THE JOURNAL OF BIOLOGICAL CHEMISTRY
`0 1991 by The American Society for Biochemistry and Molecular Biology, Inc
`
`Vol. 266, No. 10, Issue of April 5, pp. 6480-6484,1991
`Printed in U.S.A.
`
`Two Nicking Enzyme Systems Specific for Mismatch-containing DNA
`in Nuclear Extracts from Human Cells*
`
`Yang-Chuen Yeh, Dau-Yin ChangS, Jeffrey Masin, and A-Lien Lu
`From the Department of Biological Chemistry and the Program of Molecular and Cell Biology, University of Maryland School of
`Medicine, Baltimore, Maryland 21201
`
`(Received for publication, November 7, 1990)
`
`We have identified two novel enzyme systems in
`human HeLa nuclear extracts that can nick at specific
`sites of DNA molecules with base mismatches, in ad-
`dition to the T/G mismatch-specific nicking enzyme
`system (Wiebauer, K., and Jiricny, J. (1989) Nature
`339, 234-236). One enzyme (called all-type) can nick
`all eight base mismatches with different efficiencies.
`The other (A/G-specific) nicks only DNA containing an
`A/G mismatch. The all-type enzyme can be separated
`from the T/G-specific and A/G-specific nicking en-
`zymes by Bio-Rex 70 chromatography. Further puri-
`fication on a DEAE-5PW column separated the A/G-
`specific nicking enzyme from the T/G-specific nicking
`enzyme. Therefore, at least three different enzyme
`systems are able to cleave mismatched DNA in HeLa
`nuclear extracts. The all-type and A/G-specific en-
`zymes work at different optimal salt concentrations
`and cleave at different sites within the mismatched
`DNA. The all-type enzyme can only cleave at the first
`phosphodiester bond 5' to the mispaired bases. This
`enzyme shows nick disparity to only one DNA strand
`and may be involved in genetic recombination. The A/
`G-specific enzyme simultaneously makes incisions at
`the first phosphodiester bond both 5' and 3' to the
`mispaired adenine but not the guanine base. This en-
`zyme may be
`involved in an A/G mismatch-specific
`repair similar to the Escherichia coli mutY (or micA)-
`dependent pathway.
`
`G mismatch-specific repair has been identified in E. coli (10-
`13) and S. typhimurium (14). This mutY (or micA)-dependent
`pathway (15) acts on A/G mismatches to restore C/G base
`pairs exclusively, and in conjunction with MutT protein, also
`can reduce C/G-to-A/T transversions (16). Specific binding
`and nicking to DNA fragments containing A/G mispairs have
`been identified in E. coli extracts (16). The mechanism of the
`mutY (or micA)-dependent repair
`involves the action of a
`DNA glycosylase (17) followed by a 2-nucleotide excision and
`subsequent resynthesis (16).'
`Recent discoveries support a common evolution of mis-
`match repair machinery among
`diverse organisms. Protein
`sequences of MutL of S. typhimurium (18), HexB of Strep-
`tococcus pneumoniae (19), and PMSl of Saccharomyces cere-
`uisiae (20) have conserved regions. Proteins with significant
`homology to the MutS protein of S. typhimurium were found
`in human and mouse tissue (21, 22). Also, a 100-kDa protein
`has been identified that binds A/C-, T/C-, and T/T-contain-
`ing DNAs in human Raji cells (23). Thus, mammalian cells
`may use mechanisms similar to those found in prokaryotes to
`correct replication errors in favor of the parental strand (24).
`I n vitro repair systems directed by strand breaks have been
`established in nuclear extracts of HeLa and Drosophila cells
`(25). A specific repair system in human HeLa cells can repair
`deaminated 5-methylcytosines (26) and is equivalent to the
`T/G-specific pathway found in E. coli (6). Binding to and
`nicking of T/G-mismatch-containing DNA have been re-
`ported in nuclear extracts of HeLa cells (27, 28). The nicking
`of T/G-containing DNA is mediated through a DNA glyco-
`sylase and an apurinic/apyrimidinic (AP)2 endonuclease re-
`DNA mismatches may arise from DNA replication errors,
`action (28, 29).
`deamination of 5-methylcytosine, and DNA recombination.
`In this paper, we describe two novel nicking enzymes in
`Recombination between homologous but not identical se-
`HeLa nuclear extracts; one can recognize all eight mispairs
`quences generates mismatched heteroduplexes. Their repair
`and the other can only recognize A/G mismatches. These two
`may account for gene conversion, high negative interference,
`enzymes can be distinguished from each other and from the
`or map expansion (1, 2). In Escherichia coli and Salmonella
`T/G-specific nicking enzyme (28) by column chromatography
`typhimurium, mismatch repair directed by dam methylation
`and substrate specificity.
`at d(GATC) sequences is believed to correct DNA replication
`errors (3-5). Repair of all eight base mismatches with different
`EXPERIMENTAL PROCEDURES
`efficiencies is directed to the unmethylated newly synthesized
`DNA Preparations-Eight 116-mer
`oligonucleotides (four upper
`DNA strands. T/G-specific repair in E. coli is characterized
`and four lower strands, Fig. 1) were synthesized by a MilliGen 7500
`by very short repair tracts (6-8) and is apparently responsible
`DNA synthesizer and purified from 8% sequencing gels. The bases at
`for repairing deaminated 5-methylcytosines (9). This pathway
`position 51 of the upper strand and position 70 (counted from the 5'
`repairs T/G to C/G at the second position within the sequence
`end) of the lower strand vary by A, C, G, or T . Two complementary
`S'CC(A/T)GG and some related sequences. Recently, an A/
`116-mer oligonucleotides were annealed to generate a heteroduplex
`DNA containing a mismatched base at position 51 (of the upper
`strand). The annealed duplexes were labeled at the 3' end on the
`upper or lower strand with a DNA polymerase Klenow fragment and
`[u-"'P]dCTP or [a-"'P]dATP, respectively (30). After 25 min at 25 "C,
`the synthesis was completed by adding all four unlabeled deoxynucle-
`
`* This work was supported by Grant GM 35132 from the National
`Institute of General Medical Sciences. The costs of publication of
`this article were defrayed in part by the payment of page charges.
`This article must therefore
`be hereby marked "aduertisement"
`in
`accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
`$ Present address: Laboratory of Molecular Growth Regulation,
`National Institute of Child Health and Human Development, Na-
`tional Institute of Health, Bethesda, MD 20892.
`
`A-L. Lu and D.-Y. Chang, manuscript in preparation.
`' The abbreviations used are: AP, apurinic/apyrimidinic; HEPES,
`4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid.
`
`6480
`
`GDX 1011
`
`

`

`oside 5”triphosphates and incubated for an additional 5 min. The
`resulting filled-in duplex DNA is 120 base pairs in length. Alterna-
`tively, the upper strand was labeled at its 5’ end with T4 polynucle-
`otide kinase and [T-~’P]ATP before annealing with the lower strand.
`Endonuclease Nicking Assay-Endonuclease activity was assayed
`similarly to the method of Lu and Chang (16). Protein samples were
`incubated with 0.3 ng of 116-mer (5’ end-labeled) or 120-mer (3’ end-
`labeled) duplex DNA (Fig. 1) in a final volume of 20 p1 of reaction
`mixture containing 20 mM Tris-HC1 (pH 7.6), 10 p M ZnC12, 1 mM
`dithiothreitol, 1 mM EDTA, and 2.9% glycerol for 3 h at 37 “C. After
`incubation, samples were lyophilized and dissolved in 3 ~1 of 90% (v/
`v) formamide, 10 mM EDTA, 0.1% (w/v) xylene cyanol, and 0.1%
`(w/v) bromphenol blue. DNA was denatured at 90 “C for 3 min,
`fractionated on an 8% polyacrylamide, 8.3 M urea sequencing gel (311,
`and the gel was then autoradiographed.
`Enzyme Purification-Nuclear extracts were prepared from frozen
`HeLa S3 cells (21 g, grown by the Massachusetts Institute of Tech-
`nology Cell Culture Center) by a modified method as described by
`Dignam et al. (32). The isolated nuclear extract (Fraction I, 6 ml in
`buffer containing 20 mM HEPES (pH 7.9), 25% glycerol, 0.42 M
`NaC1, 1.5 mM MgC12, 0.2 mM EDTA, 0.5 mM phenylmethylsulfonyl
`fluoride, and 0.5 mM dithiothreitol) was diluted by addition of 44 ml
`of buffer A (20 mM KPOl (pH 7.4), 0.5 mM dithiothreitol, 0.1 mM
`EDTA, and 0.1 mM phenylmethylsulfonyl fluoride) containing 0.05
`M KC1, and applied to a 10-ml Bio-Rex 70 column (Bio-Rad) equili-
`brated with buffer A containing 0.05 M KC1. After washing with 20
`ml of equilibration buffer, the column was eluted with a 100-ml linear
`gradient of KC1 (0.1-0.8 M) in buffer A and followed by 20 ml of 0.8
`M KC1 in buffer A. Fractions containing all-type mismatch endonu-
`clease, which eluted at 0.8 M KC1, were pooled (Fraction 11-B, 20 ml).
`Fraction 11-A (10 ml, eluted at 0.48 M KC1) that contained both A/
`G- and T/G-specific nicking activities was diluted with 20 ml of
`buffer A containing 0.05 M KCl. The diluted protein was applied to a
`4-ml DEAE-5PW column (Waters, Millipore Corp.) equilibrated with
`buffer A containing 0.05 M KCl. After washing with 8 ml of equili-
`bration buffer, the column was eluted with a 40-ml linear gradient of
`KC1 (0.2-0.7 M) in buffer A. T/G- and A/G-specific endonucleases
`were eluted at 0.43 M KC1 (peak at fraction 28) and 0.47 M KC1 (peak
`at fraction 32), respectively.
`
`RESULTS
`Identification of Base Mismatch-specific Endonucleases in
`HeLa Cells-In order to identify human enzymes that can
`nick mismatch-containing DNA fragments, we employed an
`assay similar to the specific nicking near mismatched bases
`of E. coli A/G endonuclease (16). Synthetic double-stranded
`DNA fragments containing different mismatches at one par-
`ticular position (Fig. 1) were incubated with HeLa nuclear
`extracts and then fractionated
`on a denaturing sequencing
`gel. The two DNA strands in Fig. 1 were arbitrarily defined
`as upper and lower strands. Initially, nicking was assayed
`with DNA fragments containing T/G or A/G mismatches,
`using C/G-containing DNA as a control. In HeLa nuclear
`extracts, nicking activities could be detected to T/G- or A/G-
`containing DNA but not
`to homoduplex DNA (data not
`shown). Nicking of T/G-containing DNA has been shown to
`
`1
`51
`5’ AATTGTCCTTAAGCTTTCTTCCCTTCC’I”ITCTCGCCACGTTCGCCGAATT~GG~CCC
`3‘ CAGGAATTCGAAAGAAGGGAAGGFAAGAGCGGTGCAAGCGGCTTMYCCGFAAGGG
`
`Human Base Mismatch-specific Endonucleases
`
`
`6481
`proceed through a DNA glycosylase-AP endonuclease path-
`way in nuclear extracts of HeLa cells (28, 29). Our results
`suggested that HeLa nuclear extracts might contain other
`mismatch-specific nicking enzymes. Therefore, these nuclear
`extracts were fractionated using a Bio-Rex 70 column and
`assayed for the nicking activities to mismatch-containing
`DNA substrates. As shown in Fig. 2, fractions 60-70 (Fraction
`11-A) were able to nick T/G- or A/G-containing DNA sub-
`strate at the proximity of the mismatched site but not to A/
`A- or C/G-containing DNA substrate. Fractions
`110-130
`(Fraction 11-B) could nick A/A-, TIC-, and A/G-containing
`DNA but not homoduplex DNA. Fraction 11-A had higher
`activity to T/G-containing DNA than to A/G-containing
`DNA. However, T/G-containing DNA was a poor substrate
`for Fraction 11-B.
`Further purification of Fraction 11-A on a DEAE-5PW
`column yielded two overlapping peaks of activity (Fig. 3).
`Peak fraction 28 showed nicking activity for T/G-containing
`DNA, and peak fraction 32 showed it for A/G-containing
`DNA. However, Fraction 11-B could not be separated into
`subpeaks by DEAE-5PW chromatography (data not shown).
`Therefore, at least three mismatch-specific endonucleases can
`be observed in HeLa nuclear extracts.
`A/G Mismatch-specific Endonuclease Is Present in HeLa
`Nuclear Extracts-When Fraction 11-A from the Bio-Rex 70
`column was assayed with DNA substrates containing one of
`the eight mismatches, we found it could only nick DNA
`containing T/G or A/G mismatches. We suspected that Frac-
`tion 11-A might contain one T/G-specific nicking enzyme (or
`a DNA glycosylase and an AP endonuclease) as reported by
`Wiebauer and Jiricny (28) and an A/G-specific enzyme simi-
`lar to the E. coli mutY (or micA)-dependent A/G-nicking
`enzyme (16, 17). To prove this hypothesis, Fraction 11-A was
`further purified by DEAE-5PW chromatography. This frac-
`tion could be separated into two peaks (Fig. 3) with one T/G-
`specific and one A/G-specific enzyme. When these two en-
`zymes were further separated by a third chromatographic step
`(heparin-agarose), the A/G- and T/G-specific endonuclease
`activities did not overlap each other (data not shown). The
`T/G-specific enzyme was proven to be a DNA glycosylase
`(data not shown), the same enzyme identified by Wiebauer
`and Jiricny (28), and was not further characterized. Fig. 4
`(lanes 1-9) shows the A/G-specific enzyme has no nicking
`activity for T/G, A/A, TIT, GIG, C/C, CIA, C/T, or C/G-
`containing DNA. Furthermore, this A/G-specific nicking en-
`zyme could only nick the “ A strand but not the “G” strand
`(Fig. 5). These properties are
`similar to the A/G-specific
`enzyme of E. coli.
`HeLa Nuclear Extracts Contain a Novel Enzyme That Can
`Nick All the Mismatch-containing DNA-Fractions 110-130
`(Fraction 11-B) from the Bio-Rex 70 column could nick effec-
`tively all mismatch-containing DNA (Fig. 1) labeled at the 3’
`end of the upper strand (Fig. 4, lanes 10-18). The nicking
`efficiency of mismatch-containing DNA as determined by
`densitometry was in the following order: C/C > A/A = C/A
`= C/T > A/G > G/G > T/T > T/G. However, no specific
`nicking was detected by using mismatch-containing DNA
`labeled at the 3‘ end of the lower strand (data not shown).
`The nicking at the mismatched site with broad substrate
`specificity and strand disparity are the unique characteristics
`of this “all-type” enzyme. There is no enzyme yet identified
`in prokaryotes equivalent to this human enzyme.
`Requirement of the AIG-specific and All-type Nicking En-
`zymes-Both A/G-specific and all-type nicking enzymes did
`not require M$+ and ATP for cleavage, but activity was
`slightly enhanced by adding Zn2+ (data not
`shown). The
`
`116
`
`61
`
`CGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATCTCGAGCTTTACGGCC 33
`GCAGTTCGAGATTTAGCCCCCGAGGGAAATCCCAAGGCGAGCTCGAAATGCCGGGGCCGGGGCC 5 1
`FIG. 1. Structure of the mismatch-containing 116-mer
`DNA substrates. The bases at position 51 of the upper strand ( X )
`and position 70 (counted from the 5’ end) of the lower strand ( Y )
`vary by A, C, G, or T. Two complementary 116-mer oligonucleotides
`were annealed to generate a heteroduplex DNA containing a mis-
`matched base at position 51 (as to the upper strand). When the
`duplex DNA is labeled at one of the 3’ ends and filled in by Klenow
`fragment, it becomes 120 base pairs long.
`
`GDX 1011
`
`

`

`6482
`
`Human Base Mismatch-specific Endonucleases
`Fractions
`
`
`
`a
`
`50 80 70 80 90 too 110 120 130
`
`b
`
`50 80 70 80 90 100 110 120 130
`
`Fractions
`
`FIG. 2. Purification of mismatch-
`specific endonucleases from human
`HeLa nuclear extracts by Bio-Rex
`70 chromatography. DNA containing
`A/A ( a ) , T/G ( b ) , A/G (c), or C/G ( d )
`at position 51 was labeled at the 3’ end
`and assayed with fractions from the col-
`umn. The cleaved fragment, after dena-
`turation, was analyzed
`on an 8% se-
`quencing gel that was then autoradi-
`ographed. Fractions (60-70) containing
`A/G and T/G
`nicking activities were
`pooled (Fraction 11-A). Fractions (110-
`130, pooled as Fraction 11-B) had nicking
`activities to A/A-, T/G-, and A/G-mis-
`matched DNA.
`
`Fractions
`
`C
`
`50 80 70 80 90 100 110 120 130
`
`
`d 50 80 70 80 90 loo 110 120 130
`
`Fractions
`
`Fractions
`
`P I 6 24 3 2 40 48
`
`56
`
`a
`
`T I G
`
`AIG Specific Type
`All Mismatch Type
`r
`??Zt????t???t????t
`1
`u ~ - a ~ - u o o o o a ~ u ~ - u o o o o
`1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
`
`Fractions
`
`P I 6 24 32 40 48
`
`56
`
`b
`A/ G
`
`FIG. 3. Purification of A/G- and T/G-specific endonucleases
`by DEAE-5PW chromatography. Fraction 11-A pooled ( p ) from
`the Bio-Rex 70 column was applied on a 4-ml DEAE-5PW column
`(Waters, Millipore Corp.). DNA containing T/G
`( a ) or A/G (b) at
`position 51 was labeled at the 3’ end of the upper strand and assayed
`with fractions from the column as described in the legend to Fig. 2.
`T/G- and A/G-specific endonucleases peak at fraction 28 and fraction
`32, respectively. Fractions (30-34) were pooled as Fraction 111-B.
`
`concentration of NaCl dramatically affected the activity of
`the all-type nicking enzyme (Fig. 6). The nicking activities
`for T/G-specific, A/G-specific, and all-type nicking enzymes
`were decreased to 66, 21, and 096, respectively, when they
`were assayed in buffer containing 80 mM NaCl compared with
`no NaCl. Salt concentration may have an effect on mismatch
`conformation or kinetic parameters governing the formation
`of protein-DNA complexes.
`Incision Sites of the A/G-specific and All-type Nicking En-
`zymes-We have used the DNA substrates labeled at different
`ends and different DNA strands to determine the
`cleavage
`sites of the A/G-specific and all-type nicking enzymes. The
`denatured cleavage products were separated on a sequencing
`
`FIG. 4. Mismatch specificities of the A/G-specific and all-
`type mismatch endonucleases. Fraction 111-B from a DEAE-5PW
`column was further purified by heparin-agarose chromatography to
`generate Fraction IV, which was then assayed in lanes 1-9. Fraction
`11-B from a Bio-Rex 70 column was the enzyme used in lanes 10-18.
`DNA substrates containing a different mismatch were assayed with
`the enzyme fractions as described in the legend to Fig. 2.
`
`generated by the
`a sequencing ladder
`gel in parallel with
`Maxam and Gilbert chemical method (31). As shown in Fig.
`7a, the cleavage product of all-type enzyme on A/G-containing
`DNA ran at the same position of the T”’ band of the sequenc-
`labeled at
`ing ladder generated from C/G-containing DNA
`the 3‘ end of the upper strand. We conclude that the all-type
`enzyme cleaves 5’ to the mispaired adenine. The cleavage
`product of T/G-specific enzyme ran at the same position of
`the C”’ band (sequencing ladder from C/G-containing DNA
`incision site at the 3’ side of mispaired
`fragment), This
`thymine is consistent with the result of Wiebauer and Jiricny
`(28). The A/G-specific enzyme cleaved at the same site as the
`T/G-specific enzyme (i.e. at the first phosphodiester bond 3‘
`to the mispaired base, data not shown). Using DNA substrates
`labeled at the 5‘ end of the upper strand for A/G-specific
`nicking enzyme, a band migrating between A”’ and G” could
`be detected on a sequencing gel (Fig. 76). According to the
`chemistry of the Maxam and Gilbert method, the site gener-
`ated by the endonuclease was assigned between T”-A”’ and
`probably contains a 3’-hydroxyl group. Thus, the cleavage
`site was mapped to the first phosphodiester bond 5’ to the
`mispaired adenine. However, for the all-type nicking enzyme,
`when using DNA substrates labeled at the 5’ end of the upper
`
`GDX 1011
`
`

`

`Human Base Mismatch-specific Endonucleases
`
`1 2 3 4 5 6 7
`
`c c
`
`G
`G ‘
`51 * A
`T
`T
`A
`A
`48*G‘
`
`FIG. 5. Strand specificity of A/G-specific enzyme. DNA con-
`taining A/G or G/A at position 51 (see Fig. 1) was labeled (presented
`as *) at the 3‘ end on the upper or lower strand with Klenow fragment
`
`of DNA polymerase I and [n-:”P]dCTP or [n-:”P]dATP, respectively.
`A/G-specific enzyme only nicked on the “A” but not the “G” strand.
`the 3’ end-labeled upper strand gave a 69-nucleotide
`A nick on
`fragment, whereas a nick on the lower strand generated a 50-nucleo-
`tide band.
`
`b
`a
`FIG. 7. a, incision sites of the all-type mismatch and T/G-specific
`endonucleases on 3’ end-labeled DNA. The upper arrow marked the
`cleavage product of A/G-containing DNA by the all-type enzyme
`(lane 5), and the lower arrow marked the product of T/G-containing
`DNA by the T/G-specific enzyme (lane 6 ) . Homoduplex DNA was
`not cut by the nuclear extract (lane 7), which contained both enzymes.
`Experiments using DNA substrates labeled at the 3’ end of the upper
`strand were performed as described in the legend to Fig. 2. The four
`lanes on the left (cleaved at G, C+T, C, and A X , respectively show
`a sequencing ladder of homoduplex DNA (C at position 51) by the
`method of Maxam and Gilbert (31). b, incision site of the A/G-specific
`endonuclease on 5’ end-labeled DNA. DNA containing an A/G mis-
`match at position 51 was labeled at the 5’ end of the upper strand
`(see Fig. 1) and cleaved with A/G endonuclease (Fraction 111-B). The
`cleaved product (marked by an arrow) was analyzed on
`an 8%
`sequencing gel with G and A>C sequencing ladders of the same DNA.
`
`41
`
`.51.
`
`FIG. 6. The effect of salt concentration on the nicking ac-
`tivities of thee mismatch-specific endonucleases. The DNA
`substrates containing an A/G (lanes 1-4) or T/G (lanes 5-6) mis-
`match were labeled at the 3’ end of the upper strand and
`were
`incubated with A/G-specific (fraction 32 eluted from DEAE-5PW
`column, lanes 1 and 2), all-type (fraction 130 eluted from a Bio-Rex
`70 column, lanes 3 and 4 ) , or T/G-specific (fraction 28 eluted from a
`DEAE-5PW column, lanes 5 and 6 ) nicking enzyme. The reactions
`were carried out in 20 mM Tris-HCI (pH 7.6), 10 p M ZnC12, 1 mM
`dithiothreitol, 1 mM EDTA, and 2.9% glycerol (lanes 1, 3, and 5) or
`containing 80 mM NaCl in addition (lanes 2, 4 and 6 ) . The fraction
`32 eluted from DEAE-5PW column was concentrated by Centricon 3
`(Amicon) centrifugation.
`
`strand, no fragment could be found. The reason for this is not
`clear yet. Data from Fig. 7 are summarized in Fig. 8.
`
`DISCUSSION
`In this paper, we describe the preliminary characterization
`of two enzyme systems from human HeLa cells that recognize
`and nick mismatch-containing DNA fragments. The enzyme
`systems described here may involve more than one protein.
`One enzyme system is specific for DNA containing an A/G
`of
`mismatch, and the other can nick DNA containing one
`eight possible base mismatches. These two enzyme systems
`can be separated by chromatography from the T/G-specific
`nicking enzyme system, which was shown to consist of a DNA
`glycosylase and an AP endonuclease (28, 29).
`Although we currently lack evidence demonstrating that
`
`c ;:
`I
`AATT X GGCT
`TTAAuCCGA
`All-type
`FIG. 8. Incision sites (represented by arrows) of three mis-
`match-specific endonucleases from human HeLa cells. a, T/G-
`specific; b, A/G-specific; c, all-type mismatch endonucleases. X and
`Y represent A, C, G, or T at position 51 of the DNA substrates (Fig.
`1) but are not complementary bases. The position of the nicking site
`of the T/G specific endonuclease was determined by Wiebauer and
`Jiricny (28). The two nicking sites of the A/G-specific endonulcease
`were determined by 3’ and 5’ end-labeled A/G mismatch-containing
`DNA. There is no detectable incision at the “G” strand. The all-type
`mismatch endonuclease can nick all eight mismatched bases at the
`first phosphodiester bond
`5’ to the mispaired base on the upper
`strand.
`
`the HeLa A/G-specific nicking is mediated by DNA glycosy-
`lase-AP endonuclease, the human A/G-specific enzyme is
`similar to the E. coli MutY DNA glycosylase and AP endo-
`nuclease system involved in A/G-specific repair (10-13). The
`high specificity to A/G mismatches and nicking to the “A”
`but not “G” strand are
`common for both enzyme systems.
`Both enzymes have no requirement
`for M$+ or ATP. Our
`results suggest that higher eukaryotes have A/G-specific re-
`pair pathways similar to those identified in bacteria (11, 13).
`As in bacteria, this pathway may be involved in correcting
`replication errors to prevent C/G-to-A/T transversions. This
`is another highly conserved DNA mismatch repair pathway.
`T/G mismatch repair in human cells (28) appears similar to
`the very short patch repair system of E. coli (6). The nick-
`directed repair reactions in Drosophila and human cells (25)
`resemble the methyl-directed system of E. coli and S. typhi-
`
`GDX 1011
`
`

`

`6484
`
`3' side of the junction point or loop.
`While the T/G-specific nicking activity may be involved in
`repairing deaminated 5-methylcytosines and the A/G-specific
`nicking may be involved in preventing C/G-to-A/T transver-
`sions, the function of human all-type nicking enzyme is not
`known. It may be involved in the gene conversion during
`genetic recombination. Reciprocal and unequal mitotic recom-
`bination between nonidentical repeated sequences generates
`heteroduplex DNA. Gene conversion may play a role in se-
`quence homogenization or diversification. Mismatch repair in
`heteroduplex DNA formed from the V regions or pseudo-V
`genes of the immunoglobulin genes could generate antibody
`diversity (42, 43).
`
`thank Dr. G. Barcak for critical reading of
`Acknowledgment-We
`the manuscript and helpful discussion on this work.
`
`I. 1
`
`Human Base Mismatch-specific Endonucleases
`murium and the hex pathway of S. pneumoniae (3-5). Thus,
`the three mismatch repair systems reported in bacteria are all
`present in higher organisms.
`The human all-type mismatch repair enzyme has a broad
`substrate specificity. It nicks all eight base mismatches but
`with different efficiencies. Similar enzymes activities have
`also been identified in calf thymus3 and yeast.4 These data
`suggest that the all-type enzyme is not the analog of bacterial
`MutS protein. First, the MutS protein from E. coli can bind
`to mismatched sites but has no catalytic activity. The MutS
`analog found in human and mouse by protein sequence ho-
`mology search (21, 22) may be the same protein that binds
`A/C-, T/C-, and T/T-containing DNAs in human Raji cells
`(23). Second, the mismatch specificity also differs from the
`two enzyme systems. The E. coli MutS protein binds very
`well to DNA containing a T/G mismatch (13), but the T/G
`mismatch is the weakest substrate for the HeLa all-type repair
`enzyme. C/C mispair is repaired poorly in the E. coli methyl-
`directed (11, 13) and HeLa terminus-directed reactions (25)
`but is nicked very well by the HeLa all-type repair enzyme.
`The unique property of the HeLa all-type nicking enzyme
`is its strand disparity. With respect to the DNA fragment
`shown in Fig. 1, the enzyme only nicked the upper strand,
`and no incision on the lower strand could be detected. This
`strand specificity is not directed by strand breaks or methyl-
`ation because unmodified linear DNA substrates are used in
`these experiments. Preliminary data suggest that the neigh-
`boring DNA sequences influence the di~parity.~ As far as we
`are aware, this type of enzyme has not been described in any
`organisms. One unsolved problem for this enzyme is that no
`nicking product could be observed by using DNA fragments
`labeled at the 5' end of the cutting strands. There may be a
`contamination of a 5'-phosphorylase or a 5'- to 3"exonucle-
`ase that degrades the nicking product. After specific nicking
`at the 5' side of the mismatched base, a 3'- to 5'-exonuclease
`also may act from this point and
`degrade the 5"labeled
`product. Another possibility involves a mismatch-specific ex-
`onuclease that acts from the 5' end toward the mismatched
`site with reaction stopping just before the mispair. Further
`purification and characterization are needed to address this
`question.
`The human all-type mismatch nicking activity is function-
`ally homologous to the resolvases from bacteriophage T4 (33,
`34), yeast (35-37), calf thymus (38), and human (39) in two
`aspects. Both enzyme systems make an incision (or incisions)
`near the mismatched site or Holliday junction point, and
`cleavage occurs in one orientation depending on the neigh-
`boring sequences. In some respects, the Holliday junction may
`be viewed as two heteroduplex DNA molecules, each with one
`mismatched base pair. Some resolvases are active on hetero-
`duplex loops (37, 40). However, the action of resolvase re-
`quires M$+, which is not essential for the human all-type
`mismatch repair enzyme. The incision sites were also different
`for both enzyme systems. The human all-type repair enzyme
`nicks at the first phosphodiester bond 5' to the side of the
`mispaired base. The nicking sites of most resolvases, except
`yeast Endo X1 (35) and T7 endonuclease I (41), map to the
`' Y.-C. Yeh and A-L. Lu, unpublished results.
`D.-Y. Chang, and A-L. Lu; unpublished results.
`D.-Y. Chang, Y.4. Yeh, and A-L. Lu, unpublished results.
`
`REFERENCES
`1. Fincham, J. R. S., and Holliday, R. (1970) Mol. & Gem Genet. 109, 309-
`322
`2. Holliday, R. (1974) Genetics 78,273-287
`3. Claverys, J.-P., and Lacks, S. A. (1986) Microbiol. Reu. 5 0 , 133-165
`4. Modrich, P. (1987) Annu. Reu. Biochem. 56,435-466
`5. Radman, M., and Wagner, R. (1986) Annu. Reu. Genet. 20,523-538
`6. Lieb, M. (1983) Mol. & Gen. Genet. 181,118-125
`7. Lieb, M., Allen E., and Read, D. (1986) Genetics 114, 1041-1060
`8. Raposa, S., and Fox, M. S. (1987) Genetics 117,381-390
`9. Jones, M., Wagner, R., and Radman, M. (1987) Cell 50,621-626
`10. Au, K. G., Cabrera, M., Miller, J. H., and Modrich, P. (1988) Proc. Natl.
`Acad. Sci. U. S. A. 85,9163-9166
`11. Lu, A-L., and Chang, D.-Y. (1988) Genetics 118,593-600
`12. Radicella, J. P., Clark, E. A,, and Fox, M. S. (1988) Proc. Natl. Acad. Sci.
`U. S. A. 85,9674-9678
`13. Su, S.-S., Lahue, R. A,, Au, K. G., and Modrich, P. (1988) J. Biol. Chem.
`263,6829-6835
`14. Lu. A-L.. Cuiua. M. J.. ID. M. S.. and Shanabruch. W. G. (1990) J. Bacteriol.
`,
`.
`
`172,1232rl240
`Nghiem, Y., Cabrera, M., Cupples, C. G., and Miller, J. H. (1988) Proc.
`15.
`Natl. Acad. Sci. U. S. A. 85,2709-2713
`Lu, A-L., and Chang, D.-Y. (1988) Cell 54,805-812
`16.
`Au, K. G., Clark, S., Miller, J. H., and Modrich, P. (1989) Proc. Natl. Acad.
`17.
`Sci. U. S. A. 86,8877-8881
`Mankovich, J. A,, McIntyre, C. A., and Walker, G. C. (1989) J. Bacteriol.
`18.
`171,5325-5331
`Prudhomme, M., Martin, B., Mejean, V., and Claverys, J.-P. (1989) J.
`19.
`Bacteriol. 171,5332-5338
`Kramer, W., Kramer, B., Williamson, M. S., and Fogel, S. (1989) J.
`20.
`Bacteriol. 171,5339-5346
`Fujii, H., and Shimada, T. (1989) J. Biol. Chem. 264,10057-10064
`21.
`Linton, J. P., Yen, J.-Y. J., Selby, E., Chen, Z., Chinsky, J. M., Liu, K.,
`22.
`Kellems, R. E., and Crouse, G. F. (1989) yol. Cell. Biol. 9,3058-3072
`Stephenson, C., and Karran, P. (1989) J. B~ol. Chem. 264,21177-21182
`23.
`Hare, J. T., and Taylor, J. H. (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 ,
`24.
`7350-7354
`25. Holmes, J., Jr., Clark, S., and Modrich, P. (1990) Proc. Natl. Acad. Sci. U.
`S. A. 87,5837-5841
`26. Brown, T. C., and Jiricny, J. (1987) Cell 5 0 , 945-950
`27. Jiricny, J., Hughes, M., Corman, N., and Rudkin, B. B. (1988) Proc. Natl.
`Acad. Sci. U. S. A. 85,8860-8864
`28. Wiebauer, K., and Jiricny, J. (1989) Nature 339,234-236
`29. Wiebauer. K., and Jiricnv, J. (1990) Proc. Natl. A c d . Sci. U. S. A. 8 7 ,
`..
`5842-5845
`30. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular C h i n A
`Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Hartor,
`N V
`31. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65,499-560
`32. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res.
`",
`1 1 . 1475-1 489
`33. Kemper, B., and Garabett, M. (1981) Eur. J. Biochem. 115, 123-131
`34. Lilly, D. M. J., and Kemper, B. (1984) Cell 36,413-422
`35. West, S. C., and Korner, A. (1985) Proc. Natl. Acad. SCL. U. S. A. 82,6445-
`f i A A 9
`S., and Kolodner, R. (1985) Proc. Natl. Acad. Sci. U. S. A.
`36. Symi&on, L.
`82,7247-7251
`37. Jensch, F., Kosak, H., Seeman, N. C., and Kemper, B. (1989) EMBO J. 8,
`4325-4334
`38. Elborough, K. M., and West, S. C. (1990) EMBO J. 9,2931-2936
`39. Waldman, A. S., and Liskay, R. M. (1988) Nuclerc Aclds Res. 16, 10249-
`10266
`40. Kleff, S., and Kemper, B. (1988) EMBO J. 7, 1527-1535
`41. Dickie, P., McFadden, G., and Morgan, A. R. (1987) J. Biol. Chem. 2 6 2 ,
`1 AR%-1 ARRfi
`""" I """
`42. Maizels, N. (1989) Trends Genet. 5, 4-8
`43. Becker, R. S., and Knight, K. L. (1990) Cell 63,9