superdex 12
`column were concentrated to ;60 ml and neutralized by the addition of
`5 ml 100 mM Tris, pH 7.8. SDS loading buffer was added, and the sample
`was boiled before separation by SDS-PAGE. After running, the gel was
`fixed in 50% methanol, 10% acetic acid for 15 min and then stained with
`Coomassie Blue R-250. The 55-kDa band was excised and washed with
`water and with 50% high-performance liquid chromatography grade
`acetonitrile. The final wash was decanted, and the gel slice was snap-
`frozen in N2.
`Data Base Searches and Sequence Comparisons—Peptide sequences
`were used to identify homologous proteins and EST clones using BLAST
`at the National Center for Biotechnology Information. Searches of
`Swissprot for proteins with homology to QPP were performed using
`FASTA3 at the European Bioinformatics Institute. Multiple alignment
`of homologous sequences was performed using CLUSTAL W at the
`European Bioinformatics Institute.
`Cloning of QPP—EST 69230 was supplied in pBluescript at EcoRI-
`XhoI (ATCC). The 59 end of the QPP cDNA was isolated from human
`leukocyte cDNA, using the Marathon 59 RACE system. The primary
`amplification mixture contained 1 3 polymerase chain reaction buffer,
`0.2 mM dNTPs, 0.2 mM primer AP1, 0.5 ng of adapter-ligated human
`leukocyte cDNA, 1 3 KlenTaq polymerase mix, and 0.2 mM QPP-
`specific primer BBE1R (ACTCTGGCCCTCAAAGTCCGCCGTG). The
`products of this reaction were diluted 50-fold with 10 mM Tricine-KOH,
`pH 8.5, 0.1 mM EDTA, and 15 ml was used as template for a nested
`amplification, using 0.2 mM primer AP2, and 0.2 mM nested QPP-
`specific primer BBE2R (GCCGAGGCCTGCCACAGCTAGAACG). A
`prominent band of 600 base pairs was excised, extracted from the gel,
`and TA-cloned into pCR2.1. Several clones were isolated and se-
`quenced. All contained ;200 base pairs of 39 sequence that overlapped
`with EST 69230. To assemble a full-length cDNA, EST 69230 was
`digested with NotI and MstII. The 59 RACE product was excised from
`pCR2.1 by digestion with NotI and MstII. The 59 RACE product and
`pBluescript containing the 39 sequences of EST 69230 were gel purified
`and ligated together, generating a full-length cDNA in pBluescript.
`Transfection of QPP into 293T Fibroblasts—QPP cDNA was polym-
`erase chain reaction-amplified with primers containing XhoI and EcoRI
`restriction sites using DeepVent polymerase (New England Biolabs).
`This was cloned into the pCI-neo expression vector (Promega) and
`transfected into 293T fibroblasts using the calcium phosphate method
`(11). Lysates from transient transfectants were assayed for Ala-Pro-
`AFC cleaving activity, as described above. Stable lines of 293T cells
`were used as a source of recombinant QPP for analysis of pH optima
`and inhibitor analysis.
`Northern Analysis—Total RNA was isolated from resting PBMCs
`and Jurkat cells using the TRIZOL kit (Life Technologies). 20 mg of total
`RNA per lane was loaded from each sample. 32P-labeled QPP cDNA was
`used to probe the Northern blot.
`
`RESULTS
`Novel Intracellular DPPIV-like Activity in Lymphocytes—
`Functional analyses revealed that culturing PBMCs with
`CD26/DPPIV inhibitors led to apoptosis in resting lymphocytes
`(9). CD26/DPPIV, a T cell surface molecule, was excluded as a
`target for this death-inducing activity, because both CD261
`and CD262 lymphocytes were equally sensitive to apoptosis
`induction in the presence of the DPPIV inhibitors (9). To search
`for a novel DPPIV-like activity, a soluble fraction of PBMCs
`was prepared. This fraction contained proteolytic activity that
`cleaved the CD26/DPPIV substrate Ala-Pro-AFC (data not
`shown). The activity was inhibited by VbP (Ref. 12; see Fig. 1
`for structure) in the micromolar range but only partially inhib-
`ited by millimolar concentrations of serine- and cysteine-pro-
`tease inhibitors with broad specificity (Table I). We analyzed
`the ability of various DPPIV inhibitors to block QPP activity.
`As can be seen in Table I, Lys-thiazolidide and Lys-piperidide
`inhibit QPP with similar Ki values to VbP, whereas L-125 (see
`Fig. 1. for structure) does not.
`Because PBMCs contain CD261 cells, and a large quantity of
`blood would be required to isolate enough PBMCs to purify the
`activity, the soluble fraction of CD262 Jurkat T cells was used
`as a source for Ala-Pro-AFC cleaving activity. We analyzed the
`Km values of the purified Ala-Pro-AFC cleaving activities from
`
`Page 2 of 6
`
`

`

`QPP, an Amino-terminal Proline-specific Dipeptidase
`
`34055
`
`FIG. 2. Biochemical analysis of Ala-Pro-AFC cleaving activity.
`A, kinetic analyses. Km and Ki values of the Ala-Pro-AFC cleaving
`activity purified from the cytosol of PBMCs and Jurkat cells, respec-
`tively, were compared, using Ala-Pro-AFC as substrate and VbP as
`inhibitor. B, substrate specificity of the Ala-Pro-AFC cleaving activity
`for various alanine-and proline-containing peptide-pNA substrates was
`tested using purified Jurkat QPP. - -, undetectable activity; Z, benzyl
`blocking group on the amino terminus that blocks QPP-mediated cleav-
`age of the substrates.
`
`TABLE II
`Purification of QPP
`Protein Activitya Specific activity Purification Yield
`
`Fraction
`
`FIG. 1. Inhibitors of post-proline aminodipeptidases. R, a
`polypeptide; Rp, (4-NO2)-Z; Rpp, (4-NO2)-C6H4.
`
`TABLE I
`Inhibition profile of QPP
`
`Inhibitor
`
`Concentration
`
`% Inhibition
`
`VbP
`Antipain
`Leupeptin
`Phenymethylsulfenyl fluoride
`Benzamidine
`N-ethylmaleimide
`Iodoacetimide
`
`1 mM
`1 mM
`1 mM
`1 mM
`1 mM
`1 mM
`1 mM
`
`CD26/DPPIV
`inhibitors
`
`VbP
`Lys-thiazolidide
`Lys-piperidide
`L-125
`a ND, not determined.
`
`Ki (nM)
`
`nM
`
`CD26
`
`2
`NDa
`ND
`188
`
`%
`85
`0
`12
`36
`35
`27
`24
`
`QPP
`
`125
`145
`300
`.1000
`
`PBMCs and Jurkat T cells and found them to be similar. Both
`PBMC and Jurkat activities are inhibited by VbP with a Ki of
`125 nM (Fig. 2A). From these studies we concluded that the
`Ala-Pro-AFC cleaving activity found in the soluble fraction of
`PBMCs and Jurkat cells is attributable to the same enzyme,
`and we used Jurkat cells as a source of the activity for
`purification.
`Biochemical Isolation of QPP—The soluble Ala-Pro-AFC-
`cleavage activity, termed QPP, was purified from the soluble
`fraction of Jurkat cells by the removal of an acid-insoluble,
`denatured fraction, followed by column chromatography on
`SP-Sepharose and Superose 12. At each step fractions were
`assayed for cleavage of the chromogenic substrate Gly-Pro-
`pNA. Active fractions were combined and further purified. The
`Gly-Pro-pNA cleaving activity eluted as a single peak from all
`chromatography columns, and this scheme provided a 1000-
`fold purification of the activity with 27% yield (Table II). Acid
`precipitation removed ;75% of the bulk protein with a 131%
`recovery of Ala-Pro-AFC-cleaving activity. This increased ac-
`tivity was most likely attributable to the removal of an acid-
`insoluble inhibitor. However, from the purification it is impos-
`sible to distinguish whether the cytosolic fraction contained
`inhibitors or natural substrates of QPP activity. Cellular sub-
`strates could compete with Ala-Pro-AFC, thus acting as com-
`petitive inhibitors. Similar to CD26/DPPIV, which cleaves ami-
`
`mg
`480
`109
`
`5
`
`mU
`1119
`1466
`
`994
`
`mU/mg
`2
`13
`
`199
`
`S-110
`Acetate
`Supernatant
`SP
`Sepharose
`1004
`2007
`301
`0.15
`Superdex-12
`a Units defined as the cleavage of 1 mmol of substrate/min.
`
`fold
`
`7
`
`100
`
`%
`100
`131
`
`89
`
`27
`
`no-terminal dipeptides when the penultimate amino acid is
`proline or, to a lesser extent, alanine (13), the purified QPP
`activity is an amino dipeptidase that degrades substrates with
`prolyl and, to a lesser extent, alanyl residues in the penulti-
`mate position. Purified QPP activity is devoid of amino pepti-
`dase activity and does not cleave model substrates with blocked
`amino termini (Fig. 2B).
`The Ala-Pro-AFC cleaving activity of purified QPP is active
`over a broad pH range, from acidic to neutral pH (pH 5.0–7.5;
`Fig. 3). The Ala-Pro-AFC-cleaving activity is clearly detectable
`from pH 4.0–7.5. When incubated in 170 mM cacodylate buffer,
`a peak of maximum activity was detected at an acidic pH of 5.5,
`whereas a similar amount of activity was seen at pH 7.0 with
`HEPES buffer. The Ala-Pro-AFC cleaving activity was lower
`(69%) at pH 7.0 with the cacodylate buffer than the HEPES
`buffer, and this may be attributable to the fact that this pH is
`out of the range of the buffering capacity of cacodylate buffer.
`In both HEPES and HEPBS buffers the activity clearly drops
`off at pH 8.0 and is completely undetectable by pH 8.5.
`The activity eluted from gel filtration with an apparent mo-
`lecular size of 120 kDa. SDS-PAGE revealed the presence of
`several polypeptides in the purified preparation but no
`polypeptide of 120 kDa (Fig. 4A), indicating that the native
`enzyme may be multimeric or exist as a complex. The catalytic
`polypeptide was identified using the irreversible inhibitor of
`serine-type proteases DFP. First, DFP was shown to inhibit the
`purified activity (Fig. 4B), and then an aliquot of the purified
`activity was incubated with [3H]DFP and analyzed by SDS-
`PAGE and radiofluorography. As can be seen in Fig. 4A, a
`
`Page 3 of 6
`
`

`

`34056
`
`QPP, an Amino-terminal Proline-specific Dipeptidase
`
`FIG. 4. Purification of QPP. A, silver stain and [3H]DFP labeling of
`active site serine of 1000-fold enriched fraction run on SDS-PAGE and
`visualized by autoradiography. B, inhibition profile of QPP Ala-Pro-
`AFC cleaving activity by DFP. Untreated QPP showed an activity of
`2.03 3 103 nM min21 mg21.
`
`tide sequence of the full-length cDNA encoding QPP was un-
`ambiguously determined by sequencing both strands.
`The cDNA encodes a protein of 492 amino acids with a
`predicted molecular mass of 54.3 kDa. It appears to contain the
`complete open reading frame, because the nucleotide sequence
`around the initiating methionine conforms to the Kozak con-
`sensus (14), and the cDNA contains a polyadenylation signal
`and poly(A) tail. Furthermore, the QPP cDNA contains the
`consensus sequence for the active-site serine residue of serine-
`type proteases, Gly-Xaa-Ser-Xaa-Gly (Fig. 5A). As Fig. 5B
`shows, QPP protein bears strong homology to PCP (Ref. 8; 42%
`identity), particularly at the putative active site residues. It is
`interesting that these two post-proline cleaving enzymes have
`strong sequence homology, even though QPP is an aminodipep-
`tidase, whereas PCP is a carboxypeptidase. QPP also shows
`homology to hypothetical proteins obtained from the Caenorh-
`abditis elegans EST data base (Fig. 5 C). There is a remarkable
`conservation at and around the active-site residues, suggesting
`an evolutionary link.
`QPP cDNA Codes for a Functionally Active Protease—North-
`ern blot analysis of Jurkat T cells and PBMCs shows that QPP
`is expressed in both of these cell types (Fig. 6A). Using a QPP
`cDNA probe the Northern analysis revealed a band of 1.7
`kilobases that corresponds to QPP. To determine whether the
`QPP cDNA encodes an active protease, we transfected 293T
`human fibroblasts with QPP cDNA cloned into the pCIneo
`expression vector. Ala-Pro-AFC cleaving activity was measured
`from lysates of these samples at neutral pH. We found that
`extracts of fibroblasts transfected with the QPP cDNA con-
`tained severalfold higher specific Ala-Pro-AFC cleaving activ-
`ity than cells transfected with the pCI-neo vector alone (Fig.
`6B). Recombinant QPP exhibits a pH profile similar to that of
`native QPP (Fig. 3B). The discrepency between the units of
`
`FIG. 3. pH profile of purified QPP. Ala-Pro-AFC cleaving activity
`was assayed using 170 mM cacodylate, 50 mM HEPES, or 50 mM HEPBS
`buffer. A, native QPP purified from Jurkat cells. B, recombinant QPP
`expressed in 293T human fibroblasts.
`
`single polypeptide of 58 kDa was labeled compared with three
`bands seen by silver staining. The corresponding band was
`excised from a Coomassie Blue-stained gel and submitted for
`tryptic digestion and amino acid sequence analysis (Harvard
`Microchemistry Facility).
`Cloning of cDNA Encoding QPP—Four peptides were suc-
`cessfully isolated and sequenced (Fig. 5A). The peptide se-
`quences were used as virtual probes to search translations of
`the EST data base. Four overlapping EST clones were identi-
`fied and sequenced. The largest clone, EST 69230, contained
`1.23 kilobases of sequence including a polyadenylation signal
`and poly(A) tail and encoded the three peptides obtained from
`the tryptic digest, GT69, GT103, and GT148. The 59 end of the
`cDNA was isolated by RACE polymerase chain reaction from
`human leukocyte cDNA and was found to encode the fourth
`peptide, GT85. The RACE product was ligated to EST 69230 at
`MstII to form a full-length cDNA of 1.7 kilobases. The nucleo-
`
`Page 4 of 6
`
`

`

`QPP, an Amino-terminal Proline-specific Dipeptidase
`
`34057
`
`FIG. 6. Recombinant QPP is functional and similar to native
`QPP. A, Northern blot analysis of Jurkat clone J7.7 and PBMCs using
`a full-length QPP probe. B, Ala-Pro-AFC cleaving activity of lysates
`made from control (vector-transfected) and QPP cDNA-transfected
`293T cells. Experiments were done in triplicate, and error bars repre-
`sent S.D. C, recombinant QPP has a similar Ki for VbP as native QPP
`and shows the same level of inhibition with phenylmethylsulfonyl
`fluoride.
`
`DISCUSSION
`QPP was biochemically purified from CD26/DPPIV2 Jurkat
`cells, sequenced, and cloned. The translated product contains
`the consensus sequence for the active site of a serine-type
`protease, in agreement with the aminodipeptidase inhibitor
`profile. The purified activity eluted from gel filtration chroma-
`tography with an apparent molecular size of 120 kDa but ran
`as a [3H]DFP-labeled band of 58 kDa on SDS-PAGE, indicating
`that the native enzyme may be oligomeric or exist as a complex.
`A search of the Swissprot data base for similar proteins pro-
`duced surprising results: PCP (8) bore significant amino acid
`sequence homology to QPP, whereas CD26/DPPIV did not. The
`sequence of QPP also bears similarity to the limited sequence
`available of porcine DPPII (15). It is interesting to note that
`there is significant protein homology between human QPP and
`three C. elegans proteins. Such conservation may imply an
`important role for this gene family.
`Alignment of QPP and PCP revealed a striking degree of
`sequence conservation around the active-site residues of PCP
`(Fig. 5). Serine-type peptidases catalyze the hydrolysis of pep-
`tide bonds through a charge relay system. This catalytic mech-
`anism is dependent on three active-site amino acid residues,
`serine, histidine, and aspartic acid. These residues are scat-
`
`FIG. 5. QPP sequence and alignments. A, deduced amino acid
`sequence of QPP, showing tryptic peptide overlap (underline) and con-
`sensus sequence for the active-site serine residue of serine-type pro-
`teases Gly-Xaa-Ser-Xaa-Gly (double underline). B, sequence alignment
`of QPP and PCP. Stars indicate identity, and active-site residues are
`shown in boldface. C, amino acid alignment of the active-site residues
`for QPP, PCP, and the three C. elegans hypothetical proteins YO26,
`YOG1, and YM67. Sequences around the active-site residues are shown
`in boldface.
`
`specific activity of the pH profiles of the native and recombi-
`nant QPP is attributable to the fact that the recombinant QPP
`was only partially purified. This presence of extraneous pro-
`teins results in a decrease in specific activity. However, the
`general trends of the pH profile mirror those of native QPP.
`Additionally, recombinant QPP has a similar Ki for VbP as
`native QPP and exhibits the same level of inhibition with
`phenylmethylsulfonyl fluoride (Fig. 6C). These results show
`that the cloned cDNA is full-length and encodes an active QPP
`protease, the activities and characteristics of which mimic the
`native QPP.
`
`Page 5 of 6
`
`

`

`34058
`
`QPP, an Amino-terminal Proline-specific Dipeptidase
`
`tered throughout the primary structure of the protein but are
`brought into close proximity in the properly folded enzyme,
`forming the active site. Identification of the positions of these
`amino acids either experimentally or by comparison of the
`sequences of homologous enzymes is useful for the classifica-
`tion of the serine proteases into families, which are further
`grouped into clans. The members of a clan are groups of fam-
`ilies thought to have common ancestry (16, 17), preferably
`identified by similarities in tertiary structure. However, the
`tertiary structure of most enzymes is unknown; therefore, the
`order of the catalytic residues in the sequence is commonly
`used. The catalytic residues in the sequences of QPP and PCP
`are ordered serine, aspartic acid, and histidine. This arrange-
`ment and the homology of QPP and PCP (42% amino acid
`identity over their entire open reading frame) place QPP in the
`serine-type peptidase clan SC, family S28, with PCP. Recently,
`DPPII was assigned to this family, based on its amino-terminal
`sequence similarity to PCP and specificity for prolyl bonds (17).
`As mentioned earlier, QPP and DPPII may be closely related
`despite certain differences in physical properties.
`In terms of substrate specificity, QPP resembles CD26/DP-
`PIV and DPPII. QPP and CD26/DPPIV, however, have dissim-
`ilar cDNA structures and no significant amino acid homology.
`Furthermore, a detailed analysis of QPP and CD26/DPPIV
`activity revealed differences in their inhibitor profiles, indicat-
`ing differences in the catalytic sites of the two proteases. Before
`obtaining the QPP cDNA, we had assumed that QPP and
`CD26/DPPIV had evolved from a common ancestral gene. Al-
`though this is clearly not the case, our results indicate that
`QPP is related to DPPII and PCP.
`It is interesting to note that QPP is able to cleave the sub-
`strate Ala-Pro-AFC over a broad pH range, from acidic to
`neutral pH. Typically, enzymes do not exhibit activity over
`such a wide pH range. There are a few exceptions, however,
`including cathepsin B, a cysteine protease that catalyzes toxin
`proteolysis in endosomes, which is active from acidic to neutral
`pH (18). Recent results show that QPP may indeed localize to
`the endosomal and lysosomal compartment and a secretory
`pathway,2 explaining its ability to function over a broad pH
`range. Further work is being done to explore these and other
`possibilities.
`Although QPP is expressed in resting and activated PBMCs
`as well as Jurkat cells, we have observed that blocking QPP
`leads to cell death exclusively in resting PBMCs (9). It is likely
`that QPP has many substrates that are processed in the cell,
`only some of which are necessary for survival of resting PB-
`MCs. Activated PBMCs and transformed cells are very differ-
`ent from resting cells in both gene expression and cell cycle
`
`2 M. Chiravuri, F. Agarraberes, S. Hurta, K. Yardley, H. Lee, and
`B. T. Huber, manuscript in preparation.
`
`progression and may not produce the same substrates as rest-
`ing cells or may not require the products of QPP for survival.
`Efforts are under way to identify the natural substrates of QPP
`as well as to elucidate the mechanisms of this cell death
`pathway.
`Proteases cleave substrates at little energy cost to the cell
`and may be important mediators of homeostasis in metaboli-
`cally inactive quiescent cells. We have recently observed that
`post-proline aminodipeptidase inhibitors cause apoptosis in
`quiescent cells and that QPP is a likely target of these inhibi-
`tors. A large number of signal molecules have a highly con-
`served Xaa-Pro motif on the amino terminus, whereas there
`are relatively few enzyme activities that have the ability to
`cleave peptide bonds containing proline (1). The isolation and
`cloning of QPP will help us understand the role of post-proline
`cleavage in the regulation of proteins with an amino-terminal
`Xaa-Pro motif.
`
`Acknowledgments—We thank the following people for providing us
`with valuable reagents: R. Snow for VbP, Lys-thiazolidide, and Lys-
`piperidide; J. T. Welch for L-125; and R. Burton for Jurkat cell pellets.
`We also thank Jaison Paliakkava for assistance in protein purification
`and Julie Anselmo, Lia Kim, and Suzanne Hurta for excellent technical
`assistance. Partial support for initial protein purification was provided
`by Boehringer Ingelheim Pharmaceuticals, Inc.
`
`REFERENCES
`1. Vanhoof, G., Goossens, F., De Meester, I., Hendriks, D., and Scharpe, S. (1995)
`FASEB J. 9, 736–744
`2. Morimoto, C., and Schlossman, S. F. (1998) Immunol. Rev. 161, 55–70
`3. von Bonin, A., Huhn, J., and Fleischer, B. (1998) Immunol. Rev. 161, 43–53
`4. Oravecz, T., Pall, M., Roderique