`
`
`
`
`
`
`PHIGENIX
`PHIGENIX
`Exhibit 1007
`Exhibit 1007
`
`

`

`fiVolume 28, Number 8, August 1991
`
`ISSN 0161—5890
`
`I Jules.
`
`
`
`
`
`
`
`mmmnln
`
`
`
`
`
`
`
`
`
`
`
`3%
`
`«MW
`
`/
`
`
`
`
`
`
`
`BOARD OF' REGIONAL EDITORS
`
`Chairman
`1111011121..reururzrrear:
`Marserlle, France
`
`
`
`1313131311313"
`161511113
`G0d, Hungary
`
`raurrrrrrrra ‘
`131111111
`Ithaca, U.S.A.
`
`ram 115‘
`Exiiil‘rrrrfizn:
`Rehovot, Israel
`
`'rnrmu 11119141
`Tokyo, Japan
`
`.
`
`rt:
`,iJiaw‘
`5
`r—rmms arr-Wars We “V
`-nr:.
`3! A:
`1!
`
`AUG 27 1991
`
`130:5 Linden Dr.
`Madison. Wis. SW06
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
` W
`
`
`
`
` as?“
`
`
`
`WW
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`M
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`g“
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`m
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
` E:Er
`
`
`
`
`
`
`
`
`
`
`
`
`
`
` J
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`E-
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`J
`'9‘
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
` 0:.
`
`
`
`
`
`
`
`
`
`
`
`
`
`*‘J
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
` a. I?
`
`
`
`
`
`
`
`
`
`
` tag
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`5
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`'G
`u
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`5%
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`“gm
`
`a
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`1’
`
`
`
`
`
`
`
`
`
`Pergamon Press
`
`Oxford
`
`- New York
`
`- Seoul
`
`- Tokyo
`
`PHIGENIX
`
`Exhibit 1007-01
`
`

`

`Molecular Immunology
`
`Board of Regional Editors
`Prof. MICHEL FOUGEREAU (Chairman of the Board), Centre d'lmmuno/ogie de Marsei/Ie-Luminy, Case 906, 13288 Marseille
`Cedex 9, France.
`Dr STEVEN DOWER, lmmunex Corporation, 51 University Street, Seattle, WA 98101, U.S.A.
`Dr JANOS GERG ELY, Department Of Immunology, L. Eo'tvo's University, Javorka S.u. 14, God 2131, Hungary.
`Dr DAVID HOLOWKA, Department of Chemistry, Cornell University, Ithaca, NY 14853, U.S.A.
`Dr ROALD S. NEZLIN, Department of Chemical Immunology, The Weizmann Institute of Sciences, Rehovot 76100, Israel.
`Dr TOMIO TADA, Department of Immunology, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, Japan.
`
`Founding Editor
`Prof. DAN H. CAMPBELL
`
`G.
`
`.
`
`.
`
`Advisory Editors
`EDUARDO A. PADLAN
`FRANTISEK FHANEK
`I. ABELEV
`Bethesda, MD, USA.
`Praha. Czechoslovak/a
`MOSCOW: U.S.S.R,
`ISRAEL PECHT
`ARNOLD FROESE
`B. H. BARBER
`Rehovot, Israel
`W/nnr'peg, Canada
`Toronto, Canada
`CLAUDE DE PREVAL
`C. GRANIER
`DAVID H. BING
`Toulouse, France
`.
`Marseille, France
`Boston, MA, U.S.A.
`JEAN'FOU'S PREUD HOMME
`SEN-ITIROH HAKOMORI
`cur BORDENAVE
`Port/era, France
`Seattle, WA, U.S.A.
`Paris, France
`“gag” L-ARA'SIF’N
`JOHN K. INMAN
`0. A. BONA
`V "9”! ”5’”
`Bethesda, MD, U.S.A.
`New York. NY. U.S.A.
`EVA RAJNAVO LGYI
`..
`DAVID ISENMAN
`DENNIS R. BURTON
`J. (3/01;g/éfiffiy
`Toronto, Canada
`Sheffield, U.K.
`>
`New VOIk, NJ, U.S.A.
`M. KAARTINEN
`L. WILLIAM CLEM
`WALTER F. RIESEN
`Helsinki, Finland
`Jackson, Ml, U.S.A.
`St Gallen, Switzerland
`JEAN-PIERRE KINET
`JOHN E. COLIGAN
`KENNETH H. ROUX
`Bethesda, MD, U.S.A.
`Bethesda, MD, U.S.A.
`Tallahassee, FL, U.S.A.
`E. KLEIN
`MAURICE COLOMB
`D, J, ROWLAN DS
`Stockholm, Sweden
`Grenoble, France
`London, U.K.
`MICHEL KLEIN
`D. H. CONRAD
`CATHERINE SAUTES
`Toronto, Canada
`Richmond, VA, U.S.A.
`Paris! France
`o. M. KRANZ
`GIAMPIETRO CORRADIN
`VERNE N. SCHUMAKER
`Urbana, IL, USA.
`Lausanne, Switzerland
`L05 Ange/es! CA: U-S-A-
`M. P. LEFRANC
`SUSAN E, CULLEN
`DAVID M SEGAL
`Montpel/ier, France
`St Louis, MO, U.S.A.
`Bethesda! MD' U-s-A‘
`WARREN J. LEONARD
`JOSEPH M. DAVIE
`3- DAVID STOLLAR
`Bethesda, MD, U.S.A.
`Skokie, IL, U.S.A.
`JAioéUgénngéjE‘SA
`JOZEF LISOWSKI
`M. P. DIERICH
`Paris France
`Wroclaw, Poland
`Innsbruck, Austria
`MARC VAN REGENMORTEL
`”filiia‘ii‘iavlfiii'“
`3.5922230...”
`Strasbourg, France
`’
`’
`EDWARD w. voss. JR
`J- I?- MACH
`PETER L. EY
`Urbana, IL, U.S.A.
`Epallnges, Switzerland
`Adelaide, Australia
`|. YAHARA
`DAVID G, MARSH
`DOUGLAS FEARON
`Tokyo, Japan
`Baltimore, MD, USA.
`Baltimore, MD, U.S.A.
`JUNJI YODOI
`SHERIE L. MORRISON
`2. FISHELSON
`Kyoto, Japan
`Los Angeles, CA, U.S.A.
`Rehovot, Israel
`D. C. YUAN
`JIRI NOVOTNY
`R. FRADE
`
`
`Princeton, NJ, U.S.A.Paris, France Dallas, TX, U.S.A.
`
`Publishing andAdvert/sing Offices: Pergamon Press pic, Headington Hill Hall, Oxford 0X3 OBW, U.K., and Pergamon Press Inc., 395 Saw Mill River Road,
`Elmsford, NY 10523, USA. Published monthly. Annual
`institutional subscription rate (1991) DM 1235.00. Two year Institutional
`rate (1991/92)
`DM 234650. Personal subscription rate for those whose library subscribes at the regular rate (1991) DM 129.00. Subscription enquiriesfrom customers
`in North America should be sent to: Pergamon Press Inc., 395 Saw Mill River Road, Elmsford, NY 10523, U.S.A., and for the remainder of the world to:
`Pergamon Press plc, Headington Hill Hail, Oxford OX3 OBW, U.K. Subscription rates for Japan include despatch by air and prices are available on application.
`Prices are subject to change without notice.
`
`Micro/arm Subscriptions and Back Issues
`flack issues of all previously published volumes, in both hard copy and on microform, are available direct from Pergamon Press offices.
`
`Copyright © 1991 Pergamon Press plc
`It is a condition of publication that manuscripts submitted to this journal have not been published and will not be simultaneously submitted or published
`elsewhere. By submitting a manuscript, the authors agree that the copyright for their article is transferred to the publisher if and when the article is accepted
`for publication. However, assignment of copyright is not required from authors who work for organizations which do not permit such assignment. The
`copyright covers the exclusive rights to reproduce and distribute the article, Including reprints, photographic reproductions, microform or any other
`reproductions of similar'nature, and translation. No part of this publication may be reproduced, stored In a retrieval system or transmitted in any form or
`‘ by any means, electronic, electrostatic, magnetic tape, mechanical, photocopying, recording or otherwise, without permission in writing from the copyright
`holder.
`
`Photocopying information for users in the U.S.A. The Item-fee Code for this publication indicates that authorization to photocopy items for Internal
`or personal use is granted by the copyright holder for libraries and other users registered with the Copyright Clearance Center (CCC) Transactional Reporting
`Service provided the stated fee for copying, beyond that permitted by Section 107 or 108 of the United States Copyright Law,
`Is paid. The appropriate
`remittance of $3.00 per copy per article is paid directly to the Copyright Clearance Center Inc., 27 Congress Street, Salem, MA 01970.
`Permission for other use. The copyright owner's consent does not extend to copying for general distribution, for promotion, for creating new works.
`or for resale. Specific written permission must be obtained from the publisher for such copying.
`The Item-Fee Code for this publication is: 0161~5890/91 $300+ 0.00
`Whilst every effort is made by the publishers and editorial board to see that no Inaccurate or misleading data, opinion or statement appears In this Journal,
`they wish to make it clear that the data and opinions appearing In the articles and advertisements herein are the sole responsibility of the contributor or
`advertiser concerned. Accordingly, the publishers, the editorial board and editors and their respective employees, officers and agents accept no responsibility
`or liability whatsoever for the consequences of any such inaccurate or misleading data, opinion or statement.
`.TMThe paper used in this publication meets the minimum requirements of American National Standard for Information Sciences—Permanence of Paper for
`Printed Library Materials, ANSI 239.48-1984.
`
`PHIGENIX
`
`Exhibit 1007-02
`
`

`

`Molecular Immunology, V01. 28, N0. 8, pp. 915—917, 1991
`Print.6d in Great Britam.
`1
`
`0161-5890/91 $3.00 + 0.00
`© 1991 Pergamon Press pic
`
`identity of BCA200 and c-erbB-2 Indicated by Reactivity
`of Monoclonal Antibodies with Recombinant c-erbB-2
`
`David B. Ring’, Robin Clark and Amita Saxena
`
`Departments of Immunology [DR] and Molecular Biology [R0, AS]
`Cetus Corporation, Emeryvilie, CA 94068
`
`(First received 12 December 1990; accepted 3 May 1991)
`
`Abstract
`BCA200 has been described as a 200,000 Mr monomeric cell surface glycoprotein associated with human breast
`cancer. Since the physical properties and cellular distribution of BCA200 resemble those of c-erbB-2, antibodies to
`BCA200 were tested for the ability to bind a recombinant protein containing the c—erbB—2 extracellular domain (erbB-2
`ECD). Three antibodies to distinct epitopes of BCA200 reacted with erbB-2 ECD but not with a control protein
`expressed in a similar baculovlrus lysate. Control myeloma proteins and antibodies to four other antigens did not react
`with erbB-2 ECD. A protein with the expected molecular weight for erbB-2 ECD was also lmmunoprecipltated by anti-
`BCA200 antibody 52009. We conclude that BCA200 is another synonym for c-erbB-2.
`.
`
`.
`Introduction
`C—erbB-2 or HER-2 is a human proto-oncogene homologous to the rat neu oncogene and related in sequence to
`human erbBe1 or epidermal growth factor receptor (Coussens et al., 1985', Bargmann et al., 1986; Yamamoto et al.,
`1986).
`it encodes a 185-190,000 dalton protein product with extracellular, transmembrane and tyrosine kinase‘
`domains (Aklyama et al., 1986; Yamamoto et al., 1986). Normal c-erbB-2 product has transforming activity when over-
`expressed, as do several mutant gene products with amino acid substitutions in the transmembrane region (Di Flore
`et al., 1987; Slamon et al., 1989).- Gene amplification and protein level over-expression of c-erbB-2 have been
`observed in a wide variety of human adenocarcinomas and correlated with metastasis and poor prognosis (Slamon
`et al., 1987, 1989; Berger et al., 1988; Zhou et al., 1987).
`Recently, one of us described BCA200, an approximately 200,000 Mr glycoprotein recognized by a number of '
`mouse monoclonal antibodies raised against human breast cancer (Ring et al., 1989).
`in discussing the relationship
`of BCA200 to known tumor-associated antigens, we noted that a polyclonal rabbit .serum against c-erbB-2 did not
`capture antigen recognized by our BCA200 antibodies. However, many properties of BCA200 (Mr, monomeric
`glycoprotein structure, expression levels on particular cell lines, tumor types and normal human tissues) resembled
`those reported for c-erbB-2, leading us to question the negative result of the antigen capture experiment.
`(We were
`concerned that the polyclonal capture antibody was not affinity purified, and may actually have captured very little c~
`erbB-2). We have now carried out experiments showing that antibodies to three distinct epitopes on BCA200 react
`with a recombinant protein containing the extracellular domain of c-erbB-2.
`.
`
`Materials and Methods
`PCR subclonlng of the c-erbB-2 extracellular domain (erbB-2 ECD). cDNA template was prepared by reverse
`transcription of mRNA from tumor T882 (a gift of Dennis Siamon, UCLA). The cDNA was synthesized by using murine
`leukemia virus reverse transcriptase (Bethesda Research Laboratories) according to the manufacturer's protocol. The
`20 ul reaction mixture contained the enzyme buffer as supplied, 0.5 pg RNA, 10 units of RNasin (Promega Biotec,
`Madison, WI),
`10 pmol of 3’ PCR primer
`(CAGTCTAGATTTCAGGATCCGCATCTGCGC),
`1 mM (each)
`deoxynucleoslde triphosphates, and 100 units of reverse transcriptase. The reaction mixture was incubated for 30
`min at 37 °C. For amplification (Muiiis & Faioona, 1987; Salkl et al., 1985) 4 pl of the reaction mixture was then
`diluted Into 100 pl PCR buffer (10 mM Tris pH 8.4, 2.5 mM MgCl2, 50 mM KCI. 100 ug/ml BSA) containing 100uM
`dNTP’s,
`1 pmol of each primer and 0.5 unit of thermostable DNA polymerase from Thermus aquatlcus (Taq
`polymerase; Chlen et al., 1976; Saiki et al., 1988). The reaction was started by denaturing the RNA cDNA hybrid by
`heat (95 °C) for 1 min, annealing the primers for 1 min at 55 °C, and then extending the primers at 72 °C for 3 min.
`This cycle was repeated 25 times using a programmable heat block designed and manufactured by Cetus Corporation
`(Emeryvllle, CA). After the final cycle, the temperature was held at 72 °C for 10 min to allow reannealing of the
`amplified products and then was chilled. PCR amplification of the 5’ half erbB-2 ECD coding sequence was directed
`by the 5’ primer GCACCATGGAGCTGGCGGCC and the 3’ primer GCACTTCTCACACCGCTGTGTTCC. Amplification
`_________-———-—-
`
`1To whom correspondence should be addressed
`
` is material
`
`
`, be pro cted by Copyri
`
`915
`
`PHIGENIX
`
`Exhibit 1007-03
`
`

`

`916
`
`DAVID B. RING et al.
`
`Ema
`TRANS~
`iNTEFiNAL
`MEMB.
`EXTERNAL
`
`'3’?" V??' 9' 'l '9‘
`
`
`ie.s$>,»>fi»>$,.\,’>4\§-
`
`Reverse Transcriptase
`PCR
`
`pAcC4
`TRANSFER
`WWFfi /" VECTOR
`EB2-ECD cDNA
`
`
`
`of the 3‘ half erbB—2 ECD coding sequence was directed
`by the 5’ primer CGGACGTGGGATCCTGCACCCTCGT—
`CTGC and the 3' primer CCTGGTACCTTATGTTTCAG-
`GTTCAGGAGGAGGTGTGCCGGACGTCAGAGGGCT
`GGCTCTCTGCTCG.
`(Underlined nucleotides encode
`the KT3 epitope.) Products obtained after amplification
`were inserted between the Ncol and EcoRi sites of
`bacuiovirus
`transfer vector
`pAcC4
`(Luckow and
`Summers, 1988) to produce the transfer vector pAcNU2.
`Sequencing of the cloned PCR product revealed three
`alterations in coding sequence (F 173 to L, L 608 to P,
`i 613 to V) compared to the previously published
`sequence (Coussens etai., 1985). These three changes
`are likely to be artifacts of PCR amplification.
`8&2}???tététééétététététététéfim
`Expression 0f erbB-‘2 ECD I"
`"1390‘ cells.
`SV40 HWTIGEN
`Sequence encoding erbB-2 ECD was recombined into
`f
`the Autogragha caiifornica bacuiovirus (AcNPV) via the m KT3
`transfer vector pAcNU2. To generate recombinant virus,
`Epitope
`2 pg of transfer vector was co-transfected with 1 pg of
`wild type viral DNA into 819 cells as described Fl ure1. Constr cion
`(Summers and Smith, 1987).
`Recombinant virus
`dogmain of c-erbBElz (erbgjztgglgrned extracellular
`.
`(occlusion-negative) was isolated from the transfection
`supernatant by plaque purification (Smith et ai., 1983). To produce recombinant proteins, Sf9 cells were infected with
`5—10 PFU of recombinant virus per cell. Suspension cultures were grown in a stirred flask containing protein-free
`medium (Maioreiia et ai., 1988). The cells were infected at 1—1.5 x 10 cells per ml and were harvested at 48 hr post-
`infection. The expression level of recombinant protein was approximately 0.4 mg/i of Sf9 culture.
`Monoclonal antibodies. Murine monoclonal antibodies 106A10 (igG1), 113F1 (igGS), 454A12 (igG1), 454011
`(inga), 52009 (igG1) and 758G5 (igG1) resulted from immunizations with human breast carcinoma cell
`lines or
`membrane preparations, and were purified from mouse ascites as previously described (Frankel et ai., 1985). Murine
`hybridoma 3G8 ([901) (Unkeiess, 1979) was obtained from Dr. Jay Unkeiess and antibody was purified from mouse
`ascites by size exclusion and anion exchange chromatography. Murine hybridoma KT3 (igG1) (MoArthur and Walter,
`1984) was obtained from Gernot Walter and KT3 antibody was purified by anion exchange. MOPC21 and RP05
`myeioma proteins were obtained from Zymed Laboratories, South San Francisco, CA; horseradish peroxidase
`conjugates of monoclonal antibodies were also prepared by Zymed.
`immunoprecipitation of erbB-2 ECD by KT3 and 52009 monoclonal antibodies. KTS—Sepharose was prepared
`by absorbing KT3 monoclonal antibody (MacArthur and Walter, 1984) to protein-G Sepharose (5-8 mg KT3 per ml
`resin) and then cross-linking with dimethyi pimeiimidate (Schneider et ai., 1982). Supernatants from AcNU2 or control-
`infected Sf9 cells were concentrated 1 O—foid and diafiltered 10-foid into PBS using 30 kilodalton Centri~prep (Amicon)
`diafilters. They were then incubated with 8 pl KT8 Sepharose and 5 pg 52009 or MOPC-175 myeioma protein or no
`addition for 1 hr at room temperature and 1 hr at 4 °C. 8 pl protein-G Sepharose (Pharmacia) was added after the
`first hour. The Sepharose beads were washed 4 times with 1 ml 20 mM Tris pH 8, 150 mM Na0i, 0.5% NP40 and
`extracted with SDS PAGE sample buffer. Extracted, proteins were resolved by SDS poiyacryiamide (8%) gel
`electrophoresis and visualized by Coomassie blue staining.
`ELISA. A polyvinyl chloride microtiter plate was coated overnight with KT3 antibody at 10 ug/mi in 50 mM
`NaHCO3 pH 9.5. After three rinses in PBS, wells were incubated 1 hour in 50 ul PBS or SF9 cell supernatant
`containing recombinant c-erbB~2 or M-CSF protein. After another three rinses in blocking solution (10% heat
`inactivated fetal bovine serum, 2% normal mouse serum, 1% nonfat dry milk, 1% bovine serum albumin in PBS), wells
`were incubated 1 hour in 500i blocking solution containing antibody~peroxidase conjugates at 1 pg/mi. After fourflnal
`PBS rinses, wells were developed with tetramethyibenzidine substrate and absorbences were read at 450 nm as
`described (Sheldon et ai., 1986). All operations were conducted at room temperature.
`
`PCR
`AMPLIMER
`
`Sf9
`
`ACNU2
`srs
`ErbB-2 ECD
`
`l
`Results and Discussion
`cDNA encoding the extracellular domain of o-erbB-2 (erbB-2 ECD) was synthesized from tumor~derived mRNA
`by polymerase chain reaction (PCR; Muiiis & Faioona, 1987; Saiki et ai., 1985) and cloned into a bacuiovirus transfer
`vector (pAcC4; Luckow and Summers, 1988). At the 3’ end of this c-erbB-2 fragment, DNA encoding the late T
`antigen epitope (TPPPEPET or "Tag peptide") was added (Figure 1). This epitope is recognized by the monoclonal
`antibody KT3 (MacArthur and Walter, 1984).
`erbB-2 ECD was expressed in Sf9 insect cells using the AcNPV
`bacuiovirus expression system (Smith et ai., 1983; Summers and Smith, 1987; Luckow and Summers, 1988). A 90
`Kd protein was specifically immunoprecipitated by KT3 from supernatants from Sf9 cells infected with erbB-2 ECD
`encoding virus (AcNU2) but not from control-infected cells (Figure 2). The identity of this protein was confirmed by
`N-terminai sequence analysis.
`(Note that Figure 2 shows Coomassie blue staining of precipitating antibodies as well
`as immunoprecipitated antigens.)
`Figure 3 shows the reactivity of various antibody probes with erbB-2 ECD. Microtiter wells were coated with
`antibody KT3, and subsequently incubated with AcNU2 supernatant containing erbB-2 ECD or with a similar infected
`Sf9 supernatant containing recombinant M-CSF. Antibodies 45401 1, 52009 and 75865 recognize different antigenic
`determinants on BCA200 (Ring et ai., 1989) and MOPC21 and FiP05 are isotype-matched myeioma proteins without
`known binding specificities, memo and 113F1 respectively immunoprecipitate a 55,000 Mr giycoprotein and a
`40/60/100/200,000 Mrset ofgiycoproteins (D. Ring, unpublished data); 454A12 recognizes human transferrin receptor
`
`PHIGENIX
`
`Exhibit 1007-04
`
`

`

`Identity of BCA200 and o-erb B-Z
`
`917
`
`- KTO Ab
`alone
`
` Micro +
`M-CSF
`
`
`+
`l: KTa
`erbB—Z
`
`1.00
`
`’E‘
`
`c o
`
`0.00
`U)
`Vv 0.60
`0)
`
`92k
`
`66k
`
`31k 21k
`
`45k
`
`0.40
`
`1
`
`2
`
`a
`
`g
`(0
`.0
`0.20
`‘5
`(I)
`9 m
`10
`< 0.00
`'
`
`
`
`7
`e
`5
`4
`Antibody Probe
`
`e
`
`9
`
`Figure 3. ELISA assay of antibody binding to erbB-2
`ECD. Mlcrotiter wells were coated with KTS antibody
`alone or KT3 followed by AcNU2 supernatant or control
`Sf9 supernatant containing recombinant lVl—CSF. Wells
`were then incubated with buffer
`(1) or peroxidase
`conjugates of MOP021 (2), RPC5 (3), 454011 (4),
`52009 (5), 758G5 (6), 106A1O (7), 113F1 (8), 454A12
`(9) or 3GB (10), and probe binding was detected by a
`chromogenic reaction.
`
`lmmunoprecipltation of erbB-2 ECD by
`Figure 2.
`KT3 and 52009 monoclonal antibodies. (Coomassie
`blue staining of reduced SDS PAGE) Lanes 1 and 2,
`AcNU2 or control-infected Sf9 supernatants precipitated
`by KT3 Sepharose;
`lane 3, AcNU2 supernatant
`precipitated by protein G Sepharose; lane 4, AcNU2
`supernatant precipitated by antibody 52009 and protein
`G Sepharose; lane 5, control-infected Sf9 supernatant
`precipitated by 52009 and protein G Sepharose; lane 6,
`AcNU2 supernatant precipitated by MOPC175 myeloma
`protein and protein G Sepharose; lane 7, molecular -
`weight standards;
`lanes 8 and 9, 10 ul AcNU2
`supernatant or control-infected Sf9 supernatant.
`(Frankel et al., 1985; Bjorn et al., 1985); and 3G8 recognizes human FcY receptor lll (Unkeless, 1979). None of the
`antibodies reacted with the KTS capture antibody alone. Only antibodies to BCA200 reacted with wells that received
`erbB-2 ECD, and they did not react with wells that received supernatant of Sf9 cells infected with a different construct.
`Figure 2 further shows that antibody 52009 to BCA200, like antibody KT3, immunoprecipltated a band with the
`ECD from AcNU2 supernatant (lane 4). This band was not
`expected 90 kilodalton molecular weight for erbB-2
`observed when AcNU2 supernatant was precipitated with protein G Sepharose alone (lane 3), when MOPC175
`myelomaproteln was substituted for 52009 (lane 6), orwhen 52009 was allowed to lmmunoprecipitate control~lnfected
`instead of erbB—2 ECD (lane 5). Based on the ELISA and
`Sf9 supernatant containing recombinant y—interferon
`lmmunoprecipltation results, we now believe that BCA200 ls identical to c—erbB-2. This conclusion is supported by
`comparing the apparent molecular weight and cell line and tissue distribution of BCA200 with published data on c—
`d for 125l labeled BCA200 immunoprecipltated from SK—Br-3
`erbB-2. The molecular weight of 200,000 daltons reporte
`antly from the weights of 185,000 to 190,000 reported for
`cells (Ring et al., 1989) probably does not differ signific
`human c—erva2 immunoprecipltated in similar conditions (Kraus et al., 1987; van de Vijver et al., 1988). When
`BCA200 ls lmmunoprecipitated after endogenous labeling with 358 methionine, we observe an apparent weight closer
`to 180,000 or 190,000 daltons (D. Ring and J. Kassel, unpublished data). Furthermore, the cell surface location and
`apparently monomeric glycoprotein nature of BCA200 (Ring et al., 1989) are consistent with the known properties of
`c—erbB-2.
`Antibodies to BOA200 react strongly with SK—Br—S cells (Ring et al., 1989), and with BT4474 and MDA-MB-231 cells
`(D. Ring, 8. Hsieh-Ma and T. Shi, unpublished data). These cell lines have been reported to express relatively high
`amounts of c—erbB-2 (Kraus et al., 1987; Hynes et al., 1989; Cohen et al., 1989). When tested for binding to normal
`human tissues, BCA200 antibodies 454011 and 52009 reacted most strongly with mucinous glands of colon (Ring
`et al., 1989). Similar preferential reaction with mucosal epithelium of the gastrointestinal tract has been observed in
`immunohistochemioal staining studies of c—erbB-2 (Cohen et al., 1989; Natali et al., 1990).
`While antibodies to c-erbB-1 (human epithelial growth factor receptor) form active immunotoxins when conjugated
`to rlcin toxin A chain (Taetle et al., 1988; Masuai et al., 1989), similar results have not yet been reported for c-erbB-2.
`Given our conclusion that the glycoprotein we designated BCA200 is actually c—erbB-2, our previous studies on rlcin
`A chain conjugates of BCA200 antibodies (Bjorn et al., 1985; Ring et al., 1989) appear to be the first evidence that
`c-erbB—2 can also serve as an effeCtive immunotoxin target.
`
`.
`
`PHIGENIX
`
`Exhibit 1007-05
`
`