lfi © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`
`Mutation analysis is the
`BRCA2 gene in primary
`breast cancers
`
`Yoshio Miki‘, Toyomasa Katagiril, Fujio Kasumiz,
`Takamasa Yoshimoto2 8r Yusuke Nakamural'3
`
`
`
`Breast cancer, one of the most common and dele-
`terious of all diseases affecting women, occurs in
`hereditary and sporadic forms. Hereditary breast
`cancers are genetically heterogeneous; suscepti-
`bility is variously attributable to germline muta—
`tions in the BRCA1 (ref. 1). BRCAZ (ref. 2), TP53
`(ref. 3) or ataxia telangiectasia (ATM)4 genes, each
`of which is considered to be a tumour suppressor.
`Recently a number of germline mutations in the
`BRCA2 gene have been identified in families
`prone to breast cancer“. We screened 100 pri-
`mary breast cancers from Japanese patients for
`BRCAZ mutations, using PCR-SSCP. We found
`two germline mutations and one somatic mutation
`in our patient group. One of the germline muta—
`tions was an insertion of an Alu element into exon
`22, which resulted in alternative splicing that
`skipped exon 22. The presence of a 64-bp
`polyadenylate tract and evidence for an 8—bp tar—
`get—site duplication of the inserted DNA implied
`that the retrotransposal insertion of a transcrip-
`tionally active AIu element caused this event. Our
`results indicate that somatic BRCAZ mutations,
`like somatic mutations in the BRCA1 gene, are
`very rare in primary breast cancers.
`The BRCAZ gene is composed of 27 exons distributed
`over roughly 70 kb of genomic DNAS. Using PCR-SSCP,
`we screened the entire coding sequence and intronic
`sequences flanking each of its exons for mutations in
`DNAs from 100 primary breast cancers. The DNA
`sequences of PCR products obtained from tumour
`DNAs, and corresponding constitutional DNAs corre—
`sponding to SSCP—variants, were determined.
`We found one somatic and two germline mutations
`(Fig. 1:) This novel 650—bp fragment was also detected
`(Table l). The tumour DNA from patient 1840 had a
`in the constitutional DNA of this patient. The 650-kb
`C—to—A transition at the first nucleotide of codon 2415
`fragment was not detected in 100 control DNAs, sug—
`(Fig.
`1a), which results
`in the substitution of
`gesting that it was an insertion of about 350 bp into
`one of the BRCA2 alleles of patient 2472.
`asparagine for histidine. As this mutation was not pre—
`sent in the constitutional DNA, the alteration was con»
`To further characterize the insertion, we subcloned
`sidered to be a somatic event.
`In patient 1500,
`the 650—bp fragment and determined its nucleotide
`constitutional and tumour DNAs showed a 4-bp dele—
`sequence. We found that the BRCA2 gene was disrupted
`tion (ACAG) in exon 9 (Fig. 1b), leading to a prema—
`in exon 22 at base position 38 by insertion of 346 bp
`ture termination of BRCA2 transcript due to a
`(Fig. 2a, b). A 64—base polyadenylate tract was found at
`frameshift. In patient 2472, we found for exon 22 and
`the 3' end of the inserted sequence, and an 8-bp
`its flanking sequences an approximately 650-bp PCR
`(TCACAGGC)
`target—site duplication of the BRCA2
`fragment in addition to the normal 300-bp fragment
`sequence (underlined in Fig. 2a) flanked the integrated
`
`Table 1 Mutations of the BRCAZ gene in breast cancer patients
`
`Fig, 1 Sequence analysis of PCR products of tumour and corre—
`sponding normal DNAs that showed aberrant bands by SSCP. a,
`A one=base substitution of C to A at codes! 2415 (arrow) in
`tumour DNA (sequence 2) from patient 1840. This alteration was
`not present in the constitutional DNA (sequence 1). b, A 4-bp
`deletion (ACAG) in exon 9 found in constitutional (sequence 2)
`and tumour (sequence 3) DNAs from patient 1500. Sequence 1:
`normal control. The sequences of the normal and mutated allee
`ice are indicated on the left and right of the panel, respectively. A
`box indicates the deleted nucleotides. 0, DNA sequencing of the
`normal PCR product and the 650-bp fragment containing the
`insertion in patient 2472. Panel a, 5’ end of the insertion (32,
`arrow) and the normal counterpart (a1). Panel b. 3‘ end of the
`insertion (b2, arrow). preceded by polyadenylation, and the nor-
`mal counterpart (b1). The 8-bp sequence in brackets (a2, b2}
`constitutes the presumed target site duplication.
`
`Patient No.
`1840
`
`Somatic
`
`Exon Codon
`14
`2415
`
`Nucleotide change
`QATaAAT
`
`Effect of coding sequence
`Missense (HisaAsn)
`
`Age of onset
`49
`
`1500
`
`Germline
`
`9
`
`252
`
`4 hp deletion
`(ACAG)
`
`346 bp insertion2934 65 Frameshift
`
`22
`Germline
`2472
`None of the patients had a family history of breast cancer.
`
`Frameshift
`
`
`
`34
`
`lDepartment of
`Human Genome
`Analysis, the Cancer
`Chemotherapy
`Center and
`2Department of
`Surgery, Japanese
`Foundationfor
`Cancer Research, 1-
`37~l Kami—
`ikebukuro,
`Toshimaku, Tokyo
`170, Japan
`3Laboratory of
`Molecular
`Medicine, Institute
`ofMedical Science,
`The University of
`Tokyo, 4—6-1
`Sirokanedai,
`Minatolcu, Tokyo
`108, Japan
`
`Correspondence
`should be addressed
`to Y.M.
`
`nature genetics volume 13 june 1996
`
`245
`
`GeneDX 1005, pg. 1
`
`GeneDX 1005, pg. 1
`
`

`

`@E © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`letters
`
`a
`
`zxznnu
`
`eorru mm gamer-rue moment rum
`so
`1
`“221.:- coma: W mun: caramel-r: coo-cocoon
`llllilllll
`llllilllll !||.il Ill lllllilill
`lllllllll
`Conn-nod meux com/tram
`51
`ion
`axzzm-
`tzmoeccon 7cm W 51cm cam
`llill'lill illlllllil
`llllililll llllll lll llllllllll
`Conan-d mecca 7cm Mm mucosa scram
`m
`is»
`hum mama man mam mama: my;
`llllllllli llllllllll
`ll lllillllll lillllll I
`lil
`Ill
`Manned mm mm Mano-u mmccococromec
`isr
`zoo
`amn- more W unease»: emu: mucosa
`illllll ll Illillllll
`illlllllll llllllllll Il‘li'llll
`cean-ma Wm “account rmmmmmumc
`2c:
`zsu
`untu- mmaee m m mm com
`lllliillll l||llli'|l llllllllll
`llllllllll Illlllllll
`eon—m WWW! momec coca-recon com
`2::
`m
`zxmna come-truer; cameos AW W manna
`lllllilill
`lllllllill
`llllllllll ||
`Cool-nod mmmmm..................
`39;
`150
`has" W W W W m
`an
`:70
`Exam: minim—J Tourism-u
`
`h
`
`(
`
`
`
`l
`'__i
`
`—»
`
`(-
`
`d
`
`
`
`of Alu elements is thought to occur
`through an RNA polymerase III-
`derived transcript in a retroposition
`process“). The Alu element inserted
`in the BRCAZ allele reported here is
`flanked by perfect 8—bp duplications
`of the target site without deletion of
`the original BRCAZ gene sequence;
`this phenomenon is Characteristic of
`insertions of mobile elements into
`
`staggered single-strand nicks“. Our
`results indicate that the Alu inserv
`
`tion may have been integrated by
`retrotransposal
`events. The Ala
`insertion into the BRCA2 gene
`would be expected to alter the gene
`product significantly, as it resulted
`in the skipping of exon 22 (199 bp)
`in the transcript; this event would
`shift the coding frame and lead to an
`early termination of
`translation.
`Retrotransposal
`integration
`of
`sequences such as Alu and LINE-1
`into biologically important genes is
`thought to play a significant role in
`several human genetic diseaseslz“l6.
`For example, we reported disruption
`of the APC gene by retrotranscrip-
`tional insertion of L1”. It will be of
`interest to determine the frequency
`with which transposable element—
`mediated inactivation of human
`
`Fig. 2 Analysis of the insertional mutation in patient 2472. 3, Comparison of the inserted sequence (Ex22ins)
`with Alu consensus sequences. The consensus sequence of the conserved Alu subfamily is on the lower
`(“Conserved") line. Vertical lines indicate nucleotide identity. Four nucleotides in the insertion are different
`from the consensus sequence of the Aiu subfamily (at base positions 87. 124, 126, 149). Undedlning indi-
`cates bases corresponding to the targetuséte duplication. b, Schematic diagram of the Alu insertion and the
`experimental design for RT-PCR analysis. Upper box indicates the location of the Alu insertion, flanked by an
`8-bp target-site duplication indicated by hatched boxes. Vertical arrows denrfie s’ries of in-trame stop codons
`within the Alu insertion. Primers were selected to examine whether a transceipt from the allele with the Alu
`sequence was present. Horizontal arrows under the “transcrip ” boxes indicate positions of DNA sequences
`corresponding to the primers for RT-PCR in that experiment. c, Agarose gel electrophoresis of RT-PCFI prod-
`ucts. Lane 1, DNA size markers(BRL 1-kb ladder); lane 2. product of a PCR using primers corresponding to
`DNA sequences in exons 21 and 22; lane 3, two products of a PCR using primers corresponding to DNA
`genes occurs in somatic or germlinc
`sequences in exons 21 and 23. d, Sequence analysis of RT-PCR products. Panel 1, DNA sequences of the
`cells, and to discover whether inher-
`exon 21—22 iunction in the norrnai transcript; Panel 2, DNA sequences of the smaller transcript. Arrows indi-
`ited or environmental factors influ-
`cate the boundaries. Comparison of these sequences revealed that abnormal transcript lacked axon 22
`sequence, probably because of alternative splicing.
`ence that frequency.
`The present demonstration of
`two novel constitutional mutations in BRCAZ adds to
`the published evidence that germline mutation of this
`gene is the primary predisposing factor in some fami-
`lies prone to breast cancer. However, we found only
`one somatic mutation of BRCA2 among the 100 pri-
`mary breast cancers examined. A similarly low fre-
`quency characterizes mutations of the BRCA1 gene:
`dozens of germline mutations of BRCA1 have been
`identified in breast cancer patients, but to date no
`somatic mutations of that gene have been reported in
`any breast cancers. As a result, any role that BRCAI
`may play in sporadic breast and ovarian cancers
`remains elusive. Recently, Holt et al.13’19 presented evi-
`dence that BRCAI is a selective growth inhibitor of
`breast and ovarian cells, a tumour suppressor gene. It
`is not known whether BRCA1 and BRCA2 function in
`the same pathway of tumour suppression. One possi—
`ble explanation for the low frequencies of somatic
`mutations in BRCA1 and BRCA2 in primary breast
`cancers is that their transcription and/or translation
`may be regulated by a target gene that is more favored
`for mutation in sporadic tumours than either of them.
`The decreased expression of BRCA1 in sporadic breast
`cancers20 supports this hypothesis. We have not exam~
`ined the expression of BRCA2 in sporadic tumours,
`but our results suggest
`that somatic mutation of
`BRCA2 is not a major contributor to carcinogenesis in
`sporadic breast cancers.
`
`DNA without deletion of any BRCAZ sequences. A
`search for homologies with DNA sequences in the pub—
`lic database revealed that the inserted fragment was
`highly homologous
`(different at only 4 of 282
`nucleotides) to the consensus sequence of the conserved
`Alu subfamily”)8 (Fig. 2a). We subsequently examined
`the BRCA2 transcript in the same patient, considering it
`likely that inactivation of her BRCAZ gene was caused
`by truncation of the gene product by an in-frame stop
`codon in the inserted Alu sequence (Fig. 2b). However,
`we found by RT-PCR amplification and subsequent
`DNA sequencing that the transcript lacked exon 22 (Fig.
`2c, d). The insertion of the Alu sequence in exon 22,
`through some unknown mechanism, led to alternative
`splicing, causing this exon to be skipped.
`in
`Both the patients with germline mutations
`BRCAZ had no family history of breast cancer (Table
`1). However, as the penetrance of Japanese patients
`careying BRCAZ mutation is unknown, it is uncertain
`whether these patients have de novo mutations. The
`position of the 4-bp deletion is located one nucleotide
`downstream of that described5. Although the number
`of the reported germline mutations in the BRCA2 gene
`is very small, it may be possible that the region around
`codon 252 is a mutational hotspot.
`Alu elements are interspersed repetitive sequences
`found in human DNA; they are mobile elements, with
`copy numbers in excess of 500,000 (ref. 9). Mobilization
`
`246
`
`nature genetics volume 13 june 1996
`
`GeneDX 1005, pg. 2
`
`GeneDX 1005, pg. 2
`
`

`

`@4 © 1996 Nature Publishing Group http://www.nature.com/naturegenetics
`letters
`
`
`
`Table 2 Sequence or BRCAZ primels used tor PCR-SSCP aaarysis
`Exon Sense primer (5'-)3')
`Antisense primer (593')
`
`CAACACTGTGACGTACTGGGT
`CTCAGTCACATAATAAGGAATGC
`2
`CTAAATTCCTAGTTTGTAGTTC
`CAAATTTGTCTGTCACTGGTI'A
`3
`CATCTTTATAGTTCAAATATATGTA
`CAAAGAATGCAAATITATAATCC
`4
`AAACTCCCACATACCACTGG
`ATATCTAAAAGTAGTATTCCAACA
`5
`AATCTCAGGGCAAAGGTATAAC
`CTACAATGTACACATGTAACAC
`6
`TAACAGAATTA‘ITAGAGATGACAA‘lT
`CGTTAAGTGAAATAAAGAGTGAATGA
`7
`GTGTCATGTAATCAAATAGTAGATGT AATGTAAGATAAATAAT‘ITAACAAGG
`8
`TACTACTATATGTGCATI'GAGA
`ACAGAGCAAGACTCCACC?
`9
`TAGCACATTCTACATAAACTGTTC
`CACAGAAGGAATCGTCAGCTA
`10
`11-A TTTAGTGAATGTGATI’GATGGTA
`GTAAATGTGCAGATACAGTATTA
`11-B TTGTAAATACCTTGGCATTAGA
`GTCCCTGGAAGGTCACTAGT
`11-0 TGGACATTCTAAGTTATGAGGAA
`ACTITCTCCAATCCAGACATAT
`11-D CTCTAGATAATGATGAATGTAGC
`CTTAATTGTTAGCATACCA
`12
`AAAATGGTCTATAGACH‘TTGAG
`ACCTATAGAGGGAGAACAGAT
`13
`ACAGTAACATGGATATTCTCTTA
`AAACGAGACTI'TTCTCATACTG
`14
`CTGCAACAAAGGCATATTCCTAA
`ATATCTAACTGAAAGGCAAA
`15
`ATTTAATTACAAGTC‘ITCAGAATG
`ATAAAAGCCATCAGTATTGTAG
`16
`TWATTGTGTGATACATGTTTACT
`AAAGAGGGATGAGGGAATAC
`17
`GTTGAATFCAGTATCATCCTAT
`ATAGGATGATACTGAATTCAAC
`18
`CTTGTTTAAACAGTGGAATTCTA
`TAACTGAATCAATGACTGAT
`19
`GAATTGAATACATATI'I'AACTACTA
`CCATCTCAAACAAACAAACAAAT
`20
`ACTGTGCCTGGCCTGATAC
`TGTTAAATTCAAAGCCTCTAAGA
`21
`TATGCTTGGTTC‘I'lTAGTTTl’AG
`CTCACC'ITGAATAATCATCAAG
`22
`GTTCTGATTGCTTTTTATTCC
`AGTAAGGTCATTTFTTAAGTTAAT
`23
`TITAAATGATAATGACTTCTTCC
`TCCATAAACTAACAAGCACTTAT
`24
`TlTATGGAATCTCCATATGTTGA
`CTGGTAGCTCCAACTAATCAT
`25
`CTTAAAATTCATCTAACACATCTA
`AAAAATACCAAAATGTGTGGTGA
`26
`ACATAAATATGTGGGHTGCAAT
`ACGATGGCCTCCATATATACT
`27
`GAGACTGTGTGTAATAT‘ITGCGT
`AATAAAGCAGGCAGAATCA
`
`Methods
`tissue were
`Samples. Tumour and corresponding normal
`obtained at surgery from 100 breast cancer patients, 12 of whom
`reported positive family histories of breast cancer. We obtained
`the informed concent for genetic study from these patients.
`
`Mutation analysis. Entire exons and their associated splice
`junctions were examined by PCR-SSCP. Primers used for PCR—
`SSCP are listed in Table 2. Genomic DNA (10 ng) was ampli—
`fied by PCR; conditions consisted of 1 cycle at 94 “C for 2 min,
`30 cycles at 94 °C for 30 s, 60 0C for 30 s, and 72 ”C for 30 s,
`followed by 1 cycle at 72 °C for 2 min. Reactions took place in
`lO-ul volumes of 1x PCR buffer (25 mM TAPS, 50 mM KCl, 2
`mM MgC12 and 1 mM beta-mercaptoethanoi) containing 5
`pmole primers, 20 uM dNTPs, 0.5 U Taq polymerase, and Z
`uCi of [a]3ZP-dCTP (3,000 Ci/mmol, 10 mCi/ml). Each reac-
`tion mixture was incubated at 85 °C for 5 min and elec-
`
`trophoresed in a 6% polyacrylamide gel containing 5% glyc-
`erol at 16 °C. When variant bands were revealed in SSCP analy-
`sis, the PCR products of tumour and corresponding normal
`DNAs were electrophoresed on 2% agarose, extracted from the
`gel, and subcloned into pT7-Blue (Novagen). Nucleotide
`sequences were determined in the subclones by dideoxy—chain
`termination with T7 DNA polymerase, using sequences nested
`in the PCR primers.
`
`Multiplex SSCP analysis. A multiplex SSCP technique was
`used to screen exons 10, 11, 14, 18, and 2? as each of these
`exons was longer than 350 bp. PCR was carried out under the
`same conditions as above except that extension was performed
`for 2 min. PCR products were digested by various combina-
`tions of restriction enzymes: EcoRI, Dral for exon 10; Rsrzl,
`DmI for exon 11 A; DpnI, Paid for exon 11»B; Dpnl, Sspl,
`Suu961 for exon ll-C; Dral, Hindlll for exon llvD; Dral for
`exon 14; Sau3Al for exon 18; and Dml, Mspl, Scal, Bcll for
`exon 27. Digested PCR products were electrophoresed in 6%
`polyacrylamide gels containing 5% glycerol.
`
`RT-PCR analysis. Total RNA was extracted from normal tissue
`of the patient with ISOGEN (Nippon Gene), a procedure based
`on acid guanidine thiocyanatc—phenol—chloroform extraction”.
`Reverse transcription was carried out as described”, using 100
`ng of total RNA. PCR was performed under the same condi—
`tions as the genomic PCR. Primers in exons 21, 22, and 23 were
`5'—GTGCAC'I‘AACAAGACAGCAA—3',
`5'—TTGTGACATCC-
`CTT—B‘, and S'—TAGAT'I"I‘TGAAG’I'I‘GCAAGATG—3' respec-
`tively. RT—PCR products were subcloned, then sequenced using
`nested primers (5'—TGCAAGATGGTGCAGAGCTT—-3' for exon
`21,
`"—CAGATTCCATGGCCI'TCCTA—3'
`for exon 22, and
`S‘—TTCTGTATCTCI'TTCCTTCTG—3‘ for exon 23).
`
`Sequence accession number. The sequence data will appear in
`the EMBL, GenBank and DDBI Nucleotide Sequence data
`bases under accession number D83989.
`
`Acknowledgments
`We thank Y. Nakajima, H. Saita, 5. Sugai and E. Matsushima for
`technical assistance. This work was supported in part by a special
`grantfor Strategic Advanced Research on Cancerfrom the
`Ministry ofEducation, Culture, Sports, and Science of[upon and
`by a grantfrom the Japanese Ministry ofHealth and Welfare.
`
`
`Received 14 March; accepted 1 May 1996.
`
`1. Miki, Y. at al. A strong candidate for the breast and ovarian cancer
`susceptibility gene BRCA 1. Science 266, 66-71(1994).
`2. Wooster, R. et a1. Localization of a breast cancer susceptibility gene.
`BRCA2, to chromosome 13q12—13. Science 265. 2083—2090(1991).
`3. Malian, D. at al. Germ llnepss mutations in a familial syndrome of bmasl
`cancer. sarcomas, and other neoplasms. Science. 250, 1233-1238(1990).
`4. Savitaky, K. etal. A single ataxia telangiectasia gene with a product similar
`to PI-3 kinase. Science ace, 1749—1753(1995).
`5 Wooster, Fl. at al. Identification of the breast cancer susceptibélity gene
`BRO/12. Nature 378, 789-792(1995).
`6. Tavtiglan, SM et a]. The complete ERG/l2 gene and mutations in
`chromosome 13q-Iinked kindrads. Nature Genet. 12, 333-937(1996).
`7. Matora, AG.. Hellmann, U.
`«St Schmld. C.W A Transpositionally and
`transcriptionaliy competent Alu
`subfamily. Mol. Cell. Bibi
`10,
`5424-5432(1990).
`8 Batzer, MA. & Deininger. RL A human—specific subfamily oi Alu
`sequence. Genamics 9, 1181-4870991).
`9. Deininger, PL, Jolly, D.J., Rubin, C.M., Friedman, T. &Schmid, C.W Base
`sequence studies of 300 nucleotide renatured repeated human DNA
`clones. J. MOI. Biol. 151,17—23(1981).
`10. Rogers, J. Retroposons defined. Nature $1, 460 (1983).
`11 . Deininger, P.L. Mobile DNA, (eds Berg, DlE. & Howe. MM.) 619—636 (Am.
`Soc. Microbial, Washington, 1989).
`12. Vidaud, D. et al. Haamophilia B due to a de novo insertion of a human-
`specific Alu subfamily member within the coding region of the factor Ix
`gene. Eur J. Hum. Genet. 1, 30—96(1993).
`13. Muratani, K. eta]. inactivation of the cholinesterase gene by Alu insertion :
`
`possible mechanism for human gene transposition. Proc. Natl. Acad. Sci,
`USA 88, 1 1315-1 1319(1991).
`14. Mitchell, GA. at a]. Splice-mediated insertion of an Alu sequence
`inactivates omithine 5-aminotransterase : A role for-Ala elements In human
`mutation. Proc. Natl. Acad. SCI. USA 98, 815—819(1991).
`15. Wallace, MR. Andersen, L.B., Saulino, A.M., Gregory, RE., Glover, T.W. &
`Collins, ES. A de novo Alu insertion results in neurofibromalosrs type 1.
`Nature 353. 5644660991).
`16. Dombroski, BA, Mathias. S.L.. Nanthakumar. E., Scott, A. & Kazazian.
`H.H., Jr. Isolation of an active human lransposable element. Science. 254.
`1 805-1 908(1991).
`17 Mild, Y. et a]. Disruption of the APC gene by a retrotransposal insetion of
`L1 sequence in a colon cancer. CanoerFtes. 52, 643-645(199221,
`1B. Holt, J.T. eta]. Growth retardation and tumour inhibition by BRCA 1. Nature
`Genet. 12, 295-302(1996).
`19. Jensen, RA. et of. BRCA1 is secreted and exhibits properties of a granin.
`Nature Genet. 12, 3013-3080996).
`20. Thompson, ME. Jensen, R.A.. Obermiller, P.Si, Page. D.L. & Holt, J.T
`Decreased exprossron of BRCA1 accelerates growth and is often present
`during
`sporadic breast
`cancer
`progression. Nature Genet
`9,
`444—4500 995).
`21. Chomczynski, RA. Reagent tor the single-step simultaneous isolation of
`RNA, DNA and proteins from cell and tissue samples. Bio Techniques 15,
`532—536(1993).
`22. Koyama. K.. Sudo, K. & Nakamura, Y.
`Isolation of 115 human
`chmme 8 specific expressed sequence tags by exon amplification.
`Genomics 20, 245—253(1995).
`
`nature genetics volume 13 lune 1996
`
`247
`
`GeneDX 1005, pg. 3
`
`GeneDX 1005, pg. 3
`
`