Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`Received 23 February 2006 | Accepted 17 August 2006 | Published 29 August 2006
`
`©2006 Molecular Vision
`
`In vitro and in vivo characterization of iris pigment epithelial cells
`cultured on amniotic membranes
`
`Kyoko Ohno-Matsui,1 Keisuke Mori,2 Shizuko Ichinose,3 Tetsuji Sato,4 Jiying Wang,1 Noriaki Shimada,1 Ariko
`Kojima,1 Manabu Mochizuki,1 Ikuo Morita5
`
`1Department of Ophthalmology and Visual Science, Tokyo Medical and Dental University, Tokyo, Japan; 2Department of Ophthal-
`mology, Saitama Medical School, Saitama, Japan; 3Instrumental Analysis Research Center, Tokyo Medical and Dental University,
`Tokyo, Japan; 4Department of Anatomy, School of Dental Medicine, Tsurumi University, Yokohama, Japan; 5Section of Cellular
`Physiological Chemistry, Tokyo Medical and Dental University, Tokyo, Japan
`
`Purpose: To determine whether human amniotic membranes (AMs) can induce human and rat iris pigment epithelial
`(IPE) cells grown on them to develop characteristics of RPE cells in situ better than IPE cells grown on plastic plates, and
`to determine whether subretinal transplantation of IPE cell sheets grown on AMs can protect photoreceptor cells in dystro-
`phic Royal College of Surgeons (RCS) rats.
`Methods: IPE cells from humans and Long-Evans rats were cultured on the basement membrane side of dispase-treated
`AMs. Two weeks after seeding, ultrastructural changes were evaluated by transmission electron microscopy, and the level
`of expression of several genes present in differentiated retinal pigment epithelial (RPE) cells was determined by real time
`PCR and western blotting. IPE cell sheets cultured on AMs were transplanted into the subretinal space of 4-week-old RCS
`rats, and eyes were analyzed histologically 12 weeks after grafting.
`Results: IPE cells cultured on AMs showed ultrastructural features like intercellular junctions, similar to RPE cells in situ.
`IPE cells grown on AMs had a greater upregulation in the expression of genes important for the function of differentiated
`RPE cells (e.g., pigment epithelium-derived factor [PEDF], RPE65, bestrophin, VEGF, and BDNF) than IPE cells grown
`on plastic plates. The number of photoreceptors present in RCS rats after subretinal transplantation of IPE cell sheets
`grown on AMs was significantly higher than that of sham injected rats and rats receiving transplantation of AMs without
`IPE cells.
`Conclusions: The more advanced degree of differentiation of IPE cells grown on AMs indicates that AMs are a better
`substrate to culture IPE cells than plastic plates. This was supported by the greater protection of photoreceptors of RCS
`rats when IPE cell sheets cultured on AMs were transplanted in the subretinal space.
`
` Subretinal transplantation of suspensions of retinal pig-
`ment epithelial (RPE) cells has been performed for the treat-
`ment of both wet and dry aged-related macular degeneration
`(AMD). However, the transplantation of suspensions of allo-
`genic RPE cells has been shown to have no visual benefit to
`patients with AMD because of several factors including graft
`rejection [1,2]. Because of the rejection, autologous iris pig-
`ment epithelial (IPE) cells have been tried to replace the lost
`or damaged RPE cells in the macular area [3,4]. However,
`transplantation of suspensions of autologous IPE cells has also
`not resulted in a prolonged improvement of vision in AMD
`patients [4,5]. Recently, Binder et al. [6,7] transplanted sus-
`pensions of autologous RPE cells into eyes with wet type AMD
`after removal of choroidal neovascular (CNV) membranes.
`They reported that these eyes had significantly better reading
`acuity than controls with CNV removal only. However, ob-
`taining sufficient numbers of RPE cells was sometimes diffi-
`cult, and in some patients, the aspirated RPE cells were not
`transplanted because of insufficient numbers or hemorrhage.
`
`Correspondence to: Kyoko Ohno-Matsui, MD. Department of Oph-
`thalmology and Visual Science, Tokyo Medical and Dental Univer-
`sity, 1-5-45 Yushima, Bunkyo-ku, 113-8519, Japan; Phone: 81-3-
`5803-5297; FAX: 81-3-3818-7188; email: k.ohno.oph@tmd.ac.jp
`
`In most of these studies, suspensions of isolated cells were
`injected into the subretinal space. A major problem of inject-
`ing suspensions of RPE or IPE cells is that the transplanted
`cells fail to regain a fully differentiated phenotype. For ex-
`ample, histological examination of the subretinally transplanted
`IPE cells in rabbits showed that they gradually lose much of
`their pigment, form multilayered clumps, and survive for only
`a short time [8].
`The basement membranes of epithelial cells are known
`to promote the differentiation and survival of epithelial cells
`[9,10], serve as selective filters, and to have both structural
`and morphogenetic functions. Bruch’s membrane is the base-
`ment membrane of the RPE cells and the membrane that the
`injected cells must attach to. Unfortunately, Bruch’s membrane
`is mechanically damaged when the CNV is removed in pa-
`tients with wet AMD. In addition, aged human Bruch’s mem-
`branes do not readily support the subsistence and differentia-
`tion of transplanted RPE cells [11].
`To counter these problems, investigators have cultured
`cells on different types of substrates to form sheets of cells
`prior to implantation. We have demonstrated that human RPE
`cells cultured on human amniotic membranes (AMs) devel-
`oped morphological phenotypes of epithelial cells, and show
`an upregulation of a panel of growth factors, including pig-
`1022
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`ment epithelium-derived factor (PEDF), a cytokine important
`for maintaining retinal homeostasis [12]. Stanzel et al. [13]
`also demonstrated that RPE adopted an epithelial phenotype
`with more organized pigmentation, strong expression of ZO-
`1, and RPE 65 after seeding on AM. AMs are made up of
`thick basement membranes with an avascular stromal matrix
`and have been used as a substrate for the transplantation of
`cultivated corneal epithelial cells [14].
`Because basement membranes of epithelial cells are
`known to promote the differentiation and survival of epithe-
`lial cells [9,10], we have hypothesized that IPE cells grown
`on human AMs will induce the IPE cells to greater differen-
`tiation and stronger upregulation of growth factors than cells
`grown on plastic plates. To test this hypothesis, we have grown
`human and rat IPE cells on AMs and on plastic plates and
`have compared their ability to induce morphological differen-
`tiation and upregulation of growth factors from the IPE cells.
`We also investigated whether subretinal transplantation of IPE
`cell sheets cultivated on AMs can protect the photoreceptors
`of Royal College of Surgeon (RCS) rats from degeneration
`better than sham injected animals.
`
`METHODS
`Cell preparation: Human IPE cells were purchased from
`ScienCell (San Diego, CA). Rat IPE cells were prepared from
`the eyes of 10 to 12 week-old Long-Evans rats obtained from
`CLEA Japan (Tokyo, Japan), and the cells were isolated as
`described [15]. The rat and human IPE cells were maintained
`in a growth medium consisting of Ham’s F-12 (Invitrogen,
`Tokyo, Japan) and 20% fetal bovine serum. The medium was
`changed every 2 days, and cells at passage 2 and 3 were used
`in all experiments. All animal experiments were conducted in
`accordance with the ARVO statement for the Use of Animals
`in Ophthalmic and Vision Research and were approved by the
`Animal Research Committee, Tokyo Medical and Dental Uni-
`versity.
`Immunohistochemical detection of cytokeratin: Immu-
`nohistochemistry was used to detect cytokeratin, a marker for
`epithelial cells. For this, rat IPE cells were preincubated in
`0.3% hydrogen peroxide in phosphate-buffered saline (PBS)
`for 20 min at room temperature (RT). They were then incu-
`bated with anti-pan cytokeratins (1:100, Sigma, St. Louis, MO)
`overnight at 4 °C and then exposed to fluorescein-labeled sec-
`ond antibody in Tween-PBS and 2% FBS for 30 min at room
`temperature (RT).
`
`TABLE 1.
`
` Product GenBank
` Primer sequence (5'-3') Annealing size accession
` Gene position in mRNA temp (°C) (bp) Reference number
`---------- ----------------------------- --------- ------- --------- ---------
`RPE65 F: CCTTTCTTCATGGAGTCTTTG 50 122 BC075035
` R: ATTGCAGTGGCAGTTGTATTG
`
`CRALBP F: GCTGCTGGAGAATGAGGAAACT 61 149 BC004199
` R: TGAACCGGGCTGGGAAGGAATC
`
`Bestrophin F: ATGGGGCCTTGATGGAGCAC 58 227 BC015220
` R: GGCGAAGCATCCCCATTAGG
`
`PEDF F: TTACGAAGGCGAAGTCACCA 58 212 AF400442
` R: TAAGGTGATAGTCCAGCGGG
`
`bFGF F: GCCTTCCCGCCCGGCCACTTCAAGG 55 179 [38]
` R: GCACACACTCCTTTGATAGACACAA
`
`VEGF F: ATCGAGTACATCTTCAAGCCAT 58 199 NM_003376
` R: CTTTCTTTGGTCTGCATTCACA
`
`BDNF F: ATGACCATCCTTTTCCTTACTATGGT 52 741 [38]
` R: TCTTCCCCTTTTAATGGTCAATGTAC
`
`TRP2 F: GGTTCCTTTCTTTCCAGT 60 185 S69231
` R: GAAGAAAAGCCAACAGCACAA
`
`Tyrosinase F: GCATCATTCTTCTCCTCTTGG 60 359 [20]
` R: ATAGGATCGTTGGCAGATCC
`
`GAPDH F: TGAACGGGAAGCTCACTGG 65 307 M33197
` R: TCCACCACCCTGTTGCTGTA
`
`Primer sequences used for real-time PCR.
`
`1023
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`polyacrylamide gel electrophoresis and transblotted onto ny-
`lon membranes. Nylon membranes containing transblotted
`proteins were pretreated with 1.0% non-fat dried milk in 50
`mM Tris buffer (pH 8.0), followed by incubation overnight
`with a monoclonal antibody against human PEDF (dilution
`
`Cultures of IPE on AM: Preserved human AMs
`(AmnioGraft) were purchased from Bio-Tissue (Miami, FL),
`and the AM was preserved according to the method described
`by Lee and Tseng [16]. Briefly, AMs derived from Cesarean
`section-derived placentas were rinsed in phosphate buffered
`saline (PBS) containing 100 U/ml penicillin and 0.2 mg/ml
`streptomycin and stored in 50% DMEM and 50% glycerol at
`-80 °C for up to 3 months. After thawing to room temperature
`(RT), the AM was treated with 1.2 U/ml sterile dispase-I solu-
`tion (Godo-Shusei, Tokyo, Japan) for 30 min and then gently
`scrubbed with an epithelial cell scraper (Costar, Corning, NY),
`to remove the amniotic epithelium without damaging the un-
`derlying basement membrane (denuded AM). The AM was
`sutured onto a culture insert (Milicell-CM, Millipore, Bedford,
`MA) with a non-absorbable suture with the basement mem-
`brane facing up and placed in a 6 well tissue culture plastic
`plate as described [12].
`IPE cells were seeded at a density of 1.0x105 cells/AM
`insert. The cultures were incubated at 37 °C in 5% CO2 and
`95% air, and the medium was changed every 2 days. In some
`experiments, the IPE cells were cultured on uncoated plastic
`dishes in DMEM with 10% FBS and used as controls. Each
`condition was prepared in triplicate, and experiments were
`performed at least three times.
`Transmission electron microscopy: Transmission elec-
`tron microscopy (TEM) was used to determine whether the
`IPE cells grown on denuded AMs and on plastic dishes differ-
`entiated morphologically. Cultures were fixed in 2.5% glut-
`araldehyde in 0.1 M PBS for 2 h, washed overnight at 4 °C in
`the same buffer, and post-fixed with 1% osmium tetroxide in
`0.1 M PBS for 2 h. The pellets were dehydrated through a
`graded ethanol series, and embedded in Epon 812. Ultrathin
`(90 nm) sections were collected on copper grids and double
`stained with uranyl acetate and lead citrate and examined with
`a H-7100 TEM (Hitachi Ltd., Hitachinaka, Japan).
`cDNA synthesis and SYBR green RT-PCR analysis: Four-
`teen days after seeding, total RNA was extracted from human
`IPE cells using TRIzol reagent. Complementary DNAs were
`synthesized from the total RNA of cultured human IPE cells
`using a cDNA synthesis kit (You-Prime First-Strand Beads,
`Amersham Pharmacia, NJ). The SYBR green RT-PCR method
`(Quantitect SYBR Green PCR Kit™ Qiagen Inc., Valencia,
`CA) was used to determine the expression levels of mRNAs
`in the cultured human IPE cells using specific primers (Table
`1) with a Light Cycler™ instrument (Roche Diagnostics, Basel,
`Switzerland), as described [12]. The relative cDNA concen-
`trations were determined by a standard curve using sequential
`dilutions of corresponding PCR fragments. The relative quan-
`tity was quantified as the ratio of the mRNA expression of the
`targeted gene to that of GAPDH.
`Western blot analysis of PEDF: Human and rat IPE cells
`were allowed to condition in serum-free media for 48 h be-
`fore harvesting to determine the protein concentration. The
`Figure 1. Photomicrographs of newly-isolated rat IPE cells in cul-
`final protein concentrations were determined using the BCA
`ture (A) and at passage 2 (B). The cells are pigmented as viewed
`assay (Pierce Chemical Co., Rockford, IL) according to the
`through a phase contrast filter (C). The cells are positively labeled
`with anti-cytokeratin, pan-antibody, indicating their epithelial ori-
`manufacturer’s instructions. Equal amounts of secreted pro-
`gin.
`tein (8 µg) were separated by 12% sodium dodecyl sulfate-
`1024
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`1:4000, Transgenic Co., Kumamoto, Japan). The PEDF im-
`munoreactivity was detected by exposing X-ray film to blots
`incubated with ECL reagent.
`Earlier experiments from this laboratory have shown that
`human RPE cells will upregulate the expression of PEDF when
`they are grown on AMs. Thus as a control, experiments were
`also performed on the supernatants from primary cultures of
`human RPE cells (generously donated by Peter A.
`Campochiaro, MD; Wilmer Eye Institute, Johns Hopkins Uni-
`versity, Baltimore, MD) at passage 2 to 3. The results were
`compared with the results of human IPE cells.
`Preparation of rat IPE cell sheets on AM for transplanta-
`tion: Gelatin was used as a matrix to grow rat IPE cells on
`AMs as has been described for the transplantation of RPE cells
`sheets by Del Priore et al. [17]. Briefly, porcine skin gelatin
`powder with a rigidity of 300 blooms (Sigma-Aldrich, St.
`Louis, MO) was sterilized and dissolved in minimum essen-
`tial medium (MEM; Invitrogen-Gibco, Grand Island, NY).
`Sucrose (Sigma-Aldrich) was added to make a 300 mM gela-
`tin solution which maintained the gelatin sheets in a solid phase
`at temperatures below 37 °C, but the sheets melted within
`minutes at 37 °C.
`
`Once the gelatin dissolved, the solution was poured into
`35 mm tissue culture dishes (Falcon 3001; BD Biosciences,
`Lincoln Pak, NJ) and allowed to cool and solidify for 15 min
`at room temperature. Gelatin blocks were cut into 15x30 mm
`triangular pieces and mounted on a vibratome (Microslicer
`DSK-3000; Dosaka EM, Kyoto, Japan) with the basal side
`facing a steel blade. Smooth, 100 µm gelatin sheets were cut
`from the blocks. The IPE cell sheets cultivated on AMs were
`placed on a slice of gelatin with the apical IPE surface facing
`upward. Then, another gelatin film was placed on the IPE cell
`surface to cover the cell sheet completely. The gelatin film
`containing the IPE cells attached to the AM was then incu-
`bated in a humidified atmosphere of 5% CO2 and 95% air at
`37 °C for 5 min to allow the gelatin to melt and encase the IPE
`sheet. The specimen was kept at 4 °C for 5 min to solidify the
`liquid gelatin and then used for transplantation. The viability
`of the IPE cells after these procedures was more than 90%, as
`assessed by calcein/AM staining (data not shown).
`In some experiments, IPE cells on AMs were labeled with
`CM-Dil (chloromethylbenz-amino derivatives of 1,1'-
`dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate;
`Molecular Probes, Eugene, OR) before transplantation. For
`
`Figure 2. Representative photo-
`graphs of transmission electron mi-
`crographs of human IPE cells culti-
`vated on uncoated plastic dish (A)
`or on AMs (B,C) for 14 days. Elec-
`tron micrographs show a tight
`monolayer of IPE cells growing
`over the AM (B), while IPE cells
`cultured on plastic dish are elon-
`gated and multilayered (A). Electron
`micrograph shows junctional spe-
`cialization (arrowhead) between
`adjacent cells cultured on AMs (C).
`The scale bars represent 1 µm.
`
`1025
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`this, the IPE cells were incubated in 5 µg/ml CM-Dil solution
`for 20 min at 37 °C, and the labeled IPE cells were washed
`three times with PBS and used for transplantation.
`Transplantation procedures: Pink-eyed, dystrophic Royal
`College of Surgeons (RCS) rats were obtained from the Insti-
`tute of Laboratory Animals, Graduate School of Medicine,
`Kyoto University, Japan. Congenic nondystrophic rats were
`obtained from CLEA Japan (Tokyo, Japan). All transplanta-
`tions were made into the right eye when the rats were 4 weeks
`old. The left eye served as untreated controls.
`For the injections, animals were anesthetized with an in-
`traperitoneal injection of ketamine (80 mg/kg) and xylazine
`(20 mg/kg), and the right pupil was dilated using tropicamide
`(1% Mydrin P, Santen, Tokyo, Japan). The transplantation was
`performed under an operating microscope (OM-5, TAKAGI,
`Nagano, Japan). A beveled glass needle (World Precision In-
`struments, Sarasota, FL) was introduced into the subretinal
`space transsclerally under direct vision.
`
`TABLE 2.
`
` AM to
` plastic
` Gene ratio
`---------- -------
`RPE65 1.62
`CRALBP 0.98
`Bestrophin 2.47
`PEDF 9.25
`bFGF 1.01
`VEGF 1.53
`BDNF 1.50
`TRP2 1.18
`Tyrosinase 1.56
`
`Results of real-time PCR. The fold changes in mRNA levels of the
`selected genes were determined by real-time RT-PCR. Values repre-
`sent fold changes of mRNA levels of IPE cells on amniotic mem-
`brane compared to IPE cells on plastic dish (AM to plastic ratio)
`after normalization for GAPDH content. Data are means of 3 to 4
`samples per group.
`
`Figure 3. Transmission electron mi-
`crographs of rat IPE cells cultured on
`uncoated plastic dish (A) or on de-
`nuded AMs (B,C) for 14 days. Elec-
`tron micrographs show a tight mono-
`layer of IPE cells (A) with junctional
`specializations (C, arrowheads) grow-
`ing over AM, which is different from
`the multilayer appearance of cells
`cultured on plastic dish (A). The scale
`bars represent 1 µm.
`
`1026
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`The IPE transplant (1x3 mm) was preloaded into the broad
`end of a beveled glass needle (World Precision Instruments,
`Sarasota, FL) that was attached to a one ml syringe. To enter
`the subretinal space, a small incision (about 1 mm) was cut
`just behind the pars plana of the host eye. The transplant was
`injected into the subretinal space, and after approximately 10
`min, the transplant spontaneously unfolded. In some animals,
`AM without IPE cells was transplanted as controls.
`Sham-treated RCS rats received 1 µl of PBS injected
`transsclerally into the dorsotemporal subretinal space of the
`right eye of anesthetized 4-week-old rats by means of a fine
`glass capillary (inner diameter, 75-150 µm) attached by tub-
`ing to a 10 µl syringe (Hamilton, Reno, NV). A total of 32 rats
`received IPE cell sheet on AM, 12 received AM without IPE
`cells, and 15 had a sham injection of saline. Transplantation
`into the subretinal space was confirmed by indirect ophthal-
`moscopy with a +30 D lens, and those that had successful
`transplantation were selected for histologic analysis and be-
`havioral tests.
`Tissue fixation and processing for histological analysis:
`Eyes were enucleated 12 weeks after transplantation at age 16
`weeks and fixed in 4% paraformaldehyde. The eyes were
`embedded in OCT compound, and 6 µm sections were cut
`with a cryostat (Leica CM3050-Cryostat, Wetzlar, Germany),
`stained, and processed for light microscopy. The maximum
`thickness of the outer nuclear layer (ONL; n=6 animals for
`each group) was measured by a single masked observer, and
`the differences were analyzed with the Mann-Whitney test.
`Immunostaining of rhodopsin: The above sections were
`also used for immunohistochemical analysis. Sections from
`the periodate-lysine-paraformaldehyde-fixed samples were
`treated with 0.3% H2O2 and 10% normal horse serum to block
`endogenous peroxidase and nonspecific binding, respectively.
`The sections were then treated with mouse monoclonal
`antithodopsin antibody (1:500 dilution; Sigma-Aldrich, St.
`Louis, MO) at room temperature for 90 min. After reacting
`with goat antibodies against mouse IgG conjugated to peroxi-
`dase labeled-dextran polymer, the color was developed with
`aminoethyl carbazole (AEC; Zymed Laboratories, San Fran-
`cisco, CA) in 50 mM Tris-HCl, containing 0.006% H2O2.
`Counterstaining was performed with hematoxylin. As a nega-
`tive control, primary antibodies were replaced with nonimmune
`mouse IgG (Dako).
`
`RESULTS
`Characterization of IPE cells cultivated on AMs: Phase-con-
`trast photographs of isolated rat IPE cells and cultured IPE
`cells at passage two are shown in Figure 1A,B, respectively.
`All of the isolated cells are pigmented, and immunohistochemi-
`cal studies showed that the IPE cells were labeled with anti-
`bodies against cytokeratins indicating that they were epithe-
`lial origin (Figure 1C).
`Morphology of IPE cells grown on AMs: TEM showed
`that human and rat IPE cells cultured on AM appeared struc-
`turally very similar to RPE in situ (e.g., organized in a mono-
`layer with intercellular junctional complexes; Figure 2B,C,
`Figure 3B,C). In contrast, IPE cells cultured on plastic dishes
`1027
`
`were not only multilayered but also did not have intercellular
`junctional specialization of high-electron density (Figure 2A,
`Figure 3A). Microvilli were sparsely observed on the apical
`membrane of human IPE cells cultured on AM (Figure 2B).
`Reverse transcription PCR: Three discriminatory mol-
`ecules: RPE65, an RPE-specific molecule that plays an im-
`
`Figure 4. Increased PEDF protein secretion by IPE cells cultured on
`AMs. Cells were conditioned in serum free medium for 48 h before
`harvesting to determine the protein concentration. Equal amounts of
`secreted protein (8 µg) were applied to each lane. A: Representative
`western blot analysis of PEDF protein using supernatants from hu-
`man IPE and RPE cells. PEDF protein levels are increased by cultur-
`ing cells on AMs both for human IPE cells (lanes 1 and 2) and RPE
`cells (lanes 3 and 4). The PEDF protein levels are higher in human
`RPE cells than in IPE cells. B: Quantitative analysis of proteins con-
`firmed that the level of PEDF in human IPE or RPE cells cultured on
`AMs is higher than that in cells on plastic dish. The value shown is
`the ratio of the density of PEDF signal to that of IPE cells cultured
`on AM. PEDF secreted by IPE cells is lower than RPE cells. The
`asterisk indicates a significant difference (p<0.05, Mann-Whitney
`analysis). C: Representative western blot analysis of PEDF protein
`using supernatants from rat IPE cells demonstrating a marked in-
`crease in PEDF protein secretion when cells are cultivated on AMs.
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`portant role in the RPE-photoreceptor vitamin A cycle; cellu-
`lar retinaldehyde-binding protein (CRALBP) which is involved
`in the regeneration of visual pigment; and bestrophin, a marker
`of late RPE differentiation [18] were investigated in cultured
`human IPE cells. The expression level of bestrophin was higher
`in IPE cells cultured on AM than cells cultured on plastic dishes
`(Table 2). The expression of RPE65 was slightly increased in
`IPE cells cultured on AM, while the level of mRNA expres-
`sion of CRALBP was not significantly different between IPE
`cells grown on AMs and plastic dishes.
`The expression of growth and trophic factors which play
`a role in both RPE and photoreceptor cell function and sur-
`vival were investigated by RT-PCR. The expression of the
`mRNA of PEDF was more strongly elevated in IPE cells cul-
`tured on AMs than on plastic dishes (Table 2), while there was
`no significant difference in the mRNA expression of bFGF.
`The expression levels of VEGF and BDNF were slightly higher
`in IPE cells cultured on AMs than cultured on plastic dishes.
`Tyrosinase and TRP-2 are enzymes involved in melanin
`synthesis and are expressed in melanocytes of neural crest
`
`origin and RPE cells [19,20]. There was no significant differ-
`ence in the expression of the mRNA of TRP-2, however, that
`of tyrosinase was slightly upregulated when IPE cells were
`cultured on AMs.
`Western blot of PEDF: Western blot analysis using a
`monoclonal antibody against purified PEDF protein
`(Transgenic, Inc., Kumamoto, Japan) was performed. The
`PEDF antibody recognizes a 50 kDa protein species, and the
`level of the PEDF protein was almost undetectable in the con-
`ditioned medium from IPE cells cultured on plastic dishes,
`while that from IPE cells cultivated on AMs exhibited a marked
`increase in PEDF protein production (Figure 4). In our con-
`trol studies, human RPE cells were found to produce signifi-
`cantly higher levels of PEDF when grown on AMs than on
`plastic plates, as we have already reported (Figure 4A). PEDF
`production of human IPE cells on AMs was still lower than
`that of human RPE cells both on plastic dishes and on AMs.
`Photoreceptor rescue by subretinal transplantation of IPE
`cell sheets grown on AMs in RCS rats: RCS rats show a pro-
`gressive loss of photoreceptors, which is most marked during
`
`Figure 5. Anatomical rescue of photoreceptors after subretinal trans-
`plantation of IPE cells cultivated on AM in RCS rats. A: A 4-month-
`old nondystrophic RCS rat showing full ONL thickness. B: Sham-
`operated RCS rat 3 months postoperative showing complete loss of
`the ONL; there is also disruption of the INL. C: Photomicrograph of
`retina from a RCS rat 3 months after the transplantation of AM with-
`out IPE cells showing a slight rescue of the ONL. D: Photomicro-
`graph of retina from a RCS rat 3 months after the transplantation of
`IPE cell sheet grown on an AM showing a significant preservation of
`the ONL. Transplanted IPE cells with heavy pigmentation are recog-
`nized on the AM. Sections A through C were stained with H&E. E:
`Transplanted IPE cells prelabeled with CM-DiI (red). Nuclei are
`stained with Cytox blue (blue). In the images, INL indicates inner
`nuclear layer; ONL is outer nuclear layer; OS marks the outer seg-
`ments; RPE indicates the retinal pigment epithelium; and AM marks
`the amniotic membrane. The scale bars represent 50 µm. F: Maxi-
`mum thickness of photoreceptor in RCS rats at 16 weeks of age. The
`data are from 6 rats in each group. Dystrophic, untreated dystrophic
`RCS rats; sham, dystrophic rats that received sham-injection; AM only; dystrophic rats that received subretinal transplantation without IPE
`cells; IPE cell sheet, dystrophic rats that received subretinal transplantation of IPE cell sheet on AMs; and non-dystrophic, non-dystrophic
`control. Measurements were made along the vertical meridian. Error bars, SD. The asterisk shows a significant statistical difference (p<0.05,
`Mann-Whitney analysis) in the maximum ONL thickness between rats receiving transplantation of IPE cell sheet over AMs and animals
`receiving transplantation of AM only. There is also a significant difference between animals receiving sham surgery and rats receiving trans-
`plantation of IPE cells sheet cultured on AMs. There is no significant difference between untreated rats and those receiving transplantation of
`AM only.
`
`1028
`
`

`

`Molecular Vision 2006; 12:1022-32 <http://www.molvis.org/molvis/v12/a115/>
`
`©2006 Molecular Vision
`
`the first three months after birth [21]. This retinal degenera-
`tion is primarily due to the failure of the RPE cells to phago-
`cytose shed photoreceptor outer segments [22]. Previous stud-
`ies have demonstrated that subretinal transplantation of fetal
`RPE cells into the dystrophic RCS rat at an early age resulted
`in structural and functional preservation of photoreceptors [23-
`25].
`
`We used this animal model to explore the ability of IPE
`cells cultured on AM to rescue photoreceptor degeneration in
`RCS rats. The IPE cell sheets grown on AMs were success-
`fully injected subretinally in 23 (71.9%) of 32 eyes without
`significant complications. The other nine eyes had extensive
`vitreous hemorrhage (five eyes), retinal detachment (two eyes),
`cataract formation (one eye), and endophthalmitis (one eye),
`and were excluded from further analysis. The AMs without
`IPE cells were successfully injected subretinally in 10 of 12
`rats. The other two eyes had cataract formation, and were ex-
`cluded from analysis. In the sham surgery eyes, none showed
`significant complications. When the animals were 16 weeks
`old (12 weeks after transplantation), the eyes were removed
`and were processed for histological analysis.
`There was no histological evidence of an inflammatory
`reaction or infiltrating immune cells in any of the experimen-
`tal or control eyes. Light microscopic observation revealed
`that the transplanted tissue was located subretinally (Figure
`5D), and was easily recognized by the melanin pigments
`(Long-Evans donor) from the host’s unpigmented RPE cells.
`Prelabeling of the IPEs with CM-DiI confirmed that these
`heavily pigmented cells in the host subretinal space were de-
`rived from the donor cells (Figure 5E). The subretinally trans-
`planted IPE cells appeared to be round in shape (Figure 5D).
`Histological analysis of nondystrophic rat retinae showed
`an organized row of nuclei in the outer nuclear layer (ONL)
`of about 14 nuclei thick (Figure 5A), but in the unoperated
`eye of dystrophic rats, the ONL was reduced to an occasional
`
`cell lying at the outer border of the inner nuclear layer (Figure
`5B). Animals that had sham surgery had findings similar to
`those of unoperated rats, and almost no photoreceptors re-
`mained (data not shown). Animals that had transplantation of
`AMs without IPE cells showed only about 1-2 nuclei thick in
`the ONL (Figure 5C).
`In contrast, more photoreceptor nuclei were present in
`the group of animals that received IPE cell sheets grown on
`AMs (Figure 5D). Photoreceptor preservation was also ob-
`served in the areas that were not immediately overlying trans-
`planted IPE cells (data not shown). Retinae that had received
`transplants showed larger areas of photoreceptor survival with
`the ONL as much as eight nuclei thick in the area of the injec-
`tion (Figure 5F). There was a significant lower number of
`nuclei in the ONL of rats that had no treatment or sham sur-
`gery than animals that underwent transplantation of IPE cell
`sheet on AMs (p<0.05). There was also a significantly lower
`number of nuclei in the ONL of rats that received transplanta-
`tion of AMs without IPE cells than those that received trans-
`plantation of IPE cell sheets grown on AMs (p<0.05). There
`was no significant difference in the number of nuclei in the
`ONL in untreated rats from rats that had sham surgery.
`Immunohistochemical analysis showed that the preserved
`photoreceptors expressed rhodopsin, a visual pigment used
`by the rod photoreceptor cells to perform phototransduction
`(Figure 6).
`
`DISCUSSION
` IPE cells have recently been used for autologous cell trans-
`plantation for retinal diseases, however the transplantation did
`not result in a prolonged improvement of vision in AMD pa-
`tients [4,5,26]. One of the factors for this failure was probably
`because the transplanted IPE cells did not fully differentiate
`into cells that had morphological and physiological proper-
`ties of RPE cells in situ. To determine whether the differentia-
`
`Figure 6. Immunoreactivity for rhodopsin after subretinal transplantation of IPE cells cultivated on AM in RCS rats. A: A 4-month-old
`nondystrophic RCS rat showing intense rhodopsin immunoreactivity in OS as well as some nuclei in ONL. B: Sham-operated RCS rat 3
`months postoperative showing an absence of rhodopsin immunoreactivity. C: Photomicrograph of retina from a RCS rat 3 months after the
`transplantation of IPE cell sheet grown on an AM showing rhodopsin immunoreactivity in ONL. D: Rhodopsin staining is absent in a 4-
`month-old nondystrophic RCS rat whe