962
`
`in a developmental disorder, Williams syndrome. Nat Genet
`5:11-16
`Foster K, FerrelL, King-Underwood L, Povey S, Attwood 1,
`Rennik R, Humphries SE, et al (1993) Description of a
`dinucleotide repeat polymorphism in the human elastin gene
`and its use to confirm assignment of the gene to chromosome
`7. Ann Hum Genet 57:87-96
`Gyapay G, Morissette 1, Vignal A, Dib C, Fizames C, Millas(cid:173)
`seau P, Marc S, et al (1994) The 1993-1994 Genethon
`human genetic linkage map. Nat Genet 7:246-339
`Helms C, Dutchik 1, Lee M, Lacy M, Veile R, Burgess A,
`Hing A, et al (1995) 182 microsatellite loci placed on the
`chromosome 7 map. (Abstract and fig 3 in: L-C Tsui, H
`Donis-Keller, K-H Grzeschik [1994] Report of the Second
`International Workshop on Human Chromosome 7 Map(cid:173)
`ping 1994. Cytogenet Cell Genet 71:1-31)
`Iles DE, Lehmann-Horn F, Scherer SW, Tsui L-C, Weghuis
`DE, Suijkerbuijk RF, Heytens L, et al (1994) Localization
`of the gene encoding the a.i&-subunits of the L type voltage
`dependent calcium channel to chromosome 7q and analysis
`of the segregation of flanking markers in malignant hyper(cid:173)
`thermia susceptible families. Hum Mol Genet 3:969-975
`Lowery MC, Morris CA, Ewart A, Brothman L1, Zhu XL, Leo(cid:173)
`nard CO, Carey 1C, et al (1995) Strong correlation of elastin
`deletions, detected by FISH, with Williams syndrome: evalua(cid:173)
`tion of 235 patients. Am 1 Hum Genet 57:49-53
`Lupski 1R, Roth 1R, Weinstock GM (1996) Chromosomal
`duplications in bacteria, fruit flies, and humans. Am 1 Hum
`Genet 58:21-27
`Nickerson E, Greenberg F, Keating MT, McCaskill C, Shaffer
`LG (1995) Deletions of the elastin gene at 7q11.23 occur
`in -90% of patients with Williams syndrome. Am 1 Hum
`Genet 56:1156-1161
`Peoples R, Perez-1urado L, Wang Y-K, Kaplan P, Francke U
`(1996) The gene for replication factor C subunit 2 (RFC2)
`is within the 7q11.23 Williams syndrome deletion. Am 1
`Hum Genet 58:1370-1373
`Suter U, Patel PI (1994) Genetic basis of inherited peripheral
`neuropathies. Hum Mutat 3:95-102
`Tromp G, Christiano AM, Goldstein M, Indik Z, Rosenbloom
`1, Deak SB, Prockop D1, et al (1991) A toG polymorphism
`in the elastin gene. Nucleic Acids Res 19:4314
`Weissenbach 1, Gyapay G, Dib C, Vignal A, Morissette 1,
`Millasseau P, Vaysseix G, et al (1992) A second generation
`linkage map of the human genome. Nature 359:794-801
`Williams 1CP, Berratt-Boyers BG, Lowe 1B (1961) Supra valvu-
`lar aortic stenosis. Ciculation 24:1311-1318
`
`Address for correspondence and reprints: Dr. Charles D. Boyd, Department
`of Surgery, UMDNJ-Roben Wood Johnson Medical School, New Brunswick,
`NJ 08903.
`© 1996 by The American Sociery of Human Genetics. All rights reserved.
`0002-9297/96/5904-0029$02.00
`
`Am. f. Hum. Genet. 59:962-964, 1996
`
`A Somatic Truncating Mutation in BRCA2 in a
`Sporadic Breast Tumor
`To the Editor:
`Recently, a second susceptibility gene for hereditary
`breast and ovarian cancer, BRCA2, was cloned (Woos-
`
`Letters to the Editor
`
`ter et al. 1995; Tavtigian et al. 1996). The subsequent
`identification of heterozygous germ-line mutations con(cid:173)
`firmed its role as a predisposing factor in a subset of
`familial breast and ovarian cancer families (Wooster et
`al. 1995; Lancaster et al. 1996; Miki et al. 1996; Tavtig(cid:173)
`ian et al. 1996; Teng et al. 1996). The possible involve(cid:173)
`ment of BRCA2 in the sporadic forms of breast and
`ovarian tumors was addressed in three recent reports
`analyzing the gene for somatic mutations in 212 primary
`breast cancers and 55 ovarian cancers (Lancaster et al.
`1996; Miki et al. 1996; Teng et al. 1996). Although
`several alterations were identified, all except two
`changes were shown to represent germ-line mutations.
`Moreover, the two somatic BRCA2 alterations were
`found to be missense mutations resulting in a Asp3095-
`Glu change (Lancaster et al. 1996) in one case and in a
`His2415Asn change (Miki et al. 1996) in the other.
`Given the questionable effect of missense mutations on
`protein function, the role of BRCA2 in the carcinogene(cid:173)
`sis of sporadic breast tumors remains unclear.
`In order to identify in primary breast cancers the so(cid:173)
`matic BRCA2 mutations with clear functional conse(cid:173)
`quences, we have analyzed the three large exons-10,
`11, and 27-of BRCA2, together constituting 65% of
`the coding region of the gene (Tavtigian et al. 1996), in
`69 unselected samples of frozen breast tumor sections,
`using the protein-truncation test (PTT) (Roest et al.
`1993). Here we report a first case of a truncating somatic
`mutation in BRCA2 in a primary ductal breast carci(cid:173)
`noma with demonstrated loss of heterozygosity (LOH).
`PTT was utilized to identify protein-termination muta(cid:173)
`tions in exons 10, 11, and 27 of BRCA2, using genomic
`DNA and oligonucleotide primers PTT10 fir (5'-CTT(cid:173)
`AATACGACTCACTATAGGGAGACCACCATGTAT(cid:173)
`ACTTTAACAGGATTTGGAA-3' I 5' -ACACAGAAGG(cid:173)
`AATCGTCATC-3'), the overlapping primer sets PTT11A
`fir (5' -CTT AA TACGACTCACT ATAGGGAGACCACC(cid:173)
`ATGI I I I IATGTTTAGGTTTATTGC-3'15'-TGCATT(cid:173)
`CCTCAGAAGTGGTC-3'), PTT11B fir (5'-CTTAAT(cid:173)
`ACGACTCACTATAGGGAGACCACCATGAAACCA(cid:173)
`AGCTACATATTGCAG-3' IS' -TAA TTTCCTACAT AA(cid:173)
`TCTGCAG-3'), PTT11C fir (5'-CTTA ATACGACT(cid:173)
`CACTATAGGGAGACCACCATGTGGCTTAGAGAA(cid:173)
`GGAATATTTG-3' IS' -AAAATAGTGATTGGCAAC(cid:173)
`ACG3'), and the primer set PTT27 fir (5'-CTTAATACG(cid:173)
`ACTCACTATAGGGAGACCACCATGACGTTTTCA(cid:173)
`TTTTTTTATCA-3' IS' -ATAATTTATTGTCGCC(cid:173)
`TTTGC-3'). SDS-PAGE analysis of translated PCR prod(cid:173)
`uct PTT11A rlf revealed a truncated protein of -35 kD
`in breast tumor tissue but not in blood lymphocytes of
`patient Sp27 (fig. 1a). The genetic identity of tumor and
`lymphocyte DNA in patient Sp27 was verified by informa(cid:173)
`tive markers at D11S524 and D11S554 (data not shown)
`and was also confirmed at D13S260 and D13S171 (fig.
`1b). Sequencing of the variant PTT allele in the approxi-
`
`GeneDX 1011, pg. 1
`
`

`

`Letters to the Editor
`
`a
`
`b
`
`963
`
`2 3
`
`kDa
`
`N N T T
`
`N NT T
`
`66
`46
`
`30
`
`D13S171
`
`D13S260
`
`c
`
`d
`
`2880
`2910
`2900
`2890
`I
`I
`I
`I
`wild-type 5' ... CTITIC TCAGAC AATGAG AAT AATTTIGTCTICCAA GTA GCT ... 3'
`LFSDNENNFVFQVA
`
`..- de! A
`
`mutant
`
`5' .. . CTITIC TCAGCAATG AGAATAATTTTGTCTTCC AAGTAGCTA ... 3'
`LFSAMR I ILSSK*
`
`Figure 1
`Analysis of BRCA2 exon 11 in ductal breast tumor of patient Sp27. a, SDS-PAGE analysis of PTTllA f/r product translated
`with rabbit reticulocyte lysate. Lane 1, Healthy control individual. Lane 2, Blood sample. Lane 3, Tumor tissue of patient Sp27. The truncated
`protein product of 35 kD is present only in the tumor, and not in the blood-lymphocyte sample, of patient Sp27 (arrow). b, LOH at D13S260
`and Dl3S171 in breast tumor DNA (lanes 3 and 4, arrows), but not in blood-lymphocyte DNA, of patient Sp27 (lane 1 and 2). c, Sequencing
`of the mutant allele. A 1-bp deletion at nucleotide 2881 of BRCA2 is present. The wild-type sequence is shown for comparison. d, 2881delA
`mutation, which results in a termination codon at position 894 (asterisk ["]),with nine novel amino acids at the C-terminus of the truncated
`protein.
`
`mate region believed to contain the protein-termination
`mutation demonstrated a 1-bp deletion at nucleotide 2881
`(fig. 1c), thus resulting in a termination codon at position
`894, with nine novel amino acids at the C-terminus of the
`truncated protein (fig. 1d).
`To demonstrate LOH at the BRCA2 locus in the
`breast tumor of patient Sp27, we analyzed markers at
`D13S260 and D13S171, which were known to closely
`flank BRCA2 on the proximal and distal side, respec(cid:173)
`tively (Wooster et al. 1994). Whereas in lymphocyte
`DNA the heterozygous alleles at D13S260 and D13S171
`are present in similar intensities, a significant reduction
`of the respective lower alleles of the two microsatellite
`markers can be observed in the tumor DNA, thus
`strongly suggesting that in one allele a chromosomal
`deletion encompassing the entire BRCA2 gene (fig. 1b).
`Although the minor presence of the wild-type allele in
`the tumor sample of patient Sp27 was consistently no(cid:173)
`ticed (fig. 1a and b), we assume this to be due to the
`presence of contaminating nonmalignant stroma cells in
`the tumor preparation. Similar technical difficulties are
`commonly encountered in LOH studies (e.g., see Hosk(cid:173)
`ing et al. 1995).
`
`In analogy to the nonrandom distribution of the
`known BRCA2 germ-line mutations (Wooster et al.
`1995; Lancaster et al. 1996; Miki et al. 1996; Tavtigian
`et al. 1996; Teng et al. 1996), sporadic breast tumors
`may reveal a similar mutational profile. If this is correct,
`one can preliminarily extrapolate our data to the entire
`coding region of BRCA2, suggesting that this gene may
`be implicated in sporadic breast cancer in -2%-3% of
`all cases. In contrast, LOH involving the BRCA2 locus
`may be present in 30%-40% of sporadic breast tumors,
`which may suggest a similar number of somatic muta(cid:173)
`tions in the BRCA2 gene (Cletonjansen et al. 1995; Ker(cid:173)
`angueven et al. 1995). However, it already has been
`pointed out that LOH in sporadic breast carcinomas
`may overestimate the involvement of BRCA2 in these
`tumors. Instead, the BRCA2 locus may be a specific
`target of LOH in only a minor number of cases (Cleton(cid:173)
`jansen et al. 1995; Kerangueven et al. 1995). This ap(cid:173)
`pears consistent with our and three other reports that
`identified an additional two somatic missense mutations
`among 212 breast carcinomas studied (Lancaster et al.
`1996; Miki et al. 1996; Teng et al. 1996). Together,
`these findings show that somatic BRCA2 mutations are
`
`GeneDX 1011, pg. 2
`
`

`

`964
`
`involved in the primary events of breast carcinogenesis,
`although only in a minor subset of sporadic breast can(cid:173)
`cers.
`
`BERNHARD H. F. WEBER/ MONIKA BROHM/
`INGRID STEC/ ]AEL BACKE/ AND HANS CAFFIER2
`1 Universitiit Wurzburg, Institut fur Humangenetik,
`Biozentrum, and 2 Frauenklinik der Universitiit,
`Wurzburg
`
`Acknowledgements
`
`We are grateful to Holger Hohn for his continuous encour(cid:173)
`agement and to Ms. Michaela Kapp for technical assistance.
`This work was supported by the Institute of Human Genetics
`(Titelgruppe 77).
`
`References
`
`Cletonjansen AM, Collins N, Lakhani SR, Weissenbach J,
`Devilee P, Cornelisse CJ, Stratton MR ( 199 5) Loss of hetero(cid:173)
`zygosity in sporadic breast tumours at the BRCA2 locus on
`chromosome 13q12-q13. Br J Cancer 72:1241-1244
`Hosking L, Trowsdale j, Nicolai H, Solomon E, Foulkes W,
`Stamp G, Signer E, et al (1995) A somatic BRCA1 mutation
`in an ovarian tumour. Nat Genet 9:343-344
`Kerangueven F, Allione F, Noguchi T, Adelaide J, Sobo H,
`jacquemier J, Birnbaum D (1995) Patterns of loss of hetero(cid:173)
`zygosity at loci from chromosome arm 13q suggests a possi(cid:173)
`ble involvement of BRCA2 in sporadic tumours. Genes
`Chromosom Cancer 13:291-294
`Lancaster JM, Wooster R, Mangion j, Phelan CM, Cochran
`C, Gumbs C, Seal S, et al (1996) BRCA2 mutations in pri(cid:173)
`mary breast and ovarian cancers. Nat Genet 13:238-240
`Miki Y, Katagiri T, Kasumi F, Yoshimoto T, Nakamura Y
`(1996) Mutation analysis in the BRCA2 gene in primary
`breast cancers. Nat Genet 13:245-247
`Roest PAM, Roberts RG, Sugino S, van Ommen G-JB, den
`Dunnen JT (1993) Protein truncation test (PTT) for rapid
`detection of translation-terminating mutations. Hum Mol
`Genet 2:1719-1721
`Tavtigian S, Simard J, Rommens J, Couch F, Shattuck-Eidens
`D, Neuhausen S, Merajver S, et al (1996) The complete
`BRCA2 gene and mutations in chromosome 13q-linked kin(cid:173)
`deeds. Nat Genet 12:333-337
`Teng DH-F, Bogden R, Mitchell}, Baumgard M, Bell R, Berry
`S, Davis T, et al (1996) Low incidence of BRCA2 mutations
`in breast carcinoma and other cancers. Nat Genet 13:
`241-244
`Wooster R, Bignell G, Lancaster J, SwiftS, Seal S, Mangion
`j, Collins N, et al (1995) Identification of the breast cancer
`susceptibility gene BRCA2. Nature 378:789-792
`Wooster R, Neuhausen SL, Mangion J, Quirk Y, Ford D,
`Collins N, Nguyen K, et al (1994) Localization of a breast
`cancer susceptibility gene, BRCA2, to chromosome 13q12-
`13. Science 265:2088-2090
`
`Letters to the Editor
`
`Address for correspondence and reprints: Dr. Bernhard H. F. Weber, Institut
`for Humangenetik, Biozentrum, Am Hubland, D-97074 Worzburg, Germany.
`E-mail: bweb@biozentrum.uni-wuerzburg.de
`© 1996 by The American Society of Human Genetics. All rights reserved.
`0002-9297/96/5904-0030$02.00
`
`Am.]. Hum. Genet. 59:964-968, 1996
`
`A View of the Neolithic Demic Diffusion in Europe
`through Two Y Chromosome-Specific Markers
`
`To the Editor:
`The farmer economy originated in different places of
`the world. One of the most important (probably the
`first) is in the Middle East, in the so-called Fertile Cres(cid:173)
`cent, from which farming spread toward Europe, North
`Africa, Arabia, East Africa, and southwestern Asia (In(cid:173)
`dus valley) (Cavalli-Sforza et al. 1994).
`Two models, the cultural and the demic, were pro(cid:173)
`posed to explain the neolithic expansion of the early
`farming to Europe. According to the first, this expansion
`might have occurred by transmission of new technolo(cid:173)
`gies without movements of farmers and then without
`changes in the genetic makeup of the preexisting popula(cid:173)
`tions. According to the second, the spread of the farming
`economy might have occurred through the migration of
`farmers who progressively admixed with local paleo(cid:173)
`lithic hunter-gatherers. As a direct consequence, a
`change of allele frequencies should have taken place for
`those genes that differentiated the old inhabitants from
`the newcomers. The model of demic diffusion, called
`"the wave of advance" by Ammerman and Cavalli(cid:173)
`Sforza (1984), is the most accepted, at least for Europe,
`where it is also supported by archaeological records
`(Menozzi et al. 1978). It implies clines of the farmers'
`gene frequencies, which decrease with increasing dis(cid:173)
`tance from the area of origin.
`By performing principal components analysis on nu(cid:173)
`merous classical markers, synthetic maps were con(cid:173)
`structed for Europe and the Near East (Menozzi et al.
`1978), which show the Near East as the center of con(cid:173)
`centric clines of decreasing gene frequencies and give
`value to the theory of demic spread of agriculture.
`Further support to this theory is given by a large popu(cid:173)
`lation survey we carried out on some Y -specific poly(cid:173)
`morphisms. Two markers have been found, the distribu(cid:173)
`tion of which illustrate well the process of "wave of
`advance."
`We studied the Taql Y-specific RFLPs detected by
`p12f2 (DYS11) and 49a,f (DYS1) probes in ~3,000 sub(cid:173)
`jects of different populations, mainly from Europe (par(cid:173)
`ticularly from the Mediterranean basin) but also from
`Africa and Asia.
`
`GeneDX 1011, pg. 3
`
`