letters
`
`HE © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`
`
`1Lahoratory of
`Molecular
`Carcinogenesis, MD
`01-06, National
`Institute of
`Environmental
`Health Sciences,
`National Institutes
`ofHealth, Research
`Triangle Park,
`North Carolina,
`USA.
`{Section of
`Molecular
`Carcinogenesis,
`Institute ofCancer
`Research, Haddow
`Laboratories,
`Surrey, UK and
`Chester Beatty
`Laboratories,
`Fulham Road,
`London, UK
`3Department of
`Molecular
`Medicine,
`Endocrine Tumor
`Unit, Karolinska
`Hospital,
`Stockholm, Sweden
`4Department of
`Human Genetics
`and Medicine,
`McGill University,
`Montreal General
`Hospital, Montreal,
`Quebec. Canada
`5Departmentof
`Surgery, Duke
`University Medical
`Center, Durham,
`North Carolina
`27710—261 1, USA
`6CRC Centerfor
`Molecular Biology,
`Institutefor Cancer
`Research, Haddow
`Laboratories,
`Surrey, UK and
`Chester Beatry
`Laboratories.
`Fulham Road,
`London, UK
`7Department of
`Obstetrics and
`Gynecology,
`Division of
`Gynecologic
`Oncology, Duke
`University Medical
`Center, Durham,
`North Carolina,
`USA
`3Department of
`Genetics, Duke
`UniversityMedical
`Center, Durham,
`North Carolina,
`USA
`
`Correspondence
`should he addressed
`to RAE
`e-maihfiitreOOl @
`mc.duke.edu
`
`238
`
`SEGA? mutations in primary
`
`breast and ovarian cancers
`
`Table 1 BRCA2 mutations In primary broad cancer
`
`Patient no. Age
`
`Mutation
`
`Effect
`
`Germline/
`somatic
`
`Johnathan M. Lancaster], Richard Woosterz,
`Ionathon Mangionz, Catherine M. Phelan3‘4’5,
`Charles Cochran‘, Curtis Gumbss, Sheila Sealz,
`Rita Barfootz, Nadine Collinsz, Graham Bignellz,
`Sandeep Patelz, Rifat Hamoudiz,
`Catharina Larsson3, Roger W. Wiseman‘,
`Andrew Berchuck7, I. Dirk Igleharts,
`Jeffrey R. MarksS, Alan Ashworth6 ,
`Michael R. Stratton2 Sr P. Andrew Futrealm8
`
`second hereditary breast cancer gene,
`The
`BRCA2, was recently isolatedl. Germline muta-
`tions of this gene predispose carriers to breast
`cancer, and, to a lesser extent, ovarian cancer.
`Loss of heterozygosity (LOH) at the BRCA2 locus
`has been observed in 30—40% of sporadic breast
`and ovarian tumours, implying that BRCA2 may
`act as a tumour suppressor gene in a proportion
`of sporadic cases 2‘5. To define the role of BRCA2
`in
`sporadic breast and ovarian cancer, we
`screened the entire gene for mutations using a
`combination of techniques in 70 primary breast
`carcinomas and in 55 primary epithelial ovarian
`carcinomas. Our analysis revealed alterations in
`2/70 breast tumours and none of the ovarian car—
`cinomas. One alteration found in the breast can—
`cers was a 2-basepair (bp) deletion (471 OdelAG)
`which was subsequently shown to be a gerrnline
`mutation,
`the other was a somatic missense
`mutation (Asp3095Glu) of unknown significance.
`Our results suggest that BRCA2 is a very infre-
`quent target for somatic inactivation in breast and
`ovarian carcinomas, similar to the results obtained
`for BRCA1.
`
`We analysed genomic DNA from 70 breast and 55
`epithelial ovarian cancers for BRCAZ mutations. Thir-
`ty-four of the breast and 18 of the ovarian tumours
`(56% and 53% respectively of informative cases)
`showed LOH in the BRCA2 region, using the markers
`D13S260, D1 35171, D13SZ60, and D135153. The latter
`marker is intragenic to the RBI gene. All tumours
`analysed which were informative for both the BRCA2
`and the RBI regions of l3q show concomittant LOH
`
`19
`6
`
`59
`74
`
`471 OdelAG
`C to A
`
`framoshift
`Asp3095Glu
`
`germline
`somatic
`
`(data not shown). The complete coding region was
`screened in each sample using both single strand con-
`formation analysis (SSCA) and denaturing gel deletion
`analysis. In addition, exons 10, 11 and 27 were also
`screened by the protein truncation test (PTT). Poten-
`tial sequence alterations represented by aberrant bands
`were characterized by direct sequencing in all cases.
`Sequence alterations were identified in 2/70 breast
`tumours (Table l), but none of the 55 ovarian sam—
`ples. An SSCA shift in error: 11 was detected in breast
`carcinoma sample #19 (Fig. 1). This Eagment, along
`with the corresponding fragment from the patient’s
`normal lymphocyte DNA and a healthy control, were
`sequenced directly. A 2-bp AG deletion was detected,
`corresponding to a 4710delAG mutation. This deletion
`produces a frameshift leading to a predicted premature
`termination codon 2 amino acids downstream. The
`deletion was present in the patient’s germline (Fig. 1b).
`No family history of cancer had been reported by this
`individual, who was diagnosed at age 59 with a unilat-
`eral infiltrating ductal carcinoma. In breast carcinoma
`sample #6 a somatic alteration was detected. This
`alteration was found to be a C to A transversion in
`exon 25 resulténg in an aspartate to glutamate amino
`acid change at codon 3095 (Fig. 2). The change was
`not present in the patients lymphocyte DNA, nor in
`over 300 control chromosomes. Six different highly
`polymorphic microsatellite markers on chromosomes
`16 and 17 confirmed that the tumour and lymphocyte
`DNA came from the same patient (data not shown).
`This tumour sample had LOH in the BRCA2 region
`and it was the aberrant glutamate residue that was
`retained in the tumour. This patient had a unilateral
`infiltrating ductal adenocarcinoma diagnosed at age
`74. The significance of this amino acid change is
`unclear. Additionally, several sequence variants were
`detected via SSCAé.
`The lack of BRCA2 mutations in sporadic breast and
`ovarian cancers is very reminiscent of the results
`obtained for BRCAIHO. Similar to the observation for
`BRCAI, the region containing BRCAZ undergoes LOH
`in a fraction of breast and ovarian carcinomas“. The
`
`
`
`Control
`
`
`
`\icmr
`
`Ru:
`
`\
`
`Fig. 1 a, SSCA autoradlogram showing shift in Patient 19 in lane 3. b, ABI electropherograrns showing gerrnllne delAG in patient 19.
`The antisense strand is shown. M01 91', DNA from patient's tumour. MCIQN, DNA from patient’s peripheral blood. Control is unrelat—
`ed normal blood DNA.
`
`nature genetics volume 13 june 1996
`
`GeneDX1012, pg. 1
`
`GeneDX 1012, pg. 1
`
`

`

`fig © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`letters
`
`
`
`
`
`6 Tumor
`Fig. 2 a, Autoradiogram SSCA showing shift of tumour 6 in lane
`3. b, Electropherogram showing sequence of missense mutation
`in tumour 6. Antisense strand is shown for both patients’
`tumour and normal blood DNA. The G to T transversion in
`tumour DNA shown in the réght panel results in a GAQ to GAA/
`Asp to Glu amino acid substitution on the sense strand. This
`missense change was not present in the matching peripheral
`blood DNA from the same patient in the left panel.
`
`relatively close proximity of the RBI gene could be dri-
`ving the majority of the LOH seen in these cases. Our
`study set contained no tumours that demonstrated
`loss at one region versus the other when informative
`for both. However, for breast and particularly ovarian
`cancers, there is evidence to suggest that the RBI gene
`can be excluded from the regions of loss in some cases
`and is not always targeted for inactivation in cases with
`large scale losses on 13g (refs 3, 5, 11). Our screening
`set contained both tumours selected for LOH in the
`
`BRCA2 region as well as unselected cancer cases to
`increase the likelihood of finding mutations. Addition—
`ally, we employed three complementary techniques in
`screening for mutations, and thus feel that few coding
`region mutations have been missed. The two alter—
`ations found were both from tumours showing LOH.
`One case was a germline frameshift deletion which was
`retained in the tumour, the other a somatic missense
`mutation which was also retained in the tumour. The
`significance of the latter somatic mutation is unclear.
`Our data showing infrequent mutations in sporadic
`tumours suggests that if BRCAZ plays a significant role
`in tumourigenesis in the non-hereditary forms of
`these cancers, it is through a mechanism other than
`structural mutation. Further, combined with the data
`on somatic mutations of BRCA1 in sporadic breast
`and ovarian cancers, the evidence suggests that heredi-
`tary breast cancer (and ovarian cancer in the context of
`breast/ovarian cancer syndromes) may be fundamen-
`tally different diseases at the molecular genetic level.
`This is not to suggest that these genes play no role in
`the development of non-hereditary breast and ovarian
`cancers. Recent evidence would suggest that subcellu-
`lar localization and/or expression levels may be critical
`in BRCAI involvement in cancerlzili’, Given the results
`presented here, parallel studies on the expression,
`localization and, ultimately, normal
`function of
`BRCA2 are paramount.
`
`Methods
`Samples. Tumour tissue and matched blood lymphocytes were
`obtained from patients treated at Duke University Medical
`Center, USA, and the Royal Marsden Hospital. England and
`from the Gynecologic Oncology Group/Cooperative Human
`Tissue network ovarian tissue bank (USA). Tissues was
`obtained under general consent
`for discarded tissue and
`tumour/white cell banking. Genomic DNA was obtained from
`tumour tissue and blood using standard procedures. The
`breast cancers were all infiltrating ductal carcinomas with the
`exception of two pure intraductal carcinomas. The mean age of
`onset for the breast study set was 53. The ovarian carcinomas
`were of mixed histology, the majority being papillary serous
`(90%), and the mean age of onset for the tumours studied was
`58. There were no cases of either bilateral breast or dual prima-
`ry breast/ovarian cancer in the study set.
`
`Single strand conformation analysis. The entire coding
`region, including intron/exon borders. was examined by SSCA
`(using primers given in Table 2a) Genomic DNA (20 ng) was
`amplified using primers under the following standard PCR
`conditions: 50 mM KCl, 10 mM Tris-HCl, pH 9.0, 1.5 mM
`MgCl2 (Promega), 0.2 mM dTTP, dCTP and dGTP, 0.05 mM
`dATP, and (ct-P32)dATP (Amersham) at l pCi/reaction and 2
`U Taq DNA Polymerase (Promega) in a final volume of 10 pl.
`Thermocycling conditions consisted of 30 cycles of 30 s at
`94 °C, 30 s at 55 °C, and 30 s at 72 °C, followed by one cycle of
`3 min extension at 72 °C in a 9600 Thermocycler (Perkin
`
`239
`
`GeneDX 1012, pg. 2
`
`
`Table 23 BRCAZ PCR primers
`Sequenoefi‘qa')
`Bron
`Primers
`Sequence (5‘—>3’)
`F—CAAGCATYGGAGGAATATCG
`JADS
`MCCAGAAAGAATAAATACT
`R—GWETGGWCTMGCMCAC
`CCTCAACGCAAATATCTI'CAT
`CACMATTTGTCTGTCACTGG
`TTCCMAGTAATATCCAATGTA
`A'I'TGCAWACT'TACCTMGTC
`ATTTTI'GATITATTCTCGTTGTT
`ATCCAGAGTATATACATYCTC
`AAGTGAAAGACATAWACAGACAG
`GATCYTCTWTCTTAG
`TATGAAGCTTCCCTATACT
`AAAATMCCTAAGGGA‘ITTGC
`CACCTTGTGATGTTAGTTTG
`CMAYTCTCMTTACTAAGTC
`TTGGGATATI'AMTGTTCTGGAGTA
`CAATTCAGTMACGWMGTG
`MGTAACGAACATTCAGACC
`AACAGAAGTA'ITAGAGATGAC
`CTGGGTYTCTCTI'ATCAACAGCA
`CATGTMTCWTAGTAGATGTGC
`GTCTTCACTATTCACCTACG
`CTCMAGmTTAGATAMTTACAG
`AGTGAGACTTTGG‘ITCCTAAT
`GCATTGAGAGTTITTATACTAGTG
`TTCAACMGAGAAACAACAGT
`ACCTGTAGTYCAACTAAACAG
`GTCAGTTCATCATCTTCCATAM
`GGYTCTGTTH'ATACTTTAACAGG
`CWACTCCAMGATTCAGAMACTAC
`GATCAGTATCATUGGTTCCAC
`AGCATACCAAGTCTACTGAATAMC
`CAMGACCACATTGGAMGTC
`ATAAAACTGATATTATTTGCC
`GATCAGTATCA‘lTTGGTTCCAC
`TCCACCTGAGGTCAGAAT
`AAGCAAACGCTGATGMTGTG
`TAMGCCTATAATTGTCTCA
`TGGTCACATGMGAMTATGC
`CTTCTTAACGTTAGTGTCATT
`CAGGTCTMATGGAGCCCAG
`MGGAACGTCAAGAGATACAG
`GAGAAGTTCCAGATATFGCC
`GGTFGGTCTGCCTGTAGTMT
`CATCTTGAATCYCATACAGAC
`CTI'CAAGCAATTTAGCAGTTTCAGG
`GACATMGGAGTCCTCCTTC
`GCTGCTTGATTGGAGTI’GTT
`MGGCTCTGAMGTGGACTG
`ATTTAATTACMGTCTTCAG
`GCMATGTMGTGGTGCTTC
`ACTCTGTCATAAAAGCCATC
`GATGGTACTFI’AATTTGTCAC
`TAl' FTTGTGTAGCTGTATACG
`CMGATCCTGAGAGATTACTG
`AGGGMTACATAAAAGTTMC
`GCTCTTTlGGGACMTTCTG
`ATTCAGTATCATCCTATGTGG
`ATMAAGAC | l
`I CTGGGATTG
`TATGATTACGTAATGTAATGC
`'GGMTACAGYGATACTGAC
`GAATTCTAGAGTCACAC’TTCC
`CAGGI'GGCMCAGCTC
`ATCTAACTGGGCC'YTAACAGC
`CCCATGGMMGAATCMGATG
`TGGCCATYKI'I’GAACTTACAG
`GTTCCTTAGTATTGCTMAGC
`M'lTGAGCATCC'l'I’AGTAAGC
`TGTCTTCCMGTAGCTAATG
`GAATGAAAACTCTTATGATATCTG
`CTGTGATTTGAMYTGGACC
`AAGAGACCGMACTCCATCTC
`ACATGAACAAATGGGCAGGAC
`CACTGTGGCTGGCCTGATAC
`TGGTTTGAATTAAAATCCTGC
`AGTCTCTAAGAC
`GTTCTC
`GTCATATAACCCC?CAGATG
`TAAATCTCCCTTCTTTGGGTG
`CTGTACCTTCAMTTGCTTGC
`TTCCTTCTTGTGATGGCCAG
`CGATI’GGTCAGGTAGACAGC
`TCTAGTTACMTAGATGGAAC
`C’TCTGCAGAAGTTTCCTCAC
`MTCA
`GTTAGTAAGGTC
`TGWCTACTGMWCTGC
`GCATCTTTCTCATCTTTCTCC
`GTTATC’TTCAI l l l CAGTATTTCTC
`TGAAATAAAATTTCATCTGAAAAC
`TTGAMTGACTACTGGCAC
`TTG‘l'lAGTTI'ATGGAATCTCC
`CCTTCATMACTGGCCAGATAAT
`TAATCATAAGAGA
`AAAAGAC
`TGTCTTAMTI’ATCTGGCGAG
`TTCCATTCTAGGAG‘ITGCGC
`AAA?GACTCTITGGCGACAC
`GTGGTGATGCTGAAAAGTAAC
`AGA l I GAGACTTCTGA'MC
`YTTATAAAGCAGC l
`CCAC
`TCCAGTACCAACTEGGGACAC
`ATACTTCTTATAATATTCCTTGAG
`TGGACAU CTAAGTTATGAGG
`ACATAATTATGATAGGCTACG
`AUTCACTAGTACC‘I'TGCTCTTTT
`MATGTACAAATGGGACTAAC
`TGATGAMMGAGCAGGTAC
`AGCCTI'GGATTTCTTGAGTAG
`ACMGGTTITIATCATTATTG
`TCCTAGTGGA'I'I'CACTGACAG
`CTGCCCCMAGTGTAMGAMT
`TCTTITGTCTGGTI'CMCAGG
`AA‘T‘GACTGAATMGGGGACTGAT
`AAGCGTCAATAATTTA‘ITGTG
`TCCTGCMCFTGTTACAC
`JADS
`
`GA l l GTCAT‘I’ITCAGC
`
`10
`
`11
`
`JAD48
`
`JAD47
`
`JAD52
`
`M049
`
`JADSO
`
`JADSi
`
`JAD5dF
`JAD23R
`JADZOF
`JAD23R
`JAD24
`
`JAD25
`
`JADZG
`
`JA027F
`JADZOR
`JAD53
`
`JADZZ
`
`JAD21
`
`JADi9
`
`JADiB
`
`JADi?
`
`JAD16
`
`JAD15
`
`JADN
`
`JUL5 F3
`JUL§ R4
`JADiS
`
`JAD12
`
`JUL5 F1
`JUL5 R1
`JADH
`
`JAD1O
`
`JAD I
`
`JADG
`
`JADS
`
`JAD4
`
`JADS
`
`JADE
`
`JAD‘l
`
`JADSO
`
`S1237
`S1236
`A45
`AM
`S1239
`S1238
`JADS1
`
`JADE)?
`
`JADGS
`
`JAD84
`
`JADGS
`
`JADSS
`
`JADE?
`
`JADSS
`
`JA038
`JADSQ
`
`JAD40
`
`JAD41
`
`JAD42
`
`JAD43
`
`JAD¢4
`
`JAD45
`
`12
`
`13
`
`14
`
`15
`
`16
`
`1 T
`
`18
`
`19
`
`20
`
`21
`
`22
`23
`
`24
`
`25
`
`26
`
`27
`
`nature genetics volume 13 june 1996
`
`GeneDX 1012, pg. 2
`
`

`

`a; © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`letters
`
`
`
`Table 2b BRCAZ PTT prl ers
`
`Exon
`10
`1 1
`11
`11
`11
`11
`11
`27
`
`Primers
`JAD20F x JADZOR
`JAD54F x JAD17R
`JAD17F x JAD14R
`JAD14F x JAD12R
`JAD12F x JAD8R
`JADSF x JAD5R
`JADSF x JAD2R
`JAD43F x JAD45F1
`
`P‘lT primer sequencea (5'—>3’)
`JL—PTTH GAAACAG‘lTGTAGATACCTCTGAAGA
`JL-PTTD GATTCTGAAGAACCAACTTTGTCC
`JL-PTTF GAAATCAAGCTCTCTGAACATAAC
`JL—PTTE GAAACTTCTGCAGAGGTACATCCA
`JL—PTTA GACATTCTAAGTTATGAGGA
`JL—F’TTB GGTCAACCAGAAAGAATAAATACT
`JL—PTI'G GGGAAGCTTCATAAGTCAGTC
`JL—PTTJ TCTTCTCCTAATFGTGAGATA
`
`aEach PTT primer is preceded by the T7/Kozak sequence 5'—GGATCCTAATACGACT—
`CACTATAGGGAGACCACCATG—G‘.
`
`Elmer). PCR product (4 pl) was diluted in 56 pl of loading
`buffer (95% formamide, 10 mM NaOH, 0.05% bromophenol
`blue, 0.05% xylene cyanol), denatured at 94 °C for 5 min, and
`rapidly cooled on ice. A sample of 4 pl was electrophoresed
`through a 0.5x MDE gel (AT Biochem) containing 0.6x TBE
`buffer, at room temperature for 14-18 h at 8 W, dried, and
`autoradiographed for 1—18 h. Migration shift analysis was also
`used for detection of small deletions/insertions]. Samples were
`amplified as described above and were run through 5% defea-
`turing sequencing gels at 70 W, dried and autoradiographed
`for 1—4 11.
`
`Protein truncation test. Exons 10, 11 and 27, which represent
`64% of the coding region, were amplified in 8 segments by the
`polymerase chain reaction (PCR) using primers given in Table
`217. A 1 pl aliquot of each of these primary templates was sub—
`jected to 10 additional cycles of PCR, in a reaction mixture
`containing a modified primer carrying a T7 promoter and
`eukaryotic translation initiation sequence in place of the for—
`ward primer. A 20 pl reaction mix containing 6 pl of the sec-
`ondary PCR product,
`1.6 pl of 35S-methionine
`(1,000
`
`Ci/mmol, Amersham), 0.8 ul RNAsin (recombinant 40 U/pl),
`0.4 pl TnT T7 RNA Polymerase, 0.2 pl amino acid Methion—
`ine(v) Mix, and 5.0 pl TnT Rabbit
`reticulocyte lysate
`(Promega), was incubated at 30 °C for 1 h. This product (6 pl)
`was electreephoresed on a 10—20% SDS—polyacrylamide Ready-
`Gel (Biorad), fixed, dried and autoradiographed for 3—18 h.
`
`DNA sequence analysis. Sequencing templates were produced
`for samples showing aberrant mobility on SSCA or PTT. Aber—
`rant SSCA bands were cut from the MDE gel and eluted in 100
`pl of dHZO for 90 min at 37 °C. An additional 30 cycles of PCR
`was then carried out to amplify the DNA eluted from the gel
`slice. A parallel PCR was carried out to amplify genomic DNA
`from the same patient using the same primers. PCR products
`were purified using the Wizard PCR Prep DNA Purification
`System (Promega) and sequenced using a PRISM DyeDeoxy
`Terminator Cycle Sequencing kit and a 373 automated fluores—
`cent sequencer (Applied BioSystems), according to manufac-
`turer's instructions.
`
`Acknowledgements
`We thank P. Biggs, N. Rahman and B. Gusterson for assistance
`This work wasfunded in part by the NCI/Duke University
`Specialized Program ofResearch Excellence (SPORE) in brew:
`cancer P50-CA68438, MH/NCIgrantRZl ~CA68348. NIH grant
`1R21 -CA66228, the National lrtsititattes ofEnvironmental Health
`Science; the Cancer Research Campaign, BREAKTHROUGH
`Breast Cancer Charity and lean Rook Appeal, the US Army, the
`Institutefor Cancer Research. C.M.R and CL. werefunded by the
`Swedish Cancer Foundation.
`
`Received 28 Febniary; accepted 29 March 1996.
`
`1. Wooster. R. et al. Identification of the breast cancer susceptibility gene
`BRCAZ. Nature 378, 789-792 (1995).
`2. Lundberg. C. at 3/. Loss of heterozygosily in human ductal breast
`tumours indicates a recessive mutation on chromosome 13. Pm. Natl.
`Acad. Sci. USA 84. 2372-2376 (1987)
`3. Kim, T.M. et a]. Loss of heterozygoslty on chromosome 13 is common
`only in the biologically more aggressive subtypes of ovarian eptimelial
`tumors and is associated with normal retinoblastoma expeession. Cancer
`Res. 54, 605-609 (1994).
`4. Collins, N. et a]. Consistent loss of the wild type allele in breast cancers
`from a family linked to the BRCA2 gene chromosome 13q12-13.
`Oncogene 10, 1673-1675 (1995).
`5. Clayton—Jansen, AM. at al. Loss of heterozygosity in sporadic breast
`tumors at the BRCA2 locus on chmmosom§13q12v13 Br J. Cancer72,
`1241—1244 (1995).
`6. Phelan. CM. et a]. Mutation analysis of the BRCA2 gene in 49 site-
`specific breast cancer families. Nature Genet 13. 120—122 (1996;.
`
`7. Futreel. PA. et aI. BRCA1 mutations in primary breast and ovarian
`carcinomas. Science 266, 120—122(1994).
`8. Morajver. SA etel. Somatic mutations in the BRCA1 gene in sporadic
`ovarian tumours. Nature Genet. 9. 439-443 (1995).
`9. Hosking. L et al. AmaticBRCM mutation in an ovarian tumour: Nature
`Genet. 9,343—644(1995).
`10. Takahashi. H. at al. Mutation analysis of the BRCAi gene in ovarian
`cancers Cancerfles. 56, 29%6002 (1995).
`11. Keeangueven, F. et 3/. Patterns of loss at neterzygosity at locr from
`chromosome arm 13o suggest a possible involvement of BRCA2 in
`sporadic breast tumors. Genes Chrom. Cancer 13, 29% —294 (1995).
`12. Chen, Y, at al. Aberrant subcellular localization of BRCA1 in breast
`cancer. Science 270, 789—791,(1995).
`13. Thompson. M.E.. Jensen. RA. Obermiller, P.S., Page. D.L & Holt, J.T.
`Decreased expression ofBRCA1 ameleretes growth and is often present
`during sporadic breast cancer progression. Nature Genet. 9, 444—450
`(1995).
`
`240
`
`nature genetics volume 13 june 1996
`
`GeneDX 1012, pg. 3
`
`GeneDX 1012, pg. 3
`
`