MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference
`
`sequence
`
`(used for mutation description)
`
`(last modified February 23, 2009)
`
`This coding DNA reference sequence was created from RefSquene record NG 008189.1, transcript alpha 5, NM 001128425.1, for the
`description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced
`in several ways (e.g. NM 012222.2, NM 001048172.1 and NM 001048174.1). Due to the choice of the longest MUTYH-transcript
`(NM 0011284251) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by
`up to 42 nucleotides (14 amino acids).
`
`This coding DNA reference sequence was created from RefSquene record NG_008189.1, transcript alpha 5, NM_001128425.1, for the
`description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced
`in several ways (e.g. NM_012222.2, NM_001048172.1 ancl NM_001048174.1). Due to the choice of the longest MUTYH-transcript
`(NM_001128425.1) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by up
`to 42 nucleotides (14 amino acids).
`
`Please note that introns are available by clicking on the exon numbers above the sequence.
`
`(upstream sequence)
`
`cagccggagccgcggtgtacaacggaacttgtagtc
`
`tcctcgtggctagttcaggcggaaggagcagtcctctgaagcttgaggagcctctagaac
`
`—l8;
`
`—122_
`
`
`
`tatgagcccgaggccttcccctctcccagagcgcagaggctttgaaggctacctctggga
`
`—6l
`
`agccgctcaccgtcggaagctgcgggagctgaaactgcgccatcgtcactgtcggcggcc
`
`—l
`
`GDX 1025
`
`
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference
`
`sequence
`
`(used for mutation description)
`
`(last modified February 23, 2009)
`
`This coding DNA reference sequence was created from RefSquene record NG 008189.1, transcript alpha 5, NM 001128425.1, for the
`description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced
`in several ways (e.g. NM 012222.2, NM 001048172.1 and NM 001048174.1). Due to the choice of the longest MUTYH-transcript
`(NM 0011284251) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by
`up to 42 nucleotides (14 amino acids).
`
`This coding DNA reference sequence was created from RefSquene record NG_008189.1, transcript alpha 5, NM_001128425.1, for the
`description of sequence variants in the MUTYH gene following current HGVS recommendations. Note that exon 3 is alternatively spliced
`in several ways (e.g. NM_012222.2, NM_001048172.1 ancl NM_001048174.1). Due to the choice of the longest MUTYH-transcript
`(NM_001128425.1) as a reference, nucleotide and amino acid numbering after nucleotide position 157 (amino acid 53) may differ by up
`to 42 nucleotides (14 amino acids).
`
`Please note that introns are available by clicking on the exon numbers above the sequence.
`
`(upstream sequence)
`
`cagccggagccgcggtgtacaacggaacttgtagtc
`
`tcctcgtggctagttcaggcggaaggagcagtcctctgaagcttgaggagcctctagaac
`
`—l8;
`
`—122_
`
`
`
`tatgagcccgaggccttcccctctcccagagcgcagaggctttgaaggctacctctggga
`
`—6l
`
`agccgctcaccgtcggaagctgcgggagctgaaactgcgccatcgtcactgtcggcggcc
`
`—l
`
`GDX 1025
`
`
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence
`
`GCCGTGGGAAGTGGT CACAGGAAGCAGGCAGCCAGCCAGGAAGGGAGGCAGAAGCAT GCT
`
`3
`
`S
`
`G
`
`H
`
`R
`
`K
`
`Q A A
`
`S
`
`Q
`
`G
`
`R
`
`Q
`
`K
`
`H A
`
`l 2 O
`
`40
`
`.
`
`.
`
`.
`
`| a .
`
`/
`
`.
`
`.
`
`AAGAACAACAGTCAGGCCAAGCCTTCTGCCTGTGATG | CCTGTGCAG / GGATGATTGCTGAG
`S
`Q
`A
`K
`P
`S
`A C
`D
`A |
`C
`A
`G /
`M I
`A E
`
`180
`60
`
`.
`
`/
`
`/
`
`alternative splice site A
`.
`.
`
`(see top)
`
`.
`
`.
`
`
`TGTCCTGGGGCCCCAG / CAG / GCCTGGCCAGGCAGCCGGAAGAGGTGGTATTGCAGGCCTCT
`
`
`
`«.
`«.
`
`:4
`
`A alternative splice sites
`
`V
`
`L
`
`Q
`
`A
`
`s
`
`240
`
`80
`
`V
`
`A
`
`P
`
`A /
`
`A
`
`G /
`
`A
`
`R
`
`Q
`
`P
`
`GTCTCCTCATACCATCTATTCAGAGACGTAGCTGAAGTCACAGCCTTCCGAGGGAGCCTG
`
`3
`Y
`H
`L
`F
`R
`D V A
`V
`T
`A
`F
`R
`G
`S
`L
`
`.
`| A.
`.
`.
`.
`.
`CTAAGCTGGTACGACCAAGAGAAACGGGACCTACCATGGAGAAGACGG | GCAGAAGATGAG
`Y
`D
`Q
`E
`K
`R
`D
`L
`P
`W
`R
`R
`R
`| A
`E
`D
`E
`
`.
`.
`.
`| g.
`.
`.
`ATGGACCTGGACAGGCGGGCATATGCTG | TGTGGGTCTCAGAGGTCATGCTGCAGCAGACC
`D
`R
`R
`A
`Y
`A V |
`W
`V
`S
`E
`V
`M
`L
`Q
`Q
`T
`
`.
`.
`| Q
`.
`.
`.
`.
`CAGGTTGCCACTGTGATCAACTACTATACCGGATGGATGCAG l AAGTGGCCTACACTGCAG
`T
`V
`I
`N
`Y
`Y
`T
`G
`W
`M
`Q
`| K
`W
`P
`T
`L
`Q
`
`.
`.
`.
`.
`.
`.
`l 1
`
`GACCTGGCCAGTGCTTCCCTGGAG | GAGGTGAATCAACTCTGGGCTGGCCTGGGCTACTAT
`
`
`
`t
`L
`|
`t V N
`S
`A
`S
`Q
`L
`W
`A
`G
`L
`G
`Y
`Y
`
`.
`.
`.
`| E
`.
`.
`.
`TCTCGTGGCCGGCGGCTGCAGGAGGGAGCTCGGAAG | GTGGTAGAGGAGCTAGGGGGCCAC
`
`E
`R
`R
`L
`Q
`G A R
`K
`I V
`V
`E
`E
`L
`G
`G
`H
`
`ATGCCACGTACAGCAGAGACCCTGCAGCAGCTCCTGCCTGGCGTGGGGCGCTACACAGCT
`
`300
`100
`
`360
`120
`
`420
`140
`
`480
`160
`
`540
`180
`
`600
`200
`
`660
`
`GDX 1025
`
`
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence
`
`GGGGCCATTGCCTCTATCGCCTTTGGCCAG l GCAACCGGTGTGGTGGATGGCAACGTAGCA
`A
`S
`I
`A
`F
`G
`Q
`l A
`T
`G
`V
`V
`D
`G
`N
`V A
`
`CGGGTGCTGTGCCGTGTCCGAGCCATTGGTGCTGATCCCAGCAGCACCCTTGTTTCCCAG
`
`C
`
`R
`
`V
`
`R
`
`A
`
`I
`
`G
`
`A
`
`D
`
`P
`
`S
`
`S
`
`T
`
`L
`
`V
`
`S
`
`Q
`
`.
`.
`.
`.
`.
`l 19
`CAGCTCTG l GGGTCTAGCCCAGCAGCTGGTGGACCCAGCCCGGCCAGGAGATTTCAACCAA
`
`|
`
`G
`
`L
`
`A
`
`Q
`
`Q
`
`L V D
`
`P
`
`A
`
`R
`
`P
`
`G
`
`D
`
`F
`
`N
`
`Q
`
`GCAGCCATGGAGCTAGGGGCCACAGTGTGTACCCCACAGCGCCCACTGTGCAGCCAGTGC
`
`E
`
`L
`
`G
`
`A
`
`T
`
`V
`
`C
`
`T
`
`P
`
`Q
`
`R
`
`P
`
`L
`
`C
`
`S
`
`Q
`
`C
`
`.
`.
`.
`|_l
`.
`.
`.
`CCTGTGGAGAGCCTGTGCCGGGCACGCCAGAGA | GTGGAGCAGGAACAGCTCTTAGCCTCA
`
`E
`S
`L
`C
`R
`A
`R
`Q
`R
`l V
`Q
`E
`Q
`L
`L
`A
`S
`
`720
`240
`
`780
`
`260
`
`840
`
`280
`
`900
`
`300
`
`960
`320
`
`.
`.
`IQ.
`.
`.
`.
`GGGAGCCTGTCGGGCAGTCCTGACGTGGAGGAGTGTG l CTCCCAACACTGGACAGTGCCAC
`
`E
`S
`G
`S
`P
`D
`V
`E
`C
`A l
`P
`N
`T
`G
`Q
`C
`H
`
`CTGTGCCTGCCTCCCTCGGAGCCCTGGGACCAGACCCTGGGAGTGGTCAACTTCCCCAGA
`
`E
`
`T
`
`L
`
`G
`
`V
`
`V
`
`N
`
`F
`
`P
`
`R
`
`P
`
`P
`
`S
`
`P
`
`W
`
`D
`
`Q
`
`
`
`AAGGCCAGCCGCAAGCCCCCCAGGGAGGAGAGCTCTGCCACCTGTGTTCTGGAACAGCCT
`
`E
`
`R
`
`K
`
`P
`
`P
`
`R
`
`E
`
`S
`
`S
`
`A
`
`T
`
`C
`
`V
`
`L
`
`E
`
`Q
`
`P
`
`.
`IQ.
`.
`.
`.
`.
`GGGGCCCTTGGGGCCCAAATTCTGCTGGTGCAGAGGCCCAACTCAG l GTCTGCTGGCAGGA
`G
`A
`Q
`I
`L
`L V Q
`R
`P
`N
`S
`G |
`L
`L
`A
`G
`
`CTGTGGGAGTTCCCGTCCGTGACCTGGGAGCCCTCAGAGCAGCTTCAGCGCAAGGCCCTG
`
`F
`
`P
`
`S
`
`V
`
`T
`
`W
`
`E
`
`P
`
`S
`
`E
`
`Q
`
`L
`
`Q
`
`R
`
`K
`
`A
`
`L
`
`1020
`340
`
`1080
`
`360
`
`1140
`
`380
`
`1200
`400
`
`1260
`
`420
`
`GDX 1025
`
`
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence
`
`.
`4
`GAG l GTTGTCCACACCTTCTCTCACATCAAGCTGACATATCAAGTATATGGGCTGGCCTTG
`V
`H
`T
`F
`S
`H
`I
`K
`L
`T
`Y
`Q
`V
`Y
`G
`L
`A
`L
`
`GAAGGGCAGACCCCAGTGACCACCGTACCACCAGGTGCTCGCTGGCTGACGCAGGAGGAA
`
`T
`
`P
`
`V
`
`T
`
`T
`
`V
`
`P
`
`P
`
`G
`
`A
`
`R
`
`W
`
`L
`
`T
`
`Q
`
`E
`
`E
`
`.
`.
`IQ.
`.
`.
`.
`TTTCACACCGCAGCTGTTTCCACCGCCATGAAAAAG | GTTTTCCGTGTGTATCAGGGCCAA
`A
`A
`V
`S
`T
`A M K
`K
`| V
`F
`R
`V
`Y
`Q
`G
`Q
`
`.
`.
`.
`.
`lg
`.
`CAGCCAGGGACCTGTATG | GGTTCCAAAAGGTCCCAGGTGTCCTCTCCGTGCAGTCGGAAA
`T
`C
`M
`| G
`S
`K
`R
`S
`Q
`V
`S
`S
`P
`C
`S
`R
`K
`
`1380
`460
`
`1440
`
`480
`
`1500
`500
`
`1560
`520
`
`1620
`
`540
`
`1650
`
`549
`
`AAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTCTCACATCTCCACTGAT
`
`I
`
`M
`
`G
`
`Q
`
`Q
`
`V
`
`L
`
`D
`
`N
`
`F
`
`F
`
`R
`
`S
`
`H
`
`S
`
`T
`
`D
`
`GCACACAGCCTCAACAGTGCAGCCCAGTGA
`
`L
`
`N
`
`S
`
`A
`
`A
`
`Q
`
`X
`
`cacctctgaaagcccccattccctgagaatcctgttgttagtaaagtgcttatttttgta
`
`*60
`
`(downstream sequence)
`
`*64
`
`Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of
`the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "."
`above the sequence. The MutY homolog (E. coli) protein sequence is shown below the coding DNA sequence, with
`numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in
`bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription
`
`GDX 1025
`
`
`
`MutY Homolog (E. coli) (MUTYH) - coding DNA reference sequence
`
`Powered by LOVDv.1.1.0 Build 13
`©2004-2006 Leiden University Medical Center
`
`GDX 1025
`
`
Accessing this document will incur an additional charge of $.
After purchase, you can access this document again without charge.
Accept $ Charge
Still Working On It
This document is taking longer than usual to download. This can happen if we need to contact the court directly to obtain the document and their servers are running slowly.
Give it another minute or two to complete, and then try the refresh button.
A few More Minutes ... Still Working
It can take up to 5 minutes for us to download a document if the court servers are running slowly.
Thank you for your continued patience.
This document could not be displayed.
We could not find this document within its docket. Please go back to the docket page and check the link. If that does not work, go back to the docket and refresh it to pull the newest information.
Your account does not support viewing this document.
You need a Paid Account to view this document. Click here to change your account type.
Your account does not support viewing this document.
Set your membership
status to view this document.
With a Docket Alarm membership, you'll
get a whole lot more, including:
- Up-to-date information for this case.
- Email alerts whenever there is an update.
- Full text search for other cases.
- Get email alerts whenever a new case matches your search.
One Moment Please
The filing “” is large (MB) and is being downloaded.
Please refresh this page in a few minutes to see if the filing has been downloaded. The filing will also be emailed to you when the download completes.
Your document is on its way!
If you do not receive the document in five minutes, contact support at support@docketalarm.com.
Sealed Document
We are unable to display this document, it may be under a court ordered seal.
If you have proper credentials to access the file, you may proceed directly to the court's system using your government issued username and password.
Access Government Site
