Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`Nucleotide Sequence of Porcine Circovirus
`Associated with Postweaning Multisystemic
`Wasting Syndrome in Pigs
`Andre L. Hamel, Lihua L. Lin and Gopi P. S. Nayar
`1998, 72(6):5262.
`J. Virol. 
`  
`
`Updated information and services can be found at:
`http://jvi.asm.org/content/72/6/5262
`
`These include:
`
`REFERENCES
`
`This article cites 20 articles, 6 of which can be accessed free at:
`http://jvi.asm.org/content/72/6/5262#ref-list-1
`
`CONTENT ALERTS
`
`Receive: RSS Feeds, eTOCs, free email alerts (when new articles
`
`more»
`cite this article),
`
`http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders:
`
`
`http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:
`
`CEV Exhibit 1011_001
`
` 
`

`

`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`JOURNAL OF VIROLOGY,
`0022-538X/98/$04.0010
`Copyright © 1998, American Society for Microbiology
`
`June 1998, p. 5262–5267
`
`Vol. 72, No. 6
`
`Nucleotide Sequence of Porcine Circovirus Associated with
`Postweaning Multisystemic Wasting Syndrome in Pigs
`ANDRE L. HAMEL, LIHUA L. LIN, AND GOPI P. S. NAYAR*
`Virology Laboratory, Manitoba Agriculture, Veterinary Services,
`Winnipeg, Manitoba R3T 5S6, Canada
`
`Received 27 October 1997/Accepted 12 February 1998
`
`This article describes the nucleotide sequence of a porcine circovirus (PCV) which possesses a high degree
`of association with postweaning multisystemic wasting syndrome (PMWS), a newly described disease of young
`pigs. The DNA sequence of this PMWS-associated PCV (pmws PCV) has 68% homology with that of a previous-
`ly published nonpathogenic strain of PCV. The strains appear to be closely related yet distinct from one another.
`
`A variety of circoviruses have been identified in a range of
`animal species (porcine circovirus [PCV] [23], psittacine beak
`and feather disease virus [21], and chicken anemia virus [25])
`and plant species (subterranean clover stunt virus [SCSV] [4],
`coconut foliar decay virus [CFDV] [22], and banana bunch top
`virus [BBTV] [12]). Even though all circoviruses have circular
`single-stranded DNA genomes and small isometric virions, there
`are very limited similarities among them. The animal circovi-
`ruses have insignificant similarity at the nucleotide sequence or
`protein level with one another and with the plant circoviruses
`(1, 26, 27). On the other hand, the plant circoviruses have
`limited similarity with one another at the nucleotide sequence
`and protein levels (3, 12). Prior to the present study, the only
`reported nucleotide sequence of porcine circovirus has been
`for the nonpathogenic (np PCV) strain, which is commonly
`associated with cultured porcine kidney (PK-15) cells (17). The
`np PCV was found to have limited protein similarity with only
`some plant circoviruses (BBTV, CFDV, and SCSV), whereas it
`has insignificant nucleic acid sequence and protein homology
`with animal circoviruses (psittacine beak and feather disease
`virus and chicken anemia virus) (17).
`Postweaning multisystemic wasting syndrome (PMWS) is a
`recently recognized disease of young pigs. Typical clinical signs
`of PMWS include progressive wasting, dyspnea, tachypnea,
`occasionally, icterus and, in rare cases, jaundice (5, 11). Post-
`mortem examinations reveal a wide range of lesions; the most
`common include interstitial pneumonia, lymphadenopathy, and
`occasionally nephritis and hepatitis (5, 11). Two earlier studies
`reported that a circovirus appears to be common in swine
`populations, based upon the prevalence of circovirus antibod-
`ies (7, 14). Microscopic examination of hematoxylin-and-eosin-
`stained tissue sections reveals that PMWS distinctively exhibits
`intensely basophilic staining inclusion bodies mostly in lymph
`nodes, tonsils, and Peyer’s patches of the ileum (11). A more
`recent study on PMWS-affected animals demonstrated the
`presence of a circovirus by electron microscopy, virus isolation
`by cell culture, in situ hybridization with a cloned PCV plasmid
`probe, and immunohistochemical staining with porcine and
`rabbit immune serum (8). However, in those studies a PCV
`was used that was derived from persistently infected porcine
`kidney (PK-15) cell lines (ATCC CCL-33) and was nonpatho-
`genic for experimentally infected pigs (24). In previous work in
`
`* Corresponding author. Mailing address: Virology Laboratory,
`Manitoba Agriculture, Veterinary Services, 545 University Crescent,
`Winnipeg, Manitoba, Canada R3T 5S6. Phone: (204) 945-7643. Fax:
`(204) 945-8062. E-mail: gnayar@gov.mb.ca.
`
`our laboratory (18), it was reported that PCR was used to de-
`tect a characteristic PCV associated with PMWS, pmws PCV.
`Pigs affected by the disease were always found to contain pmws
`PCV but not np PCV. The oligonucleotide primers used in that
`PCR assay were designed from the nucleotide sequence of an
`np PCV. The pmws PCV and np PCV amplification products
`were readily distinguishable from one another by restriction
`endonuclease fragment length polymorphism (RFLP). The
`amplification products obtained from all PCR-positive clinical
`tissue specimens exhibited RFLP profiles which were unique
`for pmws PCV and quite distinct from that of np PCV (18).
`The nucleotide sequences of np PCV, derived from persis-
`tently infected PK-15 cell lines, were previously reported by
`two groups of researchers, one based in Ireland (GenBank ac-
`cession no. U49186 [17]) and the other in Germany (GenBank
`accession no. Y09921 [16]). These sequences have small (1,759-
`nucleotide [nt]) circular, single-stranded DNA genomes and
`over 99% nucleotide sequence homology. We compared the np
`PCV genome described by the Irish group with pmws PCV.
`DNA was extracted from the lungs, lymph nodes, spleens,
`and tonsils of 100 pigs with PMWS from field cases which were
`submitted to our facility from several provinces across Canada
`(most were from Manitoba, but some were from Alberta, On-
`tario, Prince Edward Island, and Saskatchewan) by methods
`described elsewhere (10, 10a, 18). We screened DNA samples
`from these pig tissues by a PCR assay for pmws PCV described
`elsewhere (10a, 18). Amplification products from all 100 PMWS
`pigs were analyzed by RFLP. We observed that all PCR pos-
`itives exhibited RFLP profiles that were unique to pmws PCV
`yet not identical to one another (10a). We randomly chose to
`use the tissues from a single PMWS case for PCR and DNA
`sequencing. Another laboratory (Western College of Veteri-
`nary Medicine, Saskatoon, Saskatchewan, Canada) confirmed
`evidence for PMWS and the presence of PCV in tissues from
`this random sample by immunohistochemical staining with por-
`cine and rabbit immune serum (see reference 8 for the details
`about methods).
`Sixteen primers suitable for PCR were selected from a pub-
`lished np PCV sequence (GenBank accession no. U49186 [17])
`with the Primer computer program (15). All of the appropriate
`primers were selected for use in several separate PCRs which
`would yield several fragments overlapping, overall covering the
`entire pmws PCV genome (based upon the assumption that
`the pmws PCV genome should at least be similar to that of the
`np PCV genome). The sequences of these fragments (59 to 39)
`were as follows: 1F (nt 24 to 43), GCACCTCGGCAGCGTC
`AGTG; 2F (nt 378 to 399), GGAAGCGCAGCGACCTGTC
`
`5262
`
`CEV Exhibit 1011_002
`
`

`

`VOL. 72, 1998
`
`NOTES
`
`5263
`
`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`FIG. 1. Map depicting the eight overlapping fragments of pmws PCV genomic DNA that were PCR amplified and sequenced in this study. The scale at the top
`represents nucleotide position numbers derived from a published np PCV sequence (17). This is a circular genome; therefore, nucleotide position 1759 abuts nucleotide
`position 1. Arrows denote location and orientation of primers that were used for PCR and sequencing. The eight overlapping horizontal lines below the graduated scale
`represent the eight portions of pmws PCV genomic DNA that were PCR amplified and sequenced. The dashed line in the 8F/15R PCR product indicates where legible
`sequence ended because it was too far from either primer. The nucleotide sequences from all eight PCR products result in an accumulated total of 6,480 nt. After all
`of the sequences were aligned, we observed that approximately 1,450 nt were sequenced at least three times and that 320 nt were sequenced twice.
`
`TAC; 3F (nt 426 to 451), GGTCTTTGGTGACTGTAGCCG
`AGCAG; 4F (nt 888 to 914), GGAAGACTGCTGGAGAAC
`AATCCACGG; 5F (nt 904 to 927), ACAATCCACGGAGG
`TACCCGAAGG; 6F (nt 947 to 972), CCACCCTGTGCCCT
`TTTCCCATATAA; 7F (nt 1231 to 1253), TGGGGGTGAA
`GTACCTGGAGTGG; 8F (nt 1682 to 1704), GCGGGTCCT
`TCTTCTGCGGTAAC; 9R (nt 43 to 24), CACTGACGCTG
`CCGAGGTGC; 10R (nt 399 to 378), GTAGACAGGTCGC
`TGCGCTTCC; 11R (nt 451 to 426), CTGCTCGGCTACAG
`TCACCAAAGACC; 12R (nt 914 to 888), CCGTGGATTGT
`TCTCCAGCAGTCTTCC; 13R (nt 927 to 904), CCTTCGGG
`TACCTCCGTGGATTGT; 14R (nt 972 to 947), TTATATG
`GGAAAAGGGCACAGGGTGG; 15R (nt 1253 to 1231),
`CCACTCCAGGTACTTCACCCCCA; and 16R (nt 1704 to
`1682), GTTACCGCAGAAGAAGGACCCGC.
`The PCR was performed as described elsewhere (10) except
`
`that Taq DNA polymerase was the only enzyme used in the
`reactions. After thermocycling was complete, PCR products
`were analyzed by gel electrophoresis as previously described
`(10). A PCR-positive sample was randomly chosen for DNA
`sequencing.
`Before sequencing, 10 mg of each PCR product for pmws
`PCV was purified and concentrated with Microcon-100 (Fisher
`Scientific) 100,000-molecular-weight-cutoff microcentrifuge fil-
`ter units according to the manufacturer’s recommendations.
`Both strands of the purified PCR products were sequenced
`with their corresponding PCR primers at a commercial facility
`(SeqWright, Houston, Tex.) by the Applied Biosystems Prism
`dye-terminator dideoxy system.
`All 16 primers generated PCR amplification products of the
`expected sizes from DNA of the PK-15 cell line infected with
`np PCV; however, only six of these primers (4F, 7F, 8F, 9R,
`
`TABLE 1. Comparison of ORFs in pmws PCV and np PCVa
`
`pmws PCV
`
`np PCV
`
`ORF
`
`Genomic DNA
`
`Protein
`
`Genomic DNA
`
`Protein
`
`Position (nt)
`
`Strandb
`
`No. of aa
`
`1
`2
`3
`4
`5
`6
`7
`8
`9
`10
`11
`
`51–995
`1735–1034
`671–357
`565–386
`1016–1177
`1611–1530
`1682–1741
`753–688
`92–1732
`1524–1631
`1033–989
`
`V
`C
`C
`C
`V
`C
`V
`C
`C
`V
`C
`
`314
`233
`104
`59
`53
`27
`19
`21
`42
`35
`14
`
`kDa
`
`35.8
`27.8
`11.9
`6.5
`6.2
`2.8
`1.9
`2.3
`4.6
`4.1
`1.8
`
`Glycc
`
`Position (nt)
`
`Strand
`
`No. of aa
`
`1
`1
`2
`1
`2
`2
`2
`2
`2
`2
`2
`
`47–985
`1723–1022
`658–38
`552–205
`1163–1450
`1518–1330
`1670–81
`740–627
`968–873
`1642–1755
`648–719
`
`V
`C
`C
`C
`V
`C
`V
`C
`C
`V
`V
`
`312
`233
`206
`115
`95
`62
`56
`37
`31
`3.7
`23
`
`kDa
`
`35.7
`27.8
`23.2
`13.3
`9.8
`6.7
`6.0
`4.3
`3.4
`3.7
`2.8
`
`Glyc
`
`1
`1
`2
`1
`1
`1
`2
`2
`2
`1
`2
`
`Homology
`(%)
`
`85
`66
`62
`83
`None
`None
`79
`67
`None
`None
`None
`
`a Traits compared were genomic position and orientation of ORF (which viral nucleic acid strand the ORF encoded), predicted size of ORF-encoded protein
`(number of amino acids and molecular mass), presence of potential glycosylation sites, and homology between ORFs in pmws PCV and np PCV.
`b V, virus strand; C, complementary strand.
`c Glyc, glycosylation site; 1, contains glycosylation signal (asparagine sequon N-X-S or N-X-T); 2, does not contain asparagine sequon.
`
`CEV Exhibit 1011_003
`
`

`

`5264
`
`NOTES
`
`J. VIROL.
`
`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`FIG. 2. Nucleotide sequence of pmws PCV (GenBank accession no. AF027217 [this study]) aligned with np PCV (GenBank accession no. U49186 [17]). Numbering
`used here is based upon numbering that was used for np PCV, where nt position 1 is the first A residue immediately downstream of the putative nick site in the
`nonanucleotide motif. Total genome sizes are 1,768 nt for pmws PCV and 1,759 nt for np PCV. Homologous nucleotides are indicated by asterisks. Potential
`polyadenylation sites are overlined in the putative viral strand and underlined in the complementary strand.
`
`15R, and 16R) were also able to produce PCR amplification
`products from DNA of PMWS-affected pigs (results not
`shown). These six primers were used in five different combi-
`nations of pairs to produce the following PCRs: 4F/15R (366
`nt), 7F/16R (474 nt), 7F/9R (572 nt), 4F/9R (915 nt), and 8F/
`15R (1,331 nt). The DNA from a single randomly chosen
`PMWS-affected pig was subjected to these five different PCRs,
`and both strands of each amplification product were sequenced
`(Fig. 1). The raw sequencing data obtained from the three
`smaller PCRs (4F/15R, 7F/16R, and 7F/9R) were clearly read-
`
`able in their entirety for both strands. About 850 nt in each of
`the two larger PCRs (8F/15R and 4F/9R) could be read with
`certainty (a maximum of about 425 nt from each strand). Raw
`sequence data for a total of 4,120 nt of pmws PCV were
`obtained from these five pairs of PCRs.
`The raw sequence data were aligned, creating a preliminary
`1,360-nt contiguous sequence of pmws PCV which consisted of
`a region of approximately 930 nt that was sequenced four times
`and separate 360- and 70-nt regions that were sequenced once.
`Six new primers were designed based upon this preliminary
`
`CEV Exhibit 1011_004
`
`

`

`VOL. 72, 1998
`
`NOTES
`
`5265
`
`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`FIG. 3. Alignments of predicted amino acid sequences of several ORFs in pmws PCV and np PCV. Potential glycosylation signal sequences (asparagine sequons NXS or
`NXT, where X 5 any amino acid [6]) are overlined in pmws PCV and underlined in np PCV. The proteins encoded by ORF1 would be 314 aa long and have a molecular
`mass of 35.8 kDa in pmws PCV, be 312 aa long and have a molecular mass of 35.7 kDa in np PCV, and have 86% homology. The proteins encoded by ORF2 would be 233
`aa long and 27.8 kDa in pmws PCV, 233 aa long and 27.8 kDa in np PCV, and have 66% homology. The proteins encoded by ORF3 would be 104 aa and 11.9 kDa in pmws
`PCV and 206 aa and 23.2 kDa in np PCV and have 62% homology. The proteins encoded by ORF4 would be 59 aa and 6.5 kDa in pmws PCV and 115 aa and 13.3 kDa in
`np PCV and have 83% homology. The proteins encoded by ORF7 would be 19 aa and 1.9 kDa in pmws PCV and 56 aa and 6.0 kDa in np PCV and have 79% homology.
`The proteins encoded by ORF8 would be 21 aa and 2.3 kDa in pmws PCV and 37 aa and 4.3 kDa in np PCV and have 67% homology. All amino acid sequence alignments
`shown involve the full-length proteins in pmws PCV and the homologous portions of appropriate lengths for their counterparts in np PCV. Thus, the arrows shown at the ends
`of protein sequences encoded by ORFs 3, 4, 7, and 8 in np PCV indicate that these proteins continue further, and their remaining sequences are not shown.
`
`pmws PCV sequence. Their sequences (59 to 39) were as fol-
`lows (nucleotide position numbers are based upon the com-
`pleted pmws PCV sequence given in Fig. 2): N1f (nt 4 to 22),
`AGCGCACTTCGGCAGCGGC; N2r (nt 337 to 306), TATT
`CTTTATTCTGCTGATCAGTTCCTTTGGC; N3f (nt 267 to
`292), GTGAAGTGGTATTTGGGTGCCCGCTG; N4r (nt
`817 to 791), ATTGCTGGTAATCAAAATACTGCGGGCC;
`N5f (nt 790 to 819), TGGCCCGCAGTATTCTGATTACCA
`GCAATC; and N6r (nt 1242 to 1268), CCACTCCCGTTAA
`TTCACACCCAAACC. These six new primers derived from
`the preliminary pmws PCV sequence were used to produce the
`following three different PCRs: N1f/N2r (334 nt), N3f/N4r (551
`nt), and N5f/N6r (469 nt). The three new PCRs were per-
`
`formed on DNA from the same PMWS-affected pig, and both
`strands of each amplification product were sequenced (Fig. 1).
`A total of about 2,360 nt of raw sequencing data was obtained
`from these three new PCR products.
`The nucleotide sequences from all eight overlapping PCR
`products for pmws PCV were aligned (an accumulated total of
`6,480 nt), generating a final 1,768-nt contiguous consensus
`sequence for pmws PCV (Fig. 2). Overall, approximately 1,450
`nt were sequenced at least three times, and approximately 320
`nt were sequenced twice.
`The nucleotide sequences were analyzed with the compu-
`ter programs Align (20), Basic Local Alignment Search Tool
`(BLAST, available on the Internet from the National Center
`
`CEV Exhibit 1011_005
`
`

`

`5266
`
`NOTES
`
`J. VIROL.
`
`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`FIG. 4. (a) Alignment of the putative DNA replication sequences in pmws
`PCV and np PCV. Homology is indicated by an asterisk. (b) Comparison of the
`stem-loop structures predicted from the sequences in panel a. In both panels the
`nonanucleotide sequence motifs are in bold-faced type, and arrows mark the
`putative nick sites. The A residues immediately downstream of these nick sites
`are used as the starting point for numbering these genomes. All sequences are
`given in the 59-to-39 direction.
`
`pmws PCV and 1753 to 2 in np PCV), which is immediately
`downstream of the putative nick site in between the rightmost
`T and A residues (Fig. 3).
`It is perhaps not surprising that the proteins encoded by
`ORF1 have the most highly conserved sequence (they have
`85% homology) considering that they code for the putative
`Rep protein, required for genome replication. The proteins
`encoded by ORFs 2, 3, 4, 7, and 8 in pmws PCV are obviously
`closely related to their respective counterparts in np PCV.
`However, their differences are striking, especially for those
`proteins encoded by ORFs 3, 4, 7, and 8, which in pmws PCV
`are about half the size of their counterparts in np PCV. Fur-
`thermore, ORFs 5, 6, 9, 10, and 11 in these two circoviruses
`lack any homology with any other ORF. These predicted dif-
`ferences in proteins, encoded in pmws PCV, are possibly the
`contributing factors for the pathogenesis, clinical signs, and
`lesions associated with PMWS.
`Work needs to be done in identifying and characterizing the
`proteins that are actually produced by pmws PCV before their
`functions can be known (by gel electrophoresis and by probing
`with antibodies raised against purified pmws PCV). It is hoped
`that such research will extend our understanding of the roles
`played by these proteins and of their different traits (overall
`amino acid sequence, hydrophobic, and hydrophilic domains,
`and glycosylation sites) in relation to the differences in viru-
`lence between pmws PCV and np PCV.
`The recent epidemic of PMWS in North American pigs has
`a characteristic PCV, pmws PCV, associated with the disease.
`The similarity of pmws PCV to np PCV in nucleotide se-
`quence, 6 of 11 protein sequences, genome structure and or-
`ganization, and host cell preferences demonstrates that they
`are closely related and may have a common ancestor.
`The PCR assay is a useful tool for studying diseases such as
`PMWS. We had previously reported using PCR and detecting
`only pmws PCV in pigs affected by PMWS (18). In an upcom-
`ing study, we will fully describe a PCR assay with primers based
`upon the pmws PCV sequence given here and its efficacy for
`
`for Biotechnology Information at http://www.ncbi.nlm.nih.gov
`[2]), ClustalV (13), and Numseq (9). Analysis of the DNA and
`predicted protein sequences of pmws PCV with BLASTn and
`BLASTx, respectively, detected any considerable homology
`only for np PCV. BLASTx detected scant homology between
`the Rep protein of pmws PCV and BBTV, CFDV, and SCSV,
`similarly to what was previously reported for np PCV (17).
`The DNA genome of pmws PCV is 9 nt larger than that of
`np PCV (Fig. 2). Overall, these two genomes have 69% se-
`quence homology, with their first halves (nt position 1 to 900)
`having over 82% sequence homology and their second halves
`(nt 901 to 1768/1759) having 62% homology. The genome of
`pmws PCV was determined to be circular, based upon reiter-
`ation of sequences flanking the end nucleotide positions (re-
`gion between nt 1730 to 1768 and 1 to 30), from several PCR
`product sequences (4F/9R, 7F/9R, 8F/15R, and N1f/N2r).
`The putative viral single-stranded DNA forms of pmws PCV
`and np PCV both contain potential polyadenylation addition
`[poly(A)] signal sequences (AATAA [19]) at conserved posi-
`tions. Poly(A) sites are found at two places in pmws PCV (nt
`positions 327 to 332 and 983 to 988) which align with poly(A)
`sites in np PCV (nt positions 314 to 319 and 973 to 978). The
`complementary (minus) strand of pmws PCV has only one
`poly(A) site (nt positions 1022 to 1027), which aligns with one
`of the minus-strand poly(A) sites of np PCV (nt positions 1015
`to 1030). The minus strand of np PCV contains an extra pos-
`sible poly(A) site (nt positions 1184 to 1189).
`The two types of PCVs, np PCV and pmws PCV, both
`contain 11 potential open reading frames (ORFs). The loca-
`tions and orientations of these ORFs are compared (Table 1),
`as are the shared homologies, sizes, and glycosylation sites for
`their predicted proteins. The six homologous predicted pro-
`teins encoded by ORFs 1, 2, 3, 4, 7, and 8 in pmws PCV and np
`PCV are aligned for comparison (Fig. 3).
`The proteins encoded by ORF1 are of similar sizes in pmws
`PCV and np PCV. Likewise, the proteins encoded by ORF2
`are of similar sizes in both PCVs. Most of the remaining nine
`ORFs (3 to 11) in pmws PCV are smaller than their counter-
`parts in np PCV, except for ORFs 9 and 10, which are larger in
`pmws PCV than in np PCV.
`Potential glycosylation sequences (also called asparagine se-
`quons NXS or NXT, where X represents any amino acid [6])
`are indicated in Figure 3. The proteins encoded by ORFs 1, 2,
`and 4 in pmws PCV contain sequons. The proteins encoded by
`ORFs 1, 2, 4, 5, 6, and 10 in np PCV contain sequons. The
`circoviruses have similar first sequons in their ORF1-encoded
`proteins, at amino acids (aa) 23 to 25 (NPS) in pmws PCV, and
`at aa 20 to 22 (NPS) in np PCV. However, the ORF1-encoded
`protein in pmws PCV has two extra sequons, at aa 256 to 258
`(NQT) and aa 286 to 288 (NAT). Both viruses have single
`sequons in their ORF2-encoded proteins, at aa 143 to 145
`(NYS) in pmws PCV and aa 102 to 104 (also NYS) in np PCV.
`Both viruses lack sequons in their proteins encoded by ORF3,
`ORF7, ORF8, ORF9, and ORF11. Both have similarly placed
`sequons in their ORF4-encoded proteins, at aa 30 to 32 (NVT)
`in pmws PCV and aa 34 to 36 (NCS) in np PCV. There are
`sequons in the proteins encoded by ORF5 (aa 64 to 66 and 69
`to 71), ORF6 (aa 6 to 8, 27 to 29, and 37 to 39) and ORF10 (aa
`21 to 23) in np PCV but not in pmws PCV.
`Both PCV genomes have nearly identical predicted stem-
`loop structures and nonanucleotide motif sequences (Fig. 4).
`This region is known to be required for np PCV genome
`replication (16). The starting point used for numbering the
`nucleotide sequence positions in both PCV genomes is located
`at the right-most A residue within the nonanucleotide se-
`quence motif, 59-AAGTATTAC-39 (nt positions 1762 to 2 in
`
`CEV Exhibit 1011_006
`
`

`

`Downloaded from
`
`http://jvi.asm.org/
`
` on October 16, 2012 by guest
`
`VOL. 72, 1998
`
`NOTES
`
`5267
`
`detecting pmws PCV in pigs (10a). Studies involving purified
`pmws PCV used to experimentally infect pigs can extend our
`understanding of the development and pathology of PMWS.
`Such studies can make use of probes and PCR assays that are
`based upon the pmws PCV nucleotide sequence presented
`here.
`PMWS is an important new disease in pigs. We hope the
`nucleotide sequence of pmws PCV described here will be use-
`ful for improving our understanding of the disease PMWS and
`developing effective vaccines against the disease and diagnostic
`procedures such as the PCR for detecting the etiological agent.
`Nucleotide sequence accession number. The GenBank ac-
`cession number for the nucleotide sequence of pmws PCV
`described in the present study is AF027217.
`We are most grateful to Cheryl Sachvie for valuable technical assis-
`tance.
`
`REFERENCES
`1. Allan, G. M., K. V. Phenix, D. Todd, and M. S. McNulty. 1994. Some
`biological and physico-chemical properties of porcine circovirus. J. Vet.
`Med. Ser. B 41:17–26.
`2. Altshul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.
`Basic local alignment search tool. J. Mol. Biol. 215:403–410.
`3. Burns, T. M., R. M. Harding, and J. L. Dale. 1995. The genome organization
`of banana bunchy top virus: analysis of six ssDNA components. J. Gen. Virol.
`76:1471–1482.
`4. Chu, P. G. W., P. Keese, B. S. Qiu, P. M. Waterhouse, and W. L. Gerlach.
`1990. Novel ssDNA genome organization of a new plant virus, abstr. W82-
`001, p. 125. In VIIIth International Congress of Virology Abstracts.
`5. Clark, E. G. 1997. Post-weaning multisystemic wasting syndrome. Proc. Am.
`Assoc. Swine Pract. 28:499–501.
`6. Darnell, J. E., H. F. Lodish, and D. Baltimore. 1986. Assembly of organelles:
`protein glycosylation, p. 961. In Molecular cell biology. Scientific American
`Books, New York, N.Y.
`7. Dulac, G. C., and A. Afshar. 1989. Porcine circovirus antigens in PK-15 cell
`line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian
`pigs. Can. J. Vet. Res. 53:431–433.
`8. Ellis, J., L. Hassard, E. Clark, J. Harding, G. Allan, P. Willson, J. Strakappe,
`K. Martin, F. McNeilly, B. Meehan, D. Todd, and D. Haines. 1998. Isolation
`of circovirus from lesions of pigs with postweaning multisystemic wasting
`syndrome. Can. Vet. J. 39:44–51.
`9. Fristensky, B., J. T. Li, and R. Wu. 1982. Portable microcomputer software
`for nucleotide analysis. Nucleic Acids Res. 10:6451–6463.
`10. Hamel, A. L., M. D. Wasylyshen, and G. P. S. Nayar. 1995. Rapid detection
`of bovine viral diarrhea virus by using RNA extracted directly from assorted
`specimens and a one-tube reverse transcription PCR assay. J. Clin. Micro-
`biol. 33:287–291.
`
`11. Harding, J. C. 1997. Post-weaning multisystemic wasting syndrome (PMWS):
`preliminary epidemiology and clinical presentation. Proc. Am. Assoc. Swine
`Pract. 28:503.
`12. Harding, R. M., T. M. Burns, G. Hafner, R. G. Dietzgen, and J. L. Dale.
`1993. Nucleotide sequence of one component of the banana bunchy top virus
`genome contains a putative replicase gene. J. Gen. Virol. 74:323–328.
`13. Higgin, D. G., and P. Sharp. 1988. CLUSTAL: a package for performing
`multiple sequence alignment on a microcomputer. Gene 45:333–338.
`14. Hines, R. K., and D. Lukert. 1995. Porcine circovirus: a serological survey of
`swine in the United States. Swine Health and Production 3:71–73.
`15. Lincoln, S. E., M. E. Daly, and E. S. Lander. 1990. Primer: a computer
`program for automatically selecting PCR primers. MIT Center for Genome
`Research and Whitehead Institute for Biomedical Research, Cambridge,
`Mass.
`16. Mankertz, A., F. Persson, J. Mankertz, G. Blaess, and H. J. Buhk. 1997.
`Mapping and characterization of the origin of DNA replication of porcine
`circovirus. J. Gen. Virol. 71:2562–2566.
`17. Meehan, B. M., J. L. Creelan, M. S. McNulty, and D. Todd. 1997. Sequence
`of porcine circovirus DNA: affinities with plant circoviruses. J. Gen. Virol.
`78:221–227.
`18. Nayar, G. P. S., A. Hamel, and L. Lin. 1997. Detection and characterization
`of porcine circovirus associated with post-weaning multisystemic wasting
`syndrome in pigs. Can. Vet. J. 38:385–386.
`19. Nevins, J. R., and J. E. Darnell, Jr. 1978. Steps in the processing of Ad2
`mRNA: poly (A) 1 nuclear sequences are conserved and poly (A) addition
`precedes splicing. Cell 15:1477–1493.
`20. Pearson, W. R. 1990. Rapid and sensitive sequence comparison with FASTP
`and FASTA. Methods Enzymol. 183:63–98.
`21. Ritchie, B. W., F. D. Niagro, P. D. Lukert, W. L. Steffens, and K. S. Latimer.
`1989. Characterization of a new virus from cockatoos with psittacine beak
`and feather disease virus. Virology 171:83–88.
`22. Rohde, W., J. W. Randles, P. Langridge, and D. Hanold. 1990. Nucleotide
`sequence of a circular single-stranded DNA associated with coconut foliar
`decay virus. Virology 176:643–651.
`23. Tischer, I., H. Gelderblom, W. Vettermann, and M. A. Koch. 1982. A very
`small porcine virus with a circular single-stranded DNA. Nature 295:64–66.
`24. Tischer, I., W. Mields, D. Wolff, M. Vagt, and W. Griem. 1986. Studies on the
`pathogenicity of porcine circovirus. Arch. Virol. 91:271–276.
`25. Todd, D., J. E. Creelan, D. P. Mackie, F. Rixon, and M. S. McNulty. 1990.
`Purification and biochemical characterization of chicken anaemia agent. J.
`Gen. Virol. 71:819–823.
`26. Todd, D., F. D. Niagro, B. W. Ritchie, W. Curran, G. M. Allan, P. D. Lukert,
`K. S. Latimer, W. L. Steffens, and M. S. McNulty. 1991. Comparison of three
`animal viruses with circular single-stranded DNA genomes. Arch. Virol. 117:
`129–135.
`27. Todd, D., K. V. Phenix, G. M. Allan, M. S. McNulty, H. J. Buhk, and I.
`Tischer. 1993. Comparison of chicken anaemia virus and porcine circovirus,
`members of the vertebrate virus family Circoviridae, abstr. P76-2, p. 367. In
`IXth International Congress of Virology Abstracts.
`
`CEV Exhibit 1011_007
`
`