`
`
`
`BIOCHEMICAL AND BIOPHYSICAL
`
`
`Research Communications
`
`Volume 211, Number 3, June 26, 1995
`
`Copyright © 1995 by Acndmzir Press, Inc.
`
`ALL RIGHTS RESERVED
`
`.———.____.—_-wia—hv
`
`No part of this publication may be reproduced or transmitted in any form, or by any means, electronic
`or mechanical, including photocopy, recording, or any information storage and retrieval system, without
`permission in writing from the copyright owner.
`The appearance of the code at the bottom of the first page of an article in this journal indicates the
`copyright owner’s consent that copies of the article may be made for personal or internal use, or for the
`personal or internal use of specific clients. This consent is given on the condition, however, that the copier
`pay the stated per copy fee through the Copyright Clearance Center, Inc. (222 Rosewood Drive, Danvers,
`Massachusetts 01923), for copying beyond that permitted by Sections 107 or 108 of the US. Copyright
`Law. This consent does not extend to other kinds of copying, such as copying for general distribution, for
`advertising or promotional purposes, for creating new collective works, or for resale. Copy fees for pie-1995
`articles are as shown on the article title pages; if no fee code appears on the title page, the copy fee is the
`same as for current articles.
`
`0006A291X/95 $5.00
`
`MADE IN THE UNITED STATES OF AMERICA
`
`This journal is printed on acid-free paper.
`
`
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`(ISSN 0006291X)
`
`Published three times per month by Academic Press, Inc., (1277 Sea Harbor Drive, Orlando, FL 3-8874900
`
`1995: Volumes 2067217. Price: $1359.00 USA. and Canada; 51652.00 all other countries
`
`All prices include postage and handling
`
`Information concerning personal subscription rates may be obtained by writing to the Publishers. All correspondence
`and subscription orders should be addressed to the office of the Publishers at ()277 Sea Harbor Drive, Orlando, FL
`3288774900. Send notices ofchange of address to the office ot'the Publishers at least 6 to 8 weeks in advance. Please
`include both old and new addresses. POSTMASTER: Send change of address to [liar/Junior! and Biophysical Rt‘a't‘m‘f/J
`(Tum“limitations, 6277 Sea Harbor Drive, Orlando, FL 328874900.
`Second class postage paid at Orlando, FL, and at additional mailing offices.
`
`Copyright © 1995 by Academic Press, Inc,
`
`IMMUNOGEN 2069, pg. 1
`Phigenix v. Immunogen
`|PR2014-00676
`
`IMMUNOGEN 2069, pg. 1
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`
`
`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`Vol. 211, NO. 3, 1995
`June 26, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`Pages 792-803
`
`CONSTRUCTION OF A CHIMERIC ANTIBODY WITH THERAPEUTIC POTENTIAL
`FOR CANCERS WHICH OVEREXPRESS c—erbB-2
`
`Hsiao-Lai C. Liu‘, Debbie L. Parkes, Beatrice C. Langton, Jian-Al Xuan, Michael
`Longhi2, Susan S. Elliger, Lorrine A. Chao, Michael P. McGrogan, John W. Brandis3,
`and Laura K. Shawver2
`
`Department of Cell and Molecular Biology, Berlex Biosciences, Richmond, CA
`
`Received May 1. 1995
`
`
`
`SUMMARY: We describe the chimerization of a monoclonal antibody directed
`against the c—erbB-2 protein using a novel PCR method for cloning immunoglobulin
`variable region genes. We also describe the characterization of the chimera and show
`its potential use for treating cancers which overexpress the c-erbB—2 protein. The
`genomic DNA fragments of heavy and light chain variable genes were cloned by PCR
`using uniquely designed primers which allowed for isolation of genes containing
`functional promoters, signal and coding sequences. The chimeric genes were then
`constructed by linking variable regions of murine genes to human constant y‘I and K
`genes. Expression of the chimeric immunoglobulin genes resulted in production of
`properly assembled chimeric antibody with improved biological properties.
`Academic Press,
`Inc.
`
`
`The presence of cell surface tumor—associated antigens is a characteristic of
`many cancers. One such tumor-associated antigen, c—erbB-2, has been shown to be
`
`overexpressed in a variety of cancers including gastrointestinal, non—small cell lung,
`breast, and ovarian adenocarcinomas (1-7). Studies of the c-erbB-2 gene in human
`breast and ovarian cancers have found that amplification of the gene occured in 25 to
`30% of both types of tumors and the amplification is correlated with overexpression of
`the protein product. The gene amplification and overexpression are associated with
`poor clinical prognosis and shortened overall patient survival (5, 8, 9). These data
`strongly suggest that c-erbB-2 plays a role in the pathogenesis of certain types of
`human cancer.
`
`The use of murine monoclonal antibodies for human therapy is limited by im-
`mune responses in humans elicited by the mouse derived antibody molecule (842)-
`
`1to whom correspondence should be addressed.
`2present address: Sugen lnc., 515 Galveston Dr., Redwood City, CA 94063.
`3present address: Applied Biosystems, a Division of Perkin—Elmer Corp., 850
`Lincoln Center Dr., Foster City, CA 94404.
`
`()006-291X/95
`
`$5.00
`
`Copyright © 1995 by Academic Press, Inc.
`All rights ofreproduction in anyfnrm rz’sm'val.
`
`792
`
`IMMUNOGEN 2069’ pg_ 2
`Phigenix V. Immunogen
`|PR2014-00676
`
`
`
`IMMUNOGEN 2069, pg. 2
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`
`
`'Ir
`VOI- 21 1, No. 3, 1995
`
`I
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`Mouse/human chimeric antibodies have been constructed in an effort to minimize the
`immunogenicity of the immunoglobulin molecule while maintaining the binding speci-
`“city and affinity of the antibody (13-16).
`In many applications, chimeric antibodies
`have demonstrated improved effector function in complement-mediated tumor cell
`lysIS and in antibody—dependent cellular cytotoxicity assays as compared to the par—
`ental murine monoclonal antibody (17-20).
`In this work, we describe the construction
`of the chimeric antibody, BACh 250,
`in which the heavy and light chain variable re-
`gionS of an anti-c—erbB-2 mouse monoclonal antibody were cloned using uniquely
`designed PCR primers allowing for genomic cloning with intact promoter, signal and
`coding sequences. The engineered chimeric antibody was characterized and the
`binding Specificity and affinity of BACh 250 to c—erbB-2 antigen were determined. Most
`importantly, the chimeric antibody was shown to have biological properties which
`make it attractive as a therapeutic for tumors which overexpress the c-erbB-2 protein.
`
`MATERIALS AND METHODS
`
`Cells, vectors, probes and primers. Mouse myelomas P3x63-Ag8.653 (PBX)
`and SP2/O, and the human cell lines ARH-77 and SKOV—3 were obtained from Ameri—
`can Type Culture Collection (ATCC, Rockville, MD). SKBR-S cells and NlH3T3 trans-
`fectants expressing the human c-erbB—2 gene were kindly provided by Dr. S.
`Aaronson (NIH, Bethesda, MD). The development and characterization of TAb 250
`has been previously described (21). Plasmid vectors pSV2neo, thSVgpt, pBR322
`and pU019 were obtained from ATCC, and plBl 21 was obtained from lBl (New
`Haven, CT). The mouse heavy chain JH probe was a 1.0 Kb DNA fragment containing
`the Jl=|3 and JH4 regions, which was isolated from plasmid pJ3J4. The mouse light
`chain JK probe was a 1.8 Kb DNA fragment containing the LlK region, which was
`isolated from plasmid pJKHB.1. Both pJ3J4 and pJKHB.1 were generous gifts from Dr.
`J. Donald Capra (Southern Medical Center, University of Texas). The probes used to
`identify human constant heavy and light chain genes were oligonucleotides, designed
`from the coding sequences of both genes. By using the GCG sequence analysis
`software (22), three degenerative 5' primers and one specific 3' primer were designed
`for VH cloning. Six degenerative 5' primers and one specific 3' primer were designed
`for VK cloning. For both VH and VK amplification, the PCR primers were designed to
`amplify the variable regions,
`including their own promoters,
`leaders and variable
`region coding sequences. The VH gene fragment also contains its own enhancer
`sequence.
`Cloning of chimeric heavy and light chain genes. Two genomic DNA fragments,
`one containing TAb 250 heavy chain variable region (VH) and the other containing
`TAb 250 light chain kappa variable region (VK) were both amplified and cloned from
`hybridoma genomic DNA by PCR. Southern hybridizations with JH and JK probes
`were performed to verify that the PCR amplified fragments were immunoglobulin
`heavy and light chain variable regions. The PCR amplified TAb 250 VH and VK genes
`were subsequently cloned into plasmid vector pU019 and plBl21 respectively, and
`their nucleotide sequences were determined by sequencing both strands of the
`template DNA. The mouse light chain enhancer, which was not included in the cloned
`VK gene fragment, was cloned separately from TAb 250 genomic DNA by PCR.
`The human heavy chain «r1 constant region gene (CH) and the human light
`chain kappa region gene (CK) were cloned from the human lgG producing cell line
`ARH=77 using a similar PCR approach as described above. The PCR products were
`
`793
`
`IMMDNOQEN 2069, pg. 3
`Phlgenlx v. Immunogen
`|PR2014-00676
`
`IMMUNOGEN 2069, pg. 3
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`
`
`Vol. 211, N0. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`verified by Southern hybridization using oligonucleotide probes to Cy-I and CK coding
`regions. The
`amplified Cy—1 and CK gene fragments contained from sixty to two
`hundred base pairs of flanking intron sequences on the 5' and 3' ends.
`Gene transfect/on. Samples of 5 lg to 50 pg of linearized heavy and light chain
`plasmid DNA were cotransfected into 1x107 SP 2/0 cells and P3X cells by
`electroporation. Culture supernatants harvested from G418 resistant transfectants
`were screened for chimeric heavy chain and chimeric light chain expression by two-
`antibody sandwich ELISAs.
`Characterization of chimeric antibody by metabolic labeling and immuno-
`precipitation. An aliquot of 1x107 SP2/0 cells was metabolically labeled with 300 )LCI
`of Tran35S-label
`(ICN, specific activity = 1100 ci/mmole) and immunoprecipitation
`carried out essentially as described (23). Culture supernatants or cell lysates were
`incubated with 10 pg of goat anti-human kappa antibody (Sigma Chemical Co.)
`followed by 50 pl of protein A-Sepharose CL—4B (Pharmacia).
`Samples were
`analyzed on a 4-20% SDS polyacrylamide gradient gel under non-reducing condition
`or on a 12% SDS polyacrylamide gel under reducing conditions.
`Binding assays. The binding activity of chimeric antibody, BACh 250, was
`tested in both ELISA and competitive binding assays. The ELISA was performed in
`96—well microtiter plates coated with glutaraldehyde fixed c-erbB-2 transfected NIH
`3T3 cells at 1x104 cells per well and goat anti-human lgG (H+L)—horseradish
`peroxidase conjugate (Zymed Lab Inc.).
`In the competitive binding assay, BACh 250
`was tested for its ability to compete with 125l-TAb 250 in binding to c—erbB-2 protein on
`the surface of SKBR—3 cells as described (24).
`Biological characterization. The ability of BACh 250 to inhibit tumor cell growth
`in vitro was compared to the murine TAb 250 antibody using SKOV-S cells as descri-
`bed (23). For complement-mediated cytotoxicity, 51Cr—release assays were carried out
`using standard procedures (25). Rabbit complement (Cedarlane Labs, Ontario, CAN)
`was added to 51Cr-labeled SKBR-3 cells followed by either TAb or BACh 250. The
`mean cpm of duplicate wells was determined, and percent specific release was
`calculated using the following formula: (Experimental cpm from test well - spontaneous
`cpm from complement control wells/total cpm released from detergent wells —
`spontaneous cpm) x 100. Release from the control wells containing cells alone or
`cells plus antibody only, varied from 0-3%. The standard deviation of duplicates was
`less than 10%.
`
`For antibody-dependent cellular cytotoxicity assays, effector cells were obtained
`by separating human peripheral blood mononuclear cells from the leukophoresed
`blood of healthy donors (Stanford blood bank) by standard procedures. Effector cells
`were then resuspended with 51Cr-labeled SKBR-3 cells and ADCC determined (25)
`after 24 h. The mean cpm of duplicate wells was determined and percent specific
`release was calculated using the following formula:
`(Experimental cpm from test well -
`spontaneous cpm from target alone wells/total cpm released from detergent wells -
`spontaneous cpm) x 100. Release from control wells containing target cells plus
`antibody only did not differ from the release from wells which contained target cells
`alone. The standard deviation of duplicates was less than 10%.
`To examine the effects of BACh250 on in vivo tumor growth, SKOV-3 tumor
`cells were implanted and passaged in 4-6 wk old BAlb/c nu/nu mice as previously
`described (23).
`
`RESULTS
`
`Cloning and construction of chimeric Ab heavy and light chain genes. Both
`TAb 250 VH and VK genes were cloned from TAb 250 hybridoma genomic DNA by
`PCR. The amplified DNA fragment obtained from PCR using the heavy chain primers
`was ~2.0 Kb (Figure 1 ). This 2.0 Kb band was amplified by one of the three designed
`
`794
`
`IMMUNOGEN 2069, pg. 4
`Phigenix v. Immunogen
`|PR2014—00676
`
`’
`
`
`
`‘
`
`‘
`I
`
`‘
`J
`
`IMMUNOGEN 2069, pg. 4
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`
`
`Vol. 211, No. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`O X
`lo
`(‘0
`N D.
`
`O X O X
`L0
`(‘0
`l0 0')
`N (L
`N n.
`
`
`
`123
`
`4567
`
`Figure 1. TAb 250 VI.| gene cloned by PCR. Aliquots of the PCR reaction mix
`using primers designed to amplify the TAb 250 VH region were analyzed on a 0.8%
`agarose gel (lanes 1-3) and by a Southern blot (lanes 4-7). Lane 1, DNA markers (23,
`9.4, 6.5, 4.3, 2.3, 2.0, 1.0, 0.77, 0.6, 0.5 and 0.39 Kb); Lane 2, 4 and 6,
`the
`amplification from genomic DNA of TAb 250 hybridoma; Lane 3, 5 and 6,
`the
`amplification from genomic DNA of P3X cells. The amplified TAb 250 VH DNA band is
`indicated by an arrow. The difference between Lane 4, 5 and Lane 6, 7 is the amount
`of PCR reaction mix loaded.
`
`5'—GAGGAATTC(AC)TATAG-
`(5' primer:
`sets
`heavy chain PCR primer
`CAG(GA)A(AC)(GC)A(CT)ATGCAAAT-3'; 3' primer: 5'—GAGGAATTCGTCGACTAAA-
`TACATTTTAGAAGTCGAT-S'). The amplified DNA fragment obtained from VK PCR
`cloning was ~30 Kb (Figure 2), and was amplified by one of the six light chain PCR
`primer sets designed for VK cloning ( 5' primer: 5'-(AC)A(AT)TTACTTCCTTATTTG-
`(GA)TGACT(GA)—CTTTGCAT—3'; 3' primer: CATTAAGCTTTTAATATAACACTG—GATA-
`3'). These two PCR amplified fragments were verified to contain the immunoglobulin
`variable genes for heavy and light chains respectively by Southern hybridization
`analyses using probes from JH and JK regions (Figures 1 and 2).
`In addition, both PCR
`amplified VH DNA and VK DNA were amplified from TAb 250 hybridoma DNA, but not
`from the fusion partner P3X DNA,
`indicating the cloned VH and VK genes were
`rearranged specific for TAb 250. The nucleotide sequences of the cloned VH and VK
`genes were obtained from sequencing independent clones. The regions of the
`promoter, leader, coding region (V, D, and J) and enhancer of TAb 250 VH gene were
`all identified and mapped as shown in Figure 3A. A similar map for TAb 250 Vk gene
`is shown in Figure 3B. The light chain enhancer was cloned from TAb 250 genomic
`DNA in a separate PCR (data not shown). As indicated in Figure 3, the TAb 250 VH
`gene rearranged to .J4 and VK gene rearranged to J2. The amino acid sequences of VH
`and VK proteins obtained from direct NHz-terminal amino acid sequencing of purified
`
`795
`
`IMMUNOGEN 2069, pg. 5
`Phigenix v. Immunogen
`lPR2014-00676
`
`lr
`
`i
`
`IMMUNOGEN 2069, pg. 5
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, N0. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`250
`
`250
`
`P3X
`
`
`
`
`
`12
`
`34
`
`Figure 2. TAb 250 VK gene cloned by PCR. Aliquots of the PCR reaction mix
`using primers designed to amplify the TAb 250 VK region were analyzed on a 0.8%
`agarose gel (lanes 1-2) and by a Southern blot (3-4). Lane 1 and 3, the amplification
`from genomic DNA of TAb 250 hybridoma; Lane 2, DNA markers (see Figure 1); Lane
`4, the amplification from genomic DNA of P3X cells. The amplified TAb 250 VK DNA
`band is indicated by an arrow.
`
`TAb 250 antibody perfectly match with those predicted from the nucleotide sequences
`
`of the cloned TAb 250 VH and VK genes (data not shown). This evidence further
`
`confirmed the cloned TAb 250 VH and VK genes.
`
`Human 07.1 gene and human CK gene were also cloned individually by PCR
`
`from cell line ARH-77. Both amplified Cw and CK genomic DNA fragments were veria
`
`I)
`
`
`
`E
`\I/
`L
`V
`DJ-I
`
`’l‘:\l125(i\’ —()—i
`I—'———C:::IT
`
`
`IIIZ
`II
`II
`905
`in
`2x7
`11 SI
`3118
`
`A
`
`B
`
`
`
`
`I)
`
`
`\L
`L
`V
`J2
`I3
`J4
`IS
`
`i,
`3-
`T
`_l
`r
`I
`
`
`
`
`
`
`
`IAIIJIIM‘ —O
`17‘)
`H
`—I
`'—
`~12<iii—>
`’/
`()I
`39‘)
`34
`M)
`48
`“I
`
`Figure 3. Gene maps of cloned TAb 250 VH region and TAb 250 VK
`region. The functionally rearranged TAb 250 VH gene and VK gene were mapped
`according to their nucleotide sequence information. Exons are represented by boxes
`and introns are represented by lines. The enhancer sequence is indicated by the
`shaded box. P, promoter; L, leader exon; V(D)J, Variable (diversity) Joining region
`exons; E, enhancer. The number of nucleotides in each region is indicated by the
`numbers.
`
`796
`
`IMMUNOGEN 2069, pg. 6
`Phigenix v. Immunogen
`IPR2014-00676
`
`AF.—
`
`
`
`
`
`IMMUNOGEN 2069, pg. 6
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, No. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`A
`
`B
`
`Barn Hl
`
`Figure 4. Structures of chimeric heavy and light chain expression
`plasmids. The chimeric heavy chain expression plasmid, pSVNH (4A), and the
`chimeric light chain expression plasmid, pRGL (4B),were constructed as described in
`Materials and Methods. The assembled chimeric heavy and light chain genes are
`represented by the blocks, and the variable and constant regions in the gene are
`indicated. The gene for ampicillin resistance (Amth), the gene for G418 resistance
`(neo), and the xanthine-guanine phosphoribosyl transferase gene (gpt) are mapped in
`the plasmids. The orientation of genes in the plasmids is indicated by an arrow.
`
`tied by Southern hybridization (data not shown). The TAb 250 VH gene and human
`07-1 gene were combined and subcloned into vector pSV2—neo to construct the
`chimeric heavy chain expression plasmid pSVNH (Figure 4A). The TAb 250 VK gene,
`mouse enhancer and human CK gene were assembled and subcloned into vector
`pRSVgpt to construct the chimeric light chain expression plasmid pRGL (Figure 48).
`Expression of and characterization of chimeric antibody. The chimeric heavy
`and light expression plasmids were cotransfected into mouse myeloma cells and
`ELISA results indicated that positive clones produced both chimeric heavy chain and
`light chain at comparable levels. The molecular weight, assembly pattern and the
`secretion of BACh 250 were examined (Figure 5). The secreted BACh 250 chimeric
`antibodies were properly assembled indicated by a single band at a molecular weight
`of ~200 Kd present in the culture media. Only low levels of fully assembled antibody
`molecules accumulated inside the cells,
`indicating that
`the chimeric antibodies
`
`produced by the cells were properly secreted.
`The ability of chimeric antibody BACh 250 to bind c-erbB-2 antigen was
`demonstrated in an ELISA using c-erbB-2—transfected NIH3T3 cells. BACh 250 and
`TAb 250 were further compared in a competitive binding assay. As shown in Figure 6,
`BACh 250 competed with 125l—TAb 250 for binding to c—erbB—2 antigen on the surface
`of SKBR—S cells and 80% of 125l-TAb 250 bound was displaced by BACh 250 at a
`concentration of 10 ug/ml.
`TAb 250 competed 125l-TAb 250 at comparable
`concentrations. These results indicated that BACh 250 retains the same binding
`
`specificity and affinity as its parent hybridoma TAb 250.
`
`
`
`
`
`I
`
`g
`
`797
`
`IMMUNOGEN 2069. pg. 7
`Phigenix v. Immunogen
`|PR2014-00676
`
`IMMUNOGEN 2069, pg. 7
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, N0. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`‘
`
`A
`
`200 —
`
`200 _ a , - :-,--_ '"—‘
`Ba
`
`(— H2L2
`
`1
`
`2
`
`3
`
`4
`
`5
`
`6
`
`7
`
`8
`
`Figure 5. Analysis of chimeric antibody BACh 250. BACh 250 or TAb 250
`was metabolically labeled,
`immunoprecipitated and analyzed on a SDS polyacryl-
`amide gel under both reducing conditions (5A) and non-reducing conditions (SB).
`Lanes 1 and 5 represent parental hybridoma TAb 250; Lanes 2 and 6 represent BACh
`250 subclone-1; Lanes 3 and 7 represent BACh 250 subclone-2; Lanes 4 and 8
`represent recipient cell
`line P3X. Lanes 1-4 represent cytoplasmic antibody and
`Lanes 5-8 represent secreted antibody. Both BACh 250 subclones shown here were
`selected from P3X cell
`line. The protein molecular weight standards, heavy chain
`protein (H),
`light chain protein (L), and protein of assembled tetrameric molecules
`(H2L2) are indicated.
`
`Biological properties of chimeric antibody. The effect of BACh 250 on cell
`proliferation was demonstrated in a cell proliferation assay (Figure 7). SKOV-3 cells
`treated with 10 (Lg/ml of BACh 250 showed a growth inhibition of 20% on Day 2, and
`50% on Day 11 as compared to the control cells. Similar growth inhibition was
`observed in TAb 250 treated cells, suggesting the chimeric BACh 250 has the same
`antiproliferative effect on tumor cells expressing c-erbB-2 as the monoclonal TAb 250.
`
`To assess whether the chimeric antibody has improved effector function
`attributed to the human 71 constant region, TAb 250 and BACh 250 were compared in
`CDC and ADCC assays. (Figure 8). Figure 8A demonstrates specific lysis of SKBR—3
`
`
`
`
`I
`
`i
`
`I
`I
`
`,
`
`798
`
`IMMUNOGEN2069, pg.8
`
`Phigenix v. Immunogen
`|PR2014-00676
`
`J
`
`IMMUNOGEN 2069, pg. 8
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`r I
`
`Vol. 211, No. 3, 1995
`
`1| U -
`
`35
`
`25
`
`(/r
`Bound 20'
`
`'
`
`~O- TAb 250
`
`'I' BACh 250
`
`I
`
`I
`I
`
`I
`J
`I
`
`I
`‘
`
`I
`
`
`
`I
`.
`
`I
`,
`I
`
`1 5
`
`10
`5
`0
`
`_' 'm'"__
`
`0.00I
`
`_
`
`r V'_“>'~'" —_'1 _
`
`0.0I0
`
`0.100
`
`_'
`
`/’3
`M‘W‘ma
`1 _>__"—
`-
`-.'] _"
`'-'
`_~__'
`
`1.000
`
`IODOO
`
`
`
`-'
`
`I
`
`100.000
`
`Cold Ab (pg/ml)
`
`Figure 6. Binding affinity of chimeric antibody BACh 250. Competition of
`TAb 250 and BACh 250 with 125l—TAb 250 for binding to SKBR—S cells was determined
`as described in Materials and Methods. Each point was determined in triplicate and
`
`bars represent standard deviations.
`
`target cells after treatment with BACh 250 and rabbit complement at dilutions of 1:10
`and 1:20 for 1 h. TAb 250, a murine lgG1 antibody failed to mediate this lysis. This is
`consistent with previous reports that indicated murine lgG:1 antibodies are ineffective at
`
`i2fJ-—.
`
`92m
`Conlrnl
`
`I00—:]
`1
`80~—
`J
`
`60-—
`:1
`
`40——
`
`
`
`" ~< M .
`~— — h\:: :::;:;.
`
`l» TAb 250
`
`+ BACh 250
`
`20—-I
`J
`
`0'E‘I‘TT'TI
`l
`" “i
`I'” 1....._|
`"”'
`l' T
`“l
`'"'_l'
`I
`o
`i
`2
`:3
`4
`a
`6
`7
`a
`9
`IO
`Days
`
`250 on c-erbB-2-
`of BACh
`7. The antiproliferative effect
`Figure
`expressing tumor cells. The ability of BACh 250 to inhibit the growth of SKOV-S
`cells in vitro was determined using a cell proliferation assay. Closed circles represent
`inhibitory effects of chimeric BACh 250 while the closed squares represent the
`inhibitory effects of the parental TAb 250. Each point
`is the mean of triplicate
`determinations and bars represent the standard deviations.
`
`799
`
`IMMUNOGEN 2069, pg. 9
`Phigenix v. Immunogen
`|PR2014-00676
`
`IMMUNOGEN 2069, pg. 9
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, No. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`TAb 250
`
`I216“
`
`1:81)
`
`1:41)
`
`1:21)
`
`1:11)
`
`70
`
`60
`
`50
`
`40
`
`30
`
`20
`
`10
`
`0
`
`BACh 250
`
`-I- 3.12ug/ml
`+ 6.25 ttg/ml
`+ 1’) i ug/ml
`+ 25
`ug/ml
`
`I:161)
`
`1:80
`
`I140
`
`1:20
`
`l:I(I
`
`Complement Dilution
`
`Complement DIIUIIOI‘
`
`S (70-f-
`pCCl
`It:
`“Cr
`Rclcasc
`
`%
`Specific
`“Cr—
`Release
`
`7°
`60
`
`50
`
`40
`
`30
`
`20
`
`10
`
`O
`
`70
`
`60
`
`50
`
`40
`30
`
`20
`
`10
`
`0
`
`IgG1
`
`7°
`60
`
`50
`
`40
`30
`
`20
`
`10
`
`0
`
`TAb 250
`
`70
`
`BACh 250
`
`60
`
`50
`
`40
`30
`
`20
`
`0.8 ug/mI
`1—
`+ 1.6 tig/mi
`3.
`l
`
`1—
`10
`
`
`I
`|
`I“
`I
`‘l
`0
`I
`I
`I
`I
`
`1 ug/In
`
`I
`
`
`
`0:1
`625111251 25:1
`
`E/T Ratio
`
`50:1
`
`0:1
`
`E/T Ratio
`
`6.25:1 12.5:1
`
`25:1
`
`50:1
`
`0:1
`
`E/T Ratio
`
`6.25:112.5:1 25:1
`
`50:1
`
`figure 8. Ability of BACh 250 to mediate immune effector functions. For
`complement mediated cytotoxicity (A), TAb 250 or BACh 250 (filled square, 3.12 ug/ml,
`filled circle,6.25 ug/ml) was added to 51Cr-Iabeled SKBR-S cells In the presence of
`rabbit complement at the dilutions indicated. The cells were incubated at 37°C for 1 h
`and supernatants were harvested and counted in a gamma counter. For Antibody
`Dependent Cellular Cytotoxicity (B), human effector cells (PBMC) isolated by density
`gradient centrifugation were added to 51Cr-labeled SKBR—3 target cells at various
`effector to target (EzT) ratios in the presence of either an lgG1 isotype control, TAb 250
`or BACh 250 (filled square, 0.8 ug/ml; filled circle, 1.6 ug/ml; filled triangle, 3.1 ug/ml).
`Cells were coincubated for 24 h at 37°C, supernatants were harvested, counted in a
`gamma counter. Percent specific release was calculated as described in Materials
`and Methods.
`
`‘
`
`I
`
`I
`I
`
`‘
`
`I
`
`I
`I
`
`I
`
`I
`I
`
`I
`I
`
`I
`
`I
`
`'
`
`‘
`
`I
`I
`
`800
`
`IMMUNOGEN 2069.139. 10
`Phigenix v. Immunogen
`|PR2014—00676
`
`
`
`;
`I
`
`I
`i
`I_
`
`i
`
`
`
`IMMUNOGEN 2069, pg. 10
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, No. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`mediating complement-dependent lysis. The complement-mediated lysis effected by
`
`BACh 250 was specific to c-erbB-2- expressing cells as MDA—MB-468, a tumor cell line
`
`which does not express c—erbB-2, were not lysed (data not shown).
`
`in ADCC assays (Figure BB), BACh 250 mediated an antibody-dependent lysis
`compared to cells treated with either TAb 250 or an lgG1 isotype control antibody at
`
`E:T ratios of 12.5:1 to 50:1. TAb 250 mediated lysis of 8-22% of the cells at all of the
`
`concentrations tested. This lysis is not significantly greater than that of the control
`
`antibody except at one E:T ratio of 6.25:1.
`in contrast, target cell lysis achieved with
`BACh 250 in the presence of peripheral blood mononuclear cells at E:T ratios of 25-
`50:1 was approximately 40-60% which was significantly greater than that observed for
`TAb 250 at E:T ratios of 125—5021. The lysis mediated by BACh 250 in ADCC assay
`
`was specific, as MDA-MB-468 cells were not lysed (data not shown).
`TAb 250 has been previously shown to inhibit growth of SKOV-3 xenografts by
`20-30% and the inhibition increased to 80-95% when TAb 250 was used in
`
`In order to assess whether the chimera is also able to
`conjunction with Cisplatin (23).
`inhibit tumor growth, an in vivo experiment was performed to compare TAb 250 and
`BACh 250, either alone or in combination with Cisplatin (CDDP).
`in animals treated
`
`with TAb 250, BACh 250 or CDDP alone, tumor growth was inhibited 40-50% as
`
`In contrast to single agent treatment, a
`compared to lgG1 isotype control (Figure 9).
`marked tumor growth inhibition of 90% was seen in animals treated with a combina-
`tion of either TAb 250 and CDDP or BACh 250 and CDDP.
`In these groups, two out of
`
`eight animals in the TAb 250 + CDDP group and three out of eight animals in the
`BACh 250 + CDDP group showed no tumor growth at the end of the experiment.
`In
`comparison, all animals in the control group developed substantial tumor nodules.
`
`DISCUSSION
`
`Previous mouse/human chimeric antibody constructions have used either
`
`genomic gene fragments (20, 26-29) or c—DNA fragments (30—33). These procedures
`frequently involved preparation of DNA libraries and subsequent laborious screening.
`The polymerase chain reaction (PCR) technique has also been introduced to obtain
`CDNA and promoterless genomic DNA fragment of the antibody variable regions in
`chimeric antibody construction (30, 32,34).
`in both cases, transcription and regulatory
`elements have to be provided by expression vectors for gene expression. The pub-
`lished genomic PCR method has a prerequisite of identifying the exact sequence of 5‘
`untranslated regions and the rearranged J segments of heavy and light chains from
`each antibody, which involves a long and complicated procedure.
`In this work, we have demonstrated a PCR approach to rapidly clone the
`genomic sequences of immunoglobulin variable genes from genomic DNA of mouse
`hybridoma cells secreting the specific monoclonal antibody. The PCR primers were
`designed to include the upstream heavy and light gene promoter elements, signal
`
`sequencesand enhancers inthe samefragments asthevariablegenecoding regions
`
`IMMUNOGEN 2069, pg. 11
`Phigenix v. Immunogen
`|PR2014-00676
`
`801
`
`I
`
`‘
`I
`
`l
`'
`
`
`
`(
`(
`I
`
`I
`
`IMMUNOGEN 2069, pg. 11
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`Vol. 211, No. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`fir
`
`2000 _
`
`Tumor
`
`
`
`
`Volume
`(mm‘) 1500_
`
`IgG. (500 fig)
`CDDP (50 pg)
`T bzs
`00
`A
`.0(5
`pg)
`BACh 250(500l1g1)
`TAb 250 + CDDP
`
`l><>lfi+llll| BACh 250 + CDDP
`
`I
`
`
`
`
` II—FITIT—IIT—Il'l—l'll—l
`6 81012141618202224262830323436384042
`f
`I
`Day f
`
`O
`
`2
`
`4
`
`J
`
`‘,
`
`I I
`
`‘
`
`Figure 9. Effect of BACh 250 and CDDP on SKOV-3 tumor xenografts.
`Female BAlb/c nu/nu mice (n = 8 animals per group) were implanted subcutaneously
`with freshly processed SKOV-3 passaged tumors (as described in Materials and
`Methods). Treatments were administered lP on day 7, 14 and 21 after tumor implant
`and tumors were measured 2x/wk using vernier calipers. Volume was calculated as
`the product of L x W x H. Animals were treated with either an isotype control antibody
`lgG1 (filled square), TAb 250 (filled circle), BACh 250 (open square), CDDP (filled
`triangle), or the combination of TAb 250 + CDDP (open circle) or BACh 250 + CDDP
`(open triangle). Antibody was administered at 500 ug/dose and CDDP at 50 ug/dose.
`The curve for the group treated with the combination of lgG1 + CDDP is not shown as
`results were similar to the effects seen for group treated with CDDP alone.
`
`for later chimeric immunoglobulin gene expression. We have successfully amplified
`both VH and VK genes and shown that they were the rearranged heavy and light chain
`
`genes from TAb 250. The chimeric heavy chain and light chain proteins were
`
`synthesized, processed and properly assembled into tetrameric molecules in mouse
`
`myeloma cells, demonstrating that the upstream promoter region sequences amplified
`
`to promote efficient gene expression. The
`with our PCR primers are sufficient
`oligonucleotide PCR primers used for TAb 250 VH and VK cloning were designed to
`
`is
`it
`cover all available mouse immunoglobulin variable sequences. Therefore,
`reasonable to predict that these primers can be used in PCR cloning of variable region
`
`genomic genes for any mouse monoclonal antibody.
`
`The chimeric antibody, BACh 250, retained the same binding affinity to the c-
`
`erbB—2 antigen.
`
`It also exhibited comparable inhibitory effects on tumor cell growth
`
`comparable to the parental mouse monoclonal antibody, both in vivo and in vitro.
`
`In
`
`addition, the human Fc region of BACh 250 interacts more efficiently with human cells
`
`to mediate tumor destruction as shown by its enhanced ability to mediate complement=
`IMMUNOGEN 2069, pg. 12
`Phigenix v. Immunogen
`
`802
`
`|PR2014—00676
`
`
`
`IMMUNOGEN 2069, pg. 12
`Phigenix v. Immunogen
`IPR2014-00676
`
`

`

`'7
`
`
`
`
`
`VOI- 211, N0. 3, 1995
`
`BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
`
`dependent and cell-mediated cytotoxicity in vitro. Human constant region domains,
`which may reduce immunogenicity in humans, along with the demonstrated efficacy in
`
`an in vivo tumor model make BACh 250 attractive as a potential therapeutic candidate.
`
`REFERENCES
`
`mmflwwewwe
`
`4424wwep-
`
`_n. 1’;
`
`_L_A_L.
`
`\"cnm
`
`18.
`19.
`20.
`21.
`22.
`
`23.
`24.
`
`26.
`27.
`28.
`29.
`30.
`
`32.
`33.
`
`King, C.R., Kraus, M.H., and Aaronson, SA. (1985) Science 229: 974-76.
`Semba, K., Kamata, N., et al. (1987) Proc. Natl. Acad. Sci. 82: 6497-501.
`Kraus, M.H., Popescu, N.C., etal. (1987) J. EMBO 6: 605-10.
`van de Vijver, M., van de Bersselaar, et al. (1987) Mol. Cell Biol. 7: 2019-23.
`Slamon, D.J., Clark, G.M., etal. (1987) Science 235: 177-82.
`Yokota, T., Yamamoto, T., etal. (1988) Oncogene 2: 283—7.
`Natali, P. G., Nicotra, M.R., etal. (1990) Int. J. Cancer 45: 457—61.
`Meeker, T.C., Lowder, et al. (1985) Blood 65: 1349-63.
`Schroff, R.W., Foon, K.H., etal. (1985) Cancer Res. 45: 879-85.
`Shawler, D.L., Bartholomew, R.M., etal. (1985) J. Immunol. 135: 1530—35.
`Courtenay-Luck, N.S., Epenetos, A.A., et al. (1986) Cancer Res. 46: 6489—93.
`Miller, R.A., Lowder, etal. (1987) Natl. Cancer inst. Monogr. 3: 131—34.
`Morrison, S.L., Johnson, M.J., et al. (1984) Proc. Natl. Acad. Sci. USA 81:6851-
`55.
`Boulianne, G.L., Hozumi, N., and Shulman, J.J. (1984) Nature 312: 643—46.
`Neuberger, M., Williams, G., etal. (1985) Nature (London) 314: 268-70.
`Morrison, S. (1985) Science 229: 1202-07.
`Liu, A.Y., Robinson, HR, at al. (1987) Proc. Natl. Acad. Sci. USA 84: 3439-43.
`Liu, A.Y., Robinson, R.R.,