Ew: J. Biochem. 267,6140-6150 (2000) ©FEES 2000
`
`Cloning, expression and chromosomal localization of a novel human
`dipeptidyl peptidase {DPP) IV homolog, DPP8
`
`Catherine A. Abbott1
`and Mark D. Gorrell 1
`
`, Denise M. T. Yu1
`
`·"'. Erica Woollatt 2
`
`, Grant R. Sutherland2
`
`, Geoffrey W. McCaughan1
`
`lA W i\1onow Ga.<troentewlogy and Li·ve1 Centre, Royal Prince Aljied Hospital, Centenary Institute of CrtnLer _Mediteine and Cell Biology
`and The University of Sydney, NSVV, Australia; 2Centre for Medical Genetics, Department of Cytor;enetics and Molecular Genetics,
`Women's and Children's Hospital, Adelaide, SA, Australia
`
`Dipeptidyl peptidase (DPP) IV has roles in T-cell costimulation, chemokine biology, type-II diabetes and
`tumor biology. Fibroblast activation protein (FAP) has been implicated in tumor growth and cirrhosis. Here we
`describe DPP8, a novel human postproline dipeptidyl aminopeptidase that is homologous to DPPTV and FAP.
`Northern-hlot hyhridi7ation showed that the tissue expression of DPP8 mRNA is ubiquitous, similar to that of
`DPPTV. The DPP8 gene was localized to chromosome 15q22, disLincL I rom a closely relaLed gene al 19p 13.3
`which we named DPP9. The full-length DPP8 eDNA codes for an 882-amino-acid protein that has about 27%
`identity and 51% similarity to DPPIV and FAP, but no transmembrane domain and no N-linked or 0-linked
`glycosylation. Westem blots and confocal microscopy of transfected COS-7 cells showed DPP8 to be a l 00-kDa
`monomeric protein expressed in the cytoplasm. Purified recombinant DPP8 hydrolyzed the DPPIV substrates
`Ala-Pro, Arg-Pro and Gly-Pro. Thus recombinant DPP8 shares a postproline dipeptidyl aminopeptidase activity
`with DPPIV and FAP. DPP8 enzyme activity had a neutral pH optimum consistent with it being nonlysosomaL
`The ~imilarities between DPP8 and DPPIV in tissue expression pattern and substrates suggests a potential role lor
`DPP8 in T-cell activation and immune function.
`
`Keywords: dipeptidyl peptidase; fibroblast activation protein; postproline peptidase; prolyl oligopeptidase; serine
`proteina~e.
`
`Very few enzymes are able to cleave the prolyl bond. The most
`widely studied of these enzymes is a 766-amino-acid, type-II
`integral membrane protein dipeptidyl peptidase (DPPJ IV (EC
`3.4.14.5). DPPIV also has a soluble form that lacks the
`transmembrane domain [1 ,2]. The tertiary structure of DPPTV
`contains an N-terminal seven-blade [:!-propeller domain and a
`C-terminal a/!3-hydrolase domain [3]. DPPIV cleavage of
`specific substrates results in alterations in their biological
`activities. These >mbstrates include certain chemokines, growth
`
`Correspondence tv C. A. Abbott, Cenc<;;nary Insticutt: of Cilllcer Meuicin"
`and Cell Biology, Locked Bag No. 6, Newtown. KSW 2042, Au"t.-alia.
`Fax: 61 2 95656101, TeL: 61 2 95656161,
`E-mail: c.abbott @centenary.usyd. edu.au
`Abbreviations: DPP, dipeptidyl peptidase; EST, expressed sequence tag;
`FAP, fibroblast activation protein; GJPDH, glyceraldehyde-3-phosphate
`dehydrogenase; NA, nitroanilide; PEP, prolyl endopeptidase; PBMC,
`peripheral blood monocyte; stPBMC, peripheral hlr;od monocyte
`stimulated with phytohaemagglutinin_
`Enzymes: dipeptidyl peptidase lV (P27487, EC 34.14.5); prolyl
`endopeptidase (P48147, EC 3.4.21.26); acylarninoacyl peptidase (Pl3798,
`EC 3.4.19.1); fibroblast activation protein (GenPept: g1RRR316); DPPIV-f3:
`attractin (GenPept: g3676347); quiescent peptidyl peptidase (GenPept:
`g6465985); N-acetylated alpha-linked acidic dipeptidase II (GenPept:
`g;4539525).
`lVote: nudeutiUe seyuerH.:es reported iu this paper have. bt:eu subruitted to
`the GenBank™ databank witl1 accession numbers Al-221634, AF221635,
`AF221636, AF221637.
`*Present addrt·ss: Department of Cancer Genetics, Kolling Institute of
`l\ledrcal Research. Royal North Shore Hospital, Sydney. NSW, Australia.
`(Received 28 April 2000, accepted 30 June 2000)
`
`factors such as glucagon and glucagon-like peptides 1 and 2,
`neuropeptides including neuropeptide Y and ~ub~tance P and
`vasoactive peptides [ 4-6]. The N terminal truncation of the
`chcmokincs RANTES (regulated on activation normal T cell
`expressed and secreted), eotaxin, macrophage-derived chemo(cid:173)
`kine and stromal-cell-derived factor-1 alters
`the receptor
`specificities of these chemokines, potentially altering
`the
`Thl/Th2 balance of an immune response towards Thl [5].
`DPPIV/CD26 expre~~ion is ubiquitous but is significantly
`upregulated on activated T, Band NK cells [7-11 ]. The role of
`DPPIV/CD26 in immune activation involves both its enzyme
`activity and its non-catalytic activity, which is the ability to
`bind adenosine deaminase [5, 12- 14] DPPTV is in the peptidase
`family S9b, which along with prolyl endopeptida~e (PEP, S9a)
`and acylaminoacyl peptidase (S9c)
`[15]
`fom1
`the prolyl
`oligopeptidase farnily. We have proposed that DPPIV, fibroblast
`activation protein
`(FAP)
`[16,17] and dipeptidyl amino(cid:173)
`peptidase-like protein (DPP6) [18] form a DPPlV-like gene
`family which corresponds to peptidase family S9b [19]. We
`have compared DPPTV and 1-'AP in detail [5]. f'AP is selectively
`expressed by stromal fibroblasts of tumors and healing wounds
`[16] and by activated hepatic stellate cells [20]. FAP has
`postproline dipeptidyl aminopeptidase activity similar to but
`distinct from that of DPPIV, has gelatinase activity and binds to
`a 3 ~ 1 and a 5 ~ 1 integrin [20-24].
`Recently, novel enzymes have been reported with substrate
`specificities similar to DPPIV DPPIV-!3 is a cell surface
`glycoprotein ol 82 kDa that binds DPPTV inhibiLOrs but with
`less affinity than DPPIV, and no ~equence data for this enzyme
`is available [25]. Attractin (DPPT-L) is a 175-kDa soluble
`glycoprotein reported to hydwlyze Gly-Pro [26]. Attractin
`
`AstraZeneca Exhibit 2166
`Mylan v. AstraZeneca
`IPR2015-01340
`
`Page 1 of 11
`
`

`
`©FEES 2000
`
`A novel dipeptidyl peptidase (Ew: 1. Binchem.. 267) 6141
`
`contains a kelch repeat domain [27] and shares no significant
`sequence homology with DPPIV or any other peptidase. Two
`other peptidases have been reported to hydrolyze Gly-Pro, but
`are structurally unrelated to DPPIV: the carboxypeptidase,
`quiescent peptidyl peptidase [28], and the glutamate carbox(cid:173)
`peptidase, N-acetylated alpha-linked acidic dipeptidase II [29].
`Thus, new enzymes of this family or enzymes of similar
`function hut different structure are emerging. Judging from
`the critical roles of DPPTV and FAP in biological pr-ocesses
`of cellular activation, inflammation and tissue remodeling,
`additional family members are likely to play a similar role in
`these and other biological processes. Hence the aim of this
`study was to characterize a novel peptidase related to DPPIV in
`both substrate specificity and structure.
`This study describes the cloning of a full-length eDNA,
`chromosomal localization, expression and functional charac(cid:173)
`terization of a novel human peptidase, dipeptidyl peptidase 8
`(DPP8). Biochemical characterization of this novel protein
`revealed that it has enzyme activity similar to that of DPPTV
`and FAP and is upregulated during immune activation.
`
`EXPERIMENTAL PROCEDURES
`
`General
`
`Restriction and other enzymes used in cloning were obtained
`from Boehringer Mannhcim Roche. Standard molecular
`biology techniques were used [30] unless indicated otherwise.
`The collection of specimens used in this study was approved by
`the Royal Prince Alfred Hospital human ethics committee.
`
`Cell culture and RNA preparation
`
`Human peripheral blood monocytes (PBMCs) were isolated
`by Ficoli-Hypaque density-gradient centrifugation (Amersham
`Pharmacia Bimech, Uppsala, Sweden) of blood obtained from
`healthy donors. The PBMCs were incubated in ATM-V medium
`(Life Technologies, Gaithersburg, MD, 1.~SA) supplemented
`with 2 mM L-glutamine and were stimulated with either
`I ]-Lg·mL - 1 phytohaemagglutinin (Wellcome) or 100 ng-mL - 1
`OKT3 (Orthoclone, Ortho Biotec Ravitan, NJ, USA) for 72 h.
`The human cell lines Jurkat, CCRF-CEM, Raji, Daudi and
`HcpG2 were grown to confluence in Dulbccco's modified
`Eagle's medium (Trace Biosciences, Sydney, NSW, Australia)
`supplemented with 1 0% fetal bovine serum and 2 mM L(cid:173)
`glutarnine.
`Liver and placental RNA were prepared from snap-frozen
`human tissue as described previously [31]. However, RNA was
`prepared from PBMCs and cell lines using an RNAeasy kit
`(Qiagen, Hilden, Germany).
`
`Bioinformatics
`
`m.AST searches [32] and all multiple sequence alignments were
`perfonned through the Australian National Genomic Infonna(cid:173)
`tion Service (ANGIS, Sydney, NSW, Au~tralia). PILEUP (GCG
`Version 8, Genetics Computer Group, Madison, WT, USA) was
`used for multiple sequence alignments of proteins.
`A BLAST search was performed on the public expressed
`sequence tag (EST) database using the complete human
`DPPIV {GenBankTM accession number X60708) and FAP
`{accession number U09278) nucleotide sequences as query
`sequences. An EST clone (accession number AA417787)
`was obtained from the American Type Culture Collection.
`The DNA insert of this clone was sequenced on both strands
`
`usmg automated sequencing at SUPAMAC (Sydney, NS\V,
`Australia). Because of its homology with DPPIV, this new gene
`was named dipeptidyl peptidase 8 (DPP8).
`
`Cloning of DPP8 eDNA
`
`The DPP8 EST sequence was w,ed Lo design the forward
`primer, DPP8-pr1
`(CAAATAGAAATTGACGATCAGGTG)
`and the reverse primer DPPR-pr2r (TCTTGAAGGTAGTG(cid:173)
`CAAAAGATGC) for PCR from the EST eDNA. The PCR
`conditions were 94 °C for 5 min, fallowed by 35 cycles of 94 °C
`for 1 min, 55 oc for 30 s and 70 "C for 1 min. This 484-bp
`PCR product was gel-purified, 32"P-labclcd using a Mcgaprimc
`Labeling Kit (Amersham Pharmacia Biotec) and hybridized to
`a Master RNA blot (Ciontech, Palo Alto, CA, USA), which
`contained poly(A)-rich RNA from 50 adult and fetal tissues
`immobilized in dots, in accordance with the manufacturer''
`instructions. The 484-bp D"P"PS PCR product was used to screen
`a human placental A. STRETCH PLUS library (Clontech) using
`standard methods. For the tertiary screen, the clones contained
`in A TriplEx were converted into pTriplEx p1asmids and
`transformed inLu BM25.8 Escherichia coli recipient bacteria.
`The clones were retransformed
`into MC1061 F:. coli fur
`subsequent DNA purification. The DNA wa:;; then sequenced
`using M 13 forward and reverse and primer walking.
`
`5' RACE
`
`A 5' RACE version 2.0 kit (Lite Technologies) was applied to
`phytohaemagglutinin-stimulated PBMC (stPBMC) and placen(cid:173)
`tal RNA according to the kit instructions. The sequence of the
`T8 library clone was used to design GSPI (TCCTTCCTTCAG(cid:173)
`CATCAATC)
`and GSP2
`(CTTAAAAGTGACTTTAG(cid:173)
`GATTTGCTGTACC). 5' RACE PCR products were cloned
`into pGEM-T Easy® vector (Promega, Madison, WT, USA) and
`sequenced using l\1[13 forward and reverse primers and by
`primer walking. To confirm that the 5' RACE product was
`DPP8, RT-PCR on stPBMC RNA used the primers DPP8-pr23
`(GGAAGAAGATGCCAGATCAGCTGG)
`and DPPR-prl9r
`(TCCGTGTATCCTGTATCATAGAAG) to span the junction
`between the 5' RACE product and the EST clone AA417787.
`This PCR yielded two products, stPBMCdy3-2-l (1602 bp) and
`stPBMCdy3-3-10 (1083 bp), which were gel purified and
`cloned into pGEM-T Easy\!\l and subsequently ,;equenced.
`
`Subcloning of DPPBcDNA into a pcDNA3.1/VS/His expression
`vector
`
`The stPBMC RACE product, the stFBMCdy3-2-l ( 1602 bp)
`junction fragment and the library clone T21 were joined
`together and cloned into the expression vector pcDNA3.1/V5/
`HisA (InviLrogen BV. Groningen,
`the Netherlands). This
`crealed a DPP8 eDNA of 3.1 kb with an ORF of 882 amino
`acids. The first construct was made using three sequential
`cloning steps. First, an EcoRV-Xbal fragment ofT21 (contain(cid:173)
`ing 3' DPP8, stop codon and 3' UTR on DPPR eDNA) was
`ligated into EcaRV-XbaT-digested pcDNA3.1N5/HisA vector
`Secondly, an EcoRI-EcoRV fragment of stPBMCdy3-2-1 was
`then added to this construct digested with EcoRI-EcoRV.
`Finally the 5' RACE product was cut with EcoRI and cloned
`into the EcoRI site of the previous con,;truct to form the
`complete 3.1-kb DPP8 eDNA. This construct, pcDNA3.1-
`DPP8, expressed DPP8 protein with no tag.
`Tn addition,
`the stop codon
`in
`the DPP8 expression
`construct in pcDNA3.1N5/HisA was altered using PCR to
`
`Page 2 of 11
`
`

`
`6142 C. A. Abbott et al. (Ew: J. Binchem. 267)
`
`© FEBS 2000
`
`create a C-terminal fusion with the VS and His tag contained in
`the vector. This construct was named pcDNA3.1-DPP8N5/His.
`All expression constructs subcloned into pcDNA3.1 /VS/His
`were verified by full sequence analysis.
`
`Chromosomal localization of DPPB by fluorescence in situ
`hybridization analysis
`
`DPP!'i was localized using two different probes, the DPP!'i
`EST and the T8 clone. The probes were nick-translated with
`biotin-14-dATP and hybridized in .~ill/ at a final concentration
`of I 0 ng·j.LL -I lo melaphases from lwo normal males. The
`fluorescence in situ hybridization method was modified from
`that previously described [33]
`in that chromosomes were
`stained with both propidium iodide and 4,6-diamidino-2-
`pheny lind ole.
`
`DPPB gene expression analyzed by Northern blot
`
`Human multiple-tissue Northern blots (Clontech) contammg
`2 j.Lg poly(A)-rich RNA were prehybridized
`in Express
`Hybridization solution (Clontcch) for 30 min at 68 oc. Both
`the DPPS 484-bp product and the 5' RACE stPBMC product
`were radiolabeled using the Megaprime Labeling kit and
`32P]dCTP (NEN Life Science, Boston, "\1A, USA). Unin(cid:173)
`[
`corporated label was removed using a NICK column (Amer(cid:173)
`sham Pharmacia Biotech), and the denatured probe was
`incubated with the blot for 2 h at 68 oc in Express Hybridiza(cid:173)
`tion solution. Washes were performed at high stringency, and
`blots exposed to BIOMAX MS film overnight with a BioMax
`(Kodak, Rochester, USA) MS screen at -70 °C.
`
`Expression of DPPB in human lymphocytes and cell lines
`
`RNA (1 j.Lg) was reverse-transcribed using the Superscript II
`enzyme kit (Gibco-BRL) as described previously [34]. PCR
`using DPP8-pr18 (CTGTGACGCCACTAATTATCTATG) as
`the forward primer and DPP8-pr26R (CCTAGAGAGGC(cid:173)
`TAGGGTATTCAAG) as the reverse primer was used to detect
`full-length DPP8 mRNA. The glyceraldehyde-3-phosphate
`dehydrogenase (G3PDIT) control primer set was G3PDII for
`{ACCACAGTCCATGCCATCAC) and G3PDHrev (TCCAC(cid:173)
`CACCCTGTTGCTGTA) to give a 4 70-bp product.
`eDNA (diluted I : 4; I [.Lg) was amplified in a 25-I.J.L PCR
`mixture which contained: 0.2 mM dNTPs, 0.125 unit Amplitaq
`Gold enzyme (PerkmElmer), I x buffer II (Perkin-Elmer),
`1.5 mM MgCl2 and 100 ng·mL - 1 each primer. The 35-cycle
`PCR was performed as follows: denaturation at 94 oc for
`1 min, primer annealing at 55 "C for 30 s, and an extension
`step at 72 oc for 1 min. The amplified products were analyzed
`by electrophoresis of 15 j.LL PCR mixture on a 3 : I Nusieve
`gel
`(FMC Bioproducts, Rockville. MD, USA)
`plus
`0.5 f.Lg·mL - 1 ethidium bromide in Tris/acetate/EDTA huffer
`(0.04 M Tris/acetate, 0.001 M EDTA, pH 8.0).
`
`Transfection. Western blot. immunocytochemistry.
`cytochemistry and flow cytometry
`
`Monkey kidney fibroblast (COS-7) cells (American Type
`Culture Collection, CRL-1651) were grown and transfected as
`described previously [3]. For making stable cell lines, Geneticin
`{G418; Life Technologies) was added to the medium, beginning
`24 h after transfection. COS cell extracts were prepared hy
`sonication followed by differential centrifugation and neither
`boiled nor reduced before SDS/PAGE ( l 0% gel) and transfer to
`nitrocellulose, as described previously [I ,20]. The presence of
`DPP8 fused with the V5 cpitopc was detected using an anti-V5
`mAb (Invitrogen). COS cell monolayers were fixed in cold
`ethanol before staining with anti-V5 mAb r3,9,20l. Some
`monolayers were fixed in 4% paraformaldehyde and permea(cid:173)
`bilized with 0.1% Triton X-100 [35], then double-stained with
`wheat germ agglutinin to label Golgi apparatus and with goat
`anti-mouse IgG to label DPP8, conjugated to Alexa Fluor 488
`and Alexa Fluor 594, respectively (Molecular Probes, Eugene,
`OR, USA). Flow cytometry and confocal scanning microscopy
`using a Leica TCS-NT confocal microscope have been
`described previously [3,20].
`
`Purification of recombinant DPPSIVS/His and DPPIVIVS/His
`Cells (1 x 10 7
`) expressing each protein were sonicated in
`native buffer (50 111M sodium phosphate, 300 mM NaCI), then
`treated with 700 U DNAse for 20 min al room temperature.
`DPPIV is expressed at the cell surface, so I% Triton X-1 00 was
`used to solubilize DPPIVNS/His. Insoluble material was
`removed by centrifugation. The supernatant was incubated
`with I mL Tdlon@ Metal Affinity Resin (Ciontech) following
`the manufacturer's
`instructions for a batch/gravity flow
`procedure. The resin was washed with 50 mM sodium
`phosphate, containing 300 mM NaCl and 5 mM imidazole,
`and proteins were eluted using the same buffer containing
`150 mM imidazole. Enzyme activity was used to monitor eluted
`fractions.
`
`Enzyme assays
`
`Enzyme assays were performed as described previously [ 19].
`Either clarified cell extract from I x I 04 sonicated COS-7
`cells or purified protein derived from 1 x 105 cells was
`incubated with substrate in 70 j.LL phosphate buffer, pH 7.4, for
`30 min ac 37 °C, except where otherwise
`indicated. The
`spee1fic DPPIV substrates Gly-Pro-toluenesulfonate, H-Gly(cid:173)
`Pro-p-nitroanilide (NA)/HCl (Sigma, St Louis, MO, USA) and
`G1y-Pro-7-amino-4-trifluromethylcoumarin (Calbiochem, San
`Diego, CA, USA) were tested. Other substrates tested were
`H-Aia-Pro-pNA/HCl, H-Arg-Pro-pNA acetate salt, H-Lys(cid:173)
`Ala-pNA.2HCl, H-Asp-Pro-pNA, H-Ala-Ala-pNA/HC1, H-Aia(cid:173)
`Aia-Pro-pNA/HCI, H-Ala-Ala-Phe-pNA, succinyl-Ala-Pro-pNA,
`H-Ala-Phe-Pro-pNA and Z-Ala-Pro-p-NA from Bachem AG
`(Buhendorf, Switzerland). H-Aia-Pro-4-methoxyf3NA/HC!, Z(cid:173)
`Lys-Pro-4-methoxyi'\NA fonnate salt, H-Lys-Pro-4-methoxy
`
`Fig. 1. Alignment of the deduced amino-acid sequence of DPP8 with the C. elegans homolog of DPP8 and human DPPIV. Amino-acid residues are
`ntnnbcrcd in the right 1nargin. Anrino-acid residues identical in all three proteins arc boxed. Asterisks mark the putative catalytic triad residues and the twu
`glmamates of the J3·propeller domain essential for DPPIV enzyme activity [19 J. The gray shading denotes the a/J3-hydrolase domain of these proteins. Filled
`triangles JOmed by lines indicate starts and ends of alternatively spliced transcripts, stPBMCdy3-3-1U (wlid lines), Til (dashed lines) and T~l (whd hnes).
`This alignn1ent was constructed using the PILEUP progran1 in GCG.
`
`Page 3 of 11
`
`

`
`©FEES 2000
`
`A novel dipeptidyl peptidase (Ew: 1. Binchem.. 267) 6143
`
`Page 4 of 11
`
`

`
`6144 C. A. Abbott et al. (Ew: J. Binchem. 267)
`
`© FEBS 2000
`
`MTNTM II
`
`MTN™
`
`tb
`
`... -
`
`4. •
`
`--.
`
`Fig. 2. Northern-blot analysis of DPP8
`expression. Hutnan multiple-tis~ue Northern
`(MTN) blots (Clontech) containmg 2 f.1g per
`lane of poly(AI-rich RNA were hybridized with
`a 32P-labekd DPP8 probe at 6R "C and washed
`at high stringency. Autoradiogmphic exposure
`wa' overnight at -70 'C with a BiuM<Lx MS
`screen. Size markers are indicated in kb on the
`left of each autoradiogram.
`
`~NA/HCl, Z-Ala-Pro-4-methoxy~NA. H-Gly-Pro-~NA and H(cid:173)
`His-Ser-4-methoxy~NA acetate salt (Bachem AG) were tested
`for their ability to :>tain unfixed transfected cells.
`All inhibitors were incubated with each purified enzyme in
`pho~phate buffer, pH 7.4, for 15 min before the addition of
`substrate. After the addition of 1 mM H-Aia-Pro-pNA substrate
`for purified DPP8 and 1 mM H-Gly-Pro-pNA substrate for
`purified DPPTV, samples were incubated for 60 min at 37 oc.
`All enzyme assays were performed in triplicate.
`
`RESULTS
`
`Molecular cloning and sequence analysis of DPPB eDNA
`
`The EST AA417787, derived from human tonsil, contained an
`insert 795 bp in length, encompassing 527 bp of coding
`sequence, a TAA stop codon and 258 bp of 3' noncoding
`sequence. The 178 amino acids encoded by this sequence had
`36% amino-acid identity with and 58% amino-acid similarity to
`a C-terminal portion of human DPPTV A BLASTp search into
`protein databases revealed that the EST AA4177'!57 had 46c/c
`amino-acid identity with and 70% amino-acid similarity to an
`uncharacterized Caenorhabditis elegans protein which we
`called the C. elegans homolog of DPP8 (accession number
`g2804453).
`The Master RNA blot revealed that DPP8 had ubiquitous
`mRNA expression, with
`the mmt
`intense hybridization
`signals in testis and placenta (data not shown). Only two of
`23 dunes obtained by screening a placental eDNA library
`contained 5 1 sequence additional to that of the TJPP8 F.ST
`These eDNA clones were designated T8 (accession numbn
`AF221636) and T21 (accession number AF221635), and were
`1669 bp and 1197 bp, respectively. Tn addition, comparison
`of these sequences with the DPP8 EST revealed that the T8
`eDNA lacked a 153-bp (51-amino-acid) region
`that was
`the DPP/5 EST.
`present
`in both
`the T2l eDNA and
`Significantly, this 51-amino-acid region includes the catalytic
`serine (Fig. 1).
`The 5' RACE technique was applied to both stPBMC
`RNA and placental R:'\l"A to obtain the 5' end of the DPP8
`gene. The 5' RACE product obtained from stPBMC RNA was
`
`0.2 kb larger than that from placental RNA but otherwise
`identicaL The first methionine within a Kozak sequence was
`found 214 bp from the 5' end of the stPBMC RACE product.
`To confirm the identity of the 5' RACE product as the 5' of
`DPP8, RT-PCR was carried out on a region ,;panning the
`junction between the 5' RACE product and the T8 eDNA
`library clone. The RT-PCR on stPBMC RNA produced two
`clones, stPBMCdy3-2-1 and stPBMCdy3-3- 10. Compared with
`T8 and T2l, both clones had an additional insert region of
`144 bp (48 amino acids) immediately adjacent tu the splice site
`of TR. Sequence homology analysis of this additional insert
`region found an hornologous region in both DPPIV and the
`C. elegans homolog of DPPS. This indicated that the library
`clones T8 and T21 represented splice variants of DPP8.
`Furthermore, the smaller clone stPBMCdy3-3-10 (accession
`number A "P22163 7) was found to represent a third splice variant
`of DPP8 as it contained a 519-bp deletion at the 5' end which
`would result in a deletion of 175 amino acids.
`A full-length DPP8 clone (accession number AF221634)
`wa,;
`constructed using
`the
`larger 5' RACE product,
`stPBMCdy3-2-1, and clone T21. This generated a putative
`DPP8 eDNA of 3.1 kb (including 5' and 3' UTRs) with an
`ORF of 882 amino acids. This 882-residue putative DPP8
`protein contained no N-linked or 0-linked glycosylation sites,
`and Kyte-Doolittle hydrophobicity analysis showed no poten(cid:173)
`tial transmembrane domain, unlike DPPTV, FAP and DPP6.
`Human DPP8 protein is homologous with both human
`DPPIV (51% amino-acid similarity, 27% amino-acid identity)
`and human PEP (46% amino-acid similarity, 21% amino-acid
`identity). Significant homology (55% similarity, 32% identity)
`was observed between human DPP8 and the C. elegans
`homolog of DPP8 (Fig. l). A BLASTn search into GenBank
`revealed that the DPP?\ gene had high homology with two
`overlapping cosmids, accession numbers AC005594 and
`AC005783. The,;e cosmids encode a region of the human
`chromosome at 19p 13.3. The gene located in this region is
`39.5 kb in size, contains 19 exons, and encodes a protein of
`= 913 amino acids. The hypothetical protein encoded by the
`Lwo cosmids shared the greatest homology (76% similarity,
`.'il'l% identity) ohserved with DPPR and so was named DPP9.
`The gene structure of DPP9 was elucidated (data not shown).
`
`Page 5 of 11
`
`

`
`©FEES 2000
`
`A novel dipeptidyl peptidase (Ew: 1. Binchem.. 267) 6145
`
`B
`
`A
`
`PBMC
`
`OKT3
`stPBMC
`day3
`
`Fig. 3. RT-PCR analysis of DPP8 expression.
`PCR amplitlcations w1th pmners specitic tor
`ei.ther a portion of human DPP8 that contained
`no altemative splicing, Val416 to Gly679
`(top of each gel) or glyceraldehyde-3-phosphate
`dehydrogenase (G3PDH) (bottom of each gel).
`(A) Top gel. lanes 1-5 contain PCR products
`from unstimulated PBMC eDNA from five
`subjects. Bottom gel, lanes 6-11 contain PCR
`product' from OKT3-stimulated PBMC eDNA
`from six subjects. (B) PCR product; are from
`eDNA from lymphocytic cell lines, liver nr
`placenta as indicated. Ne.gatiYe control
`arnplitications contained Teaction tnix,
`enzyme and no eDNA template. Each PCR
`was performed for 35 cycles. The PCR
`products were electrophoresed on agarose gels
`and stained with ethidium bromide. The left
`lane ot each gel contains PUC 19 digested with
`Haeiii as size markers.
`
`The DPPR gene was predicted to have a structure similar to that
`of DPP9 because the acceptor/donor sites of DPPS splice
`variants aligned with DPP9 exon/intron bmmdaries.
`
`Chromosomal localization of DPPB gene
`
`Two probes were used for fluorescence in situ hybridization
`analysis, the DPP8 EST and the T8 clone from the placental
`library. Seventeen metaphases from the first normal male were
`examined for fluorescent signal. All of these metaphases
`showed signal on one or both chromatids of 15 at band q22
`(data nol shown). There were a Lolal or Lwo non-speciric
`background clots observed in these metaphases. A similar
`result was obtained from the hybridization of the probe to
`15 metaphases from. the second normal male. Subsequent to
`this experiment, we found that the Drr8 EST had been
`clustered as Hs. 72165 on
`the NCBT Unigene Database
`(http://www.ncbi.nlm.nih.gov/UniGene) and had been mapped
`on Gene Map 9g to stSG30lg3, Chr.l5, Dl5SI25-Dl5S216.
`This confirmed our localization to l5q22.
`
`salivary gland, prostate and placenta. There were no signals
`over any of the negative controls on these blots.
`Northern-blot analysis of DPP8 used two probes; the 484-bp
`PCR product prohe from the 3' end of the eDNA (data not
`shown) gave results identical with those of an stPBMC RACE
`probe from the 5' end of the eDNA (Fig. 2). Both probes
`indicated the presence of transcripts in all tissues examined. A
`major transcript of 5.0 kb and a minor transcript of 8.0 kb were
`present at either moderate or high levels in most tissues
`examined. A transcript = 3.0 kb in size was detected only
`in testis. Tn the course of cloning and during RT-PCR gene
`expression analysis of DPPS, various amplified products
`were observed, isolated. and sequenced. These products were
`identified
`as
`splice variants of DPP8. The mRNA
`transcripts resulting from alternative splicing of DPP8 would
`only be 148-519 bp smaller than the full-length transcript, and
`this difference was probably undetectable on the Northern
`hlots. The multiple-tissue ~orthern hlot was pmhed with
`radiolaheled human [3-actin probe to verify equivalent loading
`of mRNA in each lane; a 2.0-kb transcript was common to all
`tissues (Fig. 2).
`
`Tissue distribution of DPPB determined by Master RNA blot
`and Northern blot
`
`Analysis of DPPB gene expression by RT-PCR
`
`The Master RNA blot produced similar hybridization patterns
`with Drrs and DrriV probes (data not shown), indicating
`ubiquitous expression of both mRNAs in all human adult and
`fetal tissues. The most intense hybridization signals using the
`DPP8 probe were in testis and placenta whereas the most
`intense hybridization signals using the VPPTV probe were in
`
`DPPTV is expressed by most lymphocytes and lymphocytic
`cell lines but upregulated on activated lymphocytes [7,9-11].
`The various splice variants of DPP8 might not encode
`functional protein. so the PCR was designed to detect only
`mRNA that contained full-length sequence (.Pig. 1). At 35
`cycles, amplification product of the expected size (783 bp) was
`
`Table 1. Km and Vmax values for DPP8 and DPPIV.
`
`DPPTV
`
`DPP8
`
`H-Ala-Pro-pNA
`H-Gl y· Pro-pNA
`
`0 374 ± 0.134
`0.'147 -'- 0.08R
`
`0.991 ± 0.171
`0.467 -'- 0.064
`
`DPPTV
`
`9.6 ± 1.0
`7.2 -'- 0.49
`
`DPPS
`
`12.4 ± 0.9
`1.5_1_0]4
`
`Page 6 of 11
`
`

`
`6146 C. A. Abbott et al. ( Ew: J. Binchem. 267)
`
`© FEBS 2000
`
`A
`
`--
`
`E
`
`Fig. 4. Rewmbinant DPP8 is a 100-kDa cytuplasmic prutt:in. \Vt:Mt:rn
`blots of lysatcs (A) and pcnncabilizcd parafurmaldchyJc-fixcd monulaycrs
`(B-E) of stably transfcctcd COS-7 cell lines were probed with anti-V5
`mAb. (A) Left hand panel. non-boiled, V5-tagged DPPTV was seen at
`140 kDa, the expected mobility ot DPPIV dimer [3,1 <J.47]. DPPl> protem at
`100 kDa was seen in two different cell preparations of DPP8/V5/His(cid:173)
`transfected celk Right hand panel, boiling (1 00 DC) did not alter the
`electrophoretic mobility of DPP8. DPP8 bands of greater mobilities were
`sometimes seen (third and fifth lanes) and were probably bTeakdown
`products uf intact DPP8. The anti-V5 1nAb is specific fur tagged proteins
`and did not bind DPPIV-transfected or vector-transfeeted stable cell lines
`(;;ixth and ;;eventh lanes). Pluore;;cence confocal micro;;copy showed that
`DPP8 (B. red channel) was localized to the cytoplasm including structures
`bound by wheat germ agglutinin (C, green channel), shown in overlay mode
`(D) and in a fluore,cence intensity profile of the douhle-positiYe cell (E).
`
`readily observed in OKT3-stimulated PBMCs (six of six
`subjects; Fig. 3B) but not in unstimulated PBMCs from most
`subjects (four of five, Fig. 3A), suggesting that more DPP8
`rnRNA is expres,;ed in activated T cells than in unstimulated
`FRMCs. Similar RT-PCR data were obtained from PRMCs
`stimulated with phytohaemagglutinin (not shown). Tn addition,
`DPP8 mRNA was expressed in all BandT cell lines examined
`and in both liver and placenta (Fig. 38).
`
`Expression of DPP8 in COS-7 cells
`
`the full-length
`the function of DPP8 protein.
`To assess
`DPPC! eDNA of 3.1 kb was cloned into the Xbai site of the
`pcDNA3.1AN5/His expression vector tu produce two cun(cid:173)
`stmcts, one of which, pcDNA3.1-DPP8/V5/His, expressed
`the V5 epitope and His tag fused to the C -terminus of DPP8.
`A 1 00-kDa monomer, consistent with the molecular ma,;,;
`predicted from
`the amino-acid sequence, was detected in
`Western blots of stably transfcctcd COS-7 cells (Fig. 4A) but
`not of cell culture supernatants (data not shown). DPP8/V5/His
`was not detected on the cell surface by flow cytometry (data not
`shown). In addition, DPP8 was detected in the cytoplasmic
`compartment but not on the surface of either ethanol-fixed or
`paraformaldehyde-fixed DPP8N5/His-expressing COS-7 cells,
`by both immunofluorescence confocal microscopy (Fig. 4B-E)
`and immunoperoxidase light microscopy (data not shown).
`
`DPP8 is a dipeptidyl peptidase
`
`Sequence homology between DPPIV and DPP8 suggested
`functional similarities, so cell lysates of DPP8-transfected
`cells were examined for proline-specific peptidase activity.
`DPPIV expressed in COS-7 cells with or without the V5/His tag
`were positive controls, and negative cuntt·oh included vector(cid:173)
`only transfected COS-7 cells. Extract,; of DPPll-tran~fected
`COS-7 cells hydrolyzed Ala-Pro-pNA and Arg-Pro-pNA but
`not Gly-Pro-pNA, Gly-Arg-pNA, Gly-Pro-toluenesulfonate or
`Gly-Pro-7-amino-4-trifluoromethylcoumarin above the levels
`exhibited by untransfccted COS-7 cells (data not shown). The
`pH optimum of DPP8 enzyme activity was 7.4 (Fig. SA).
`similar to the pH 7.8 optimum of DPPTV enzyme activity
`[36,37]. DPP8 exhibited little activity below pH 6.3, suggesting
`that it is not an enzyme of the lysozome/endosome com(cid:173)
`partmem. Of all the substrates tested on cell monolayers, only
`Ala-Pro-4M~NA/HCI stained DPP8-transfected COS cells
`(data not shown).
`Both purified recombinant DPP8N5/His and purified recom(cid:173)
`binant DPPIV/V5/His hydrolyzed H-Ala-Pro-pNA, H-Gly-Pro(cid:173)
`pNA and H-Arg-Pro-p~A (Fig. 5B, Table 1 ). Transfection with
`DPP8 possihly causes increased dipeptidase, tripeptidase and
`endopeptidase activities, similar
`to an effect of DPPIV
`
`A
`
`4 s
`
`55
`
`6.5
`
`pH
`
`7.5
`
`85
`
`---..-DPPB- tH·Giy-::>ro-pNA]
`-
`;;. -DPPrV:I-<-Giy-Pro-pNAt
`-·+· - OPPS (1+-Ata-Pro-pNA)
`- -"" - -OPPIV (H-Aia-Pr<J-pfi.A)
`
`. ____ ... ----
`
`.. -----·
`
`____ .......... - ..... ..
`
`8
`g 12
`
`10
`
`><
`~-
`
`"' ~
`' §
`
`Substra~e con-centration (mM)
`
`Fig. 5. DPPS enzyme activity. (A) pH-dependence of DPP8 enzyme
`activity. (B) DPPS and DPPTV enzyme kinetics. Means ± SD of absOTbance
`change per minute, multiplied by 1000, ate shown. Cur\"e fitting assumed
`Michaelis-Menten kinetics.
`
`Page 7 of 11
`
`

`
`©FEES 2000
`
`A novel dipeptidyl peptidase (Ew: J. Binchem.. 267) 6147
`
`Table 2. Inhibition of the peptidase activity of DPP8 in comparison
`with DPPIV.