UNITED STATES PATENT AND TRADEMARK OFFICE
`
`UNITED STATES DEPARTMENT OF COMMERCE
`United States Patent and Trademark Office
`Address. COMMISSIONER FOR PATENTS
`PO Box 1450
`A1exaJidria,Vi.1gLnia 22313-1450
`WvWv.uspto.gov
`
`APPLICATION
`NUMBER
`
`FILING or
`371(c) DATE
`
`GRP ART
`UNIT
`
`F
`
`FEE REC'D
`
`12/637,905
`
`12/15/2009
`
`1632
`
`3240
`
`23906
`E I DU PONT DE NEMOURS AND COMPANY
`LEGAL mam aacoaos cam
`BARLEY MILL PLAZA 25/1122B
`4417 LANCASTER PIKE
`
`WILMINGTON, DE 19805
`
`ATTY.DOCKET.NO
`
`CIA165USCIP
`
`TOT CLA11\/IS IND CLAIMS
`
`11
`19
`CONFIRMATION NO. 4159
`
`FILING RECEIPT
`
`llllllllllllllllllllllIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIlllllllllllllllllllllll
`
`Date Mailed: 01/07/2010
`
`Receipt is acknowledged of this non-provisional patent application. The application will be taken up for examination
`in due course. Applicant will be notified as to the results of the examination. Any correspondence concerning the
`application must include the following identification information: the U.S. APPLICATION NUMBER, FILING DATE,
`NAME OF APPLICANT, and TITLE OF INVENTION. Fees transmitted by check or draft are subject to collection.
`Please verify the accuracy of the data presented on this receipt. If an error is noted on this Filing Receipt, please
`submit a written request for a Filing Receipt Correction. Please provide a copy of this Filing Receipt with the
`changes noted thereon. If you received a "Notice to File Missing Parts" for this application, please submit
`any corrections to this Filing Receipt with your reply to the Notice. When the USPTO processes the reply
`to the Notice, the USPTO will generate another Filing Receipt incorporating the requested corrections
`
`Applicant(s)
`
`Yougen Li, Lawrenceville, NJ;
`Der-lng Liao, Wilmington, DE;
`Mark J. Nelson, Newark, DE;
`Daniel P. Okeefe, Ridley Park, PA;
`Assignment For Published Patent Application
`E.
`I. DU PONT DE NEMOURS AND COMPANY, Wilmington, DE
`Power of Attorney: None
`
`Domestic Priority data as claimed by applicant
`This application is a CIP of 12/337,736 12/18/2008
`which claims benefit of 61/015,346 12/20/2007
`and claims benefit of 61/109,297 10/29/2008
`
`Foreign Applications
`
`If Required, Foreign Filing License Granted: 01/05/2010
`
`The country code and number of your priority application, to be used for filing abroad under the Paris Convention,
`is US 12/637,905
`
`Projected Publication Date: To Be Determined — pending completion of Missing Parts
`
`Non-Publication Request: No
`
`Early Publication Request: No
`
`page 1 of 3
`
`BUTAMAX 1025
`
`BUTAMAX 1025
`
`

`
`Title
`
`KETOL-ACID REDUCTOISOMERASEUSING NADH
`
`Preliminary Class
`
`435
`
`PROTECTING YOUR INVENTION OUTSIDE THE UNITED STATES
`
`Since the rights granted by a U.S. patent extend only throughout the territory of the United States and have no
`effect in a foreign country, an inventor who wishes patent protection in another country must apply for a patent
`in a specific country or in regional patent offices. Applicants may wish to consider the filing of an international
`application under the Patent Cooperation Treaty (PCT). An international (PCT) application generally has the same
`effect as a regular national patent application in each PCT-member country. The PCT process simplifies the filing
`of patent applications on the same invention in member countries, but does not result in a grant of "an international
`patent" and does not eliminate the need of applicants to file additional documents and fees in countries where patent
`protection is desired.
`
`Almost every country has its own patent law, and a person desiring a patent in a particular country must make an
`application for patent in that country in accordance with its particular laws. Since the laws of many countries differ
`in various respects from the patent law of the United States, applicants are advised to seek guidance from specific
`foreign countries to ensure that patent rights are not lost prematurely.
`
`Applicants also are advised that in the case of inventions made in the United States, the Director of the USPTO must
`issue a license before applicants can apply for a patent in a foreign country. The filing of a U.S. patent application
`serves as a request for a foreign filing license. The application's filing receipt contains further information and
`guidance as to the status of applicant's license for foreign filing.
`
`Applicants may wish to consult the USPTO booklet, "General Information Concerning Patents" (specifically, the
`section entitled "Treaties and Foreign Patents") for more information on timeframes and deadlines for filing foreign
`patent applications. The guide is available either by contacting the USPTO Contact Center at 800-786-9199, or it
`can be viewed on the USPTO website at http://www.uspto.gov/web/offices/pac/doc/general/index.html.
`
`For information on preventing theft of your intellectual property (patents, trademarks and copyrights), you may wish
`to consult the U.S. Government website, http://www.stopfakes.gov. Part of a Department of Commerce initiative,
`this website includes se|f—he|p "too|kits" giving innovators guidance on how to protect intellectual property in specific
`countries such as China, Korea and Mexico. For questions regarding patent enforcement issues, applicants may
`call the U.S. Government hotline at 1-866-999-HALT (1—866-999-4158).
`
`LICENSE FOR FOREIGN FILING UNDER
`
`Title 35, United States Code, Section 184
`
`Title 37, Code of Federal Regulations, 5.11 & 5.15
`
`GRANTED
`
`if the phrase "|F REQUIRED, FOREIGN FILING
`The applicant has been granted a license under 35 U.S.C. 184,
`LICENSE GRANTED" followed by a date appears on this form. Such licenses are issued in all applications where
`the conditions for issuance of a license have been met, regardless of whether or not a license may be required as
`page 2 of 3
`
`

`
`set forth in 37 CFR 5.15. The scope and limitations of this license are set forth in 37 CFR 5.15(a) unless an earlier
`license has been issued under 37 CFR 5.15(b). The license is subject to revocation upon written notification. The
`date indicated is the effective date of the license, unless an earlier license of similar scope has been granted under
`37 CFR 5.13 or 5.14.
`
`This license is to be retained by the licensee and may be used at any time on or after the effective date thereof unless
`it is revoked. This license is automatically transferred to any related applications(s) filed under 37 CFR 1.53(d). This
`license is not retroactive.
`
`The grant of a license does not in any way lessen the responsibility of a licensee for the security of the subject matter
`as imposed by any Government contract or the provisions of existing laws relating to espionage and the national
`security or the export of technical data. Licensees should apprise themselves of current regulations especially with
`respect to certain countries, of other agencies, particularly the Office of Defense Trade Controls, Department of
`State (with respect to Arms, Munitions and Implements of War (22 CFR 121-128)); the Bureau of Industry and
`Security, Department of Commerce (15 CFR parts 730-774); the Office of Foreign AssetsControI, Department of
`Treasury (31 CFR Parts 500+) and the Department of Energy.
`
`NOT GRANTED
`
`No license under 35 U.S.C. 184 has been granted at this time, if the phrase "IF REQUIRED, FOREIGN FILING
`LICENSE GRANTED" DOES NOT appear on this form. Applicant may still petition for a license under 37 CFR 5.12,
`if a license is desired before the expiration of 6 months from the filing date of the application. If 6 months has lapsed
`from the filing date of this application and the licensee has not received any indication of a secrecy order under 35
`U.S.C. 181, the licensee may foreign file the application pursuant to 37 CFR 5.15(b).
`
`page 3 of 3
`
`

`
`CL4165USC|P
`
`KETOL—AC|D REDUCTOISOMERASE USING NADH
`
`TITLE
`
`This application is a continuation—in—part of USSN 12/337736, filed
`
`12/18/2008 and claims the benefit of the U.S. Provisional Applications,
`
`61/015346, filed 12/20/2007, and 61/109297, filed 10/29/2008.
`
`FIELD OF THE INVENTION
`
`The invention relates to protein evolution. Specifically, ketol-acid
`
`reductoisomerase enzymes have been evolved to use the cofactor NADH
`
`instead of NADPH.
`
`BACKGROUND OF THE INVENTION
`
`Ketol—acid reductoisomerase enzymes are ubiquitous in nature and
`
`are involved in the production of valine and isoleucine, pathways that may
`
`affect the biological synthesis of isobutanol.
`
`Isobutanol is specifically
`
`produced from catabolism of L—vaIine as a by-product of yeast
`
`fermentation.
`
`It is a component of “fuse| oil” that forms as a result of
`
`incomplete metabolism of amino acids by yeasts. After the amine group of
`
`L—vaIine is harvested as a nitrogen source, the resulting O.-ketO acid is
`
`decarboxylated and reduced to isobutanol by enzymes of the Ehrlich
`
`pathway (Dickinson, et al., J. Biol. Chem., 273: 25752-25756, 1998).
`
`Addition of exogenous L-valine to the fermentation increases the
`
`yield of isobutanol, as described by Dickinson et al., supra, wherein it is
`
`reported that a yield of isobutanol of 3 g/L is obtained by providing L-valine
`
`at a concentration of 20 g/L in the fermentation.
`
`In addition, production of
`
`n-propanol, isobutanol and isoamylalcohol has been shown by calcium
`
`alginate immobilized cells of Zymomonas mobilis (Oaxaca, et al., Acta
`
`Biotechnol., 11: 523-532, 1991).
`
`An increase in the yield of C3-C5 alcohols from carbohydrates was
`
`shown when amino acids leucine, isoleucine, and/or valine were added to
`
`the growth medium as the nitrogen source (WO 2005040392).
`
`While methods described above indicate the potential of isobutanol
`
`production via biological means these methods are cost prohibitive for
`
`industrial scale isobutanol production. The biosynthesis of isobutanol
`
`directly from sugars would be economically viable and would represent an
`
`1
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`
`advance in the art. However, to date the only ketol-acid reductoisomerase
`
`(KARI) enzymes known are those that bind NADPH in its native form,
`
`reducing the energy efficiency of the pathway. A KARI that would bind
`
`NADH would be beneficial and enhance the productivity of the isobutanol
`
`biosynthetic pathway by capitalizing on the NADH produced by the
`
`existing glycolytic and other metabolic pathways in most commonly used
`
`microbial cells. The discovery of a KARI enzyme that can use NADH as a
`
`cofactor as opposed to NADPH would be an advance in the art.
`
`The evolution of enzymes having specificity for the NADH cofactor
`
`as opposed to NADPH is known for some enzymes and is commonly
`
`referred to as “cofactor switching”. See for example Eppink, et al. (J. Mol.
`
`Biol., 292: 87-96, 1999), describing the switching of the cofactor
`
`specificity of strictly NADPH-dependent p-Hydroxybenzoate hydroxylase
`
`(PHBH) from Pseudomonas fluorescens by site—directed mutagenesis; and
`
`Nakanishi, et al., (J. Biol. Chem., 272: 2218-2222, 1997), describing the
`
`use of site—directed mutagenesis on a mouse lung carbonyl reductase in
`
`which Thr-38 was replaced by Asp (T38D) resulting in an enzyme having a
`
`200-fold increase in the KM values for NADP(H) and a corresponding
`
`decrease of more than 7-fold in those for NAD(H). Co—factor switching has
`
`been applied to a variety of enzymes including monooxygenases,
`
`(Kamerbeek, et al., Eur. J, Biochem., 271: 2107-2116, 2004);
`
`dehydrogenases; Nishiyama, et al., J. Biol. Chem., 268: 4656-4660, 1993;
`
`Ferredoxin-NADP reductase, Martinez-Julvez, et al., Biophys. Chem.,115:
`
`219-224, 2005); and oxidoreductases (US2004/0248250).
`
`Rane et al., (Arch. Biochem. Biophys., 338: 83-89, 1997) discuss
`
`cofactor switching of a ketol acid reductoisomerase isolated from E. coli by
`
`targeting four residues in the enzyme for mutagenesis, (R68, K69, K75,
`
`and R76,); however the effectiveness of this method is in doubt.
`
`Although the above cited methods suggest that it is generally
`
`possible to switch the cofactor specificity between NADH and NADPH, the
`
`methods are enzyme specific and the outcomes unpredictable. The
`
`development of a ketol-acid reductoisomerase having a high specificity for
`
`NADH with decreased specificity for NADPH would greatly enhance this
`
`2
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`
`enzyme’s effectiveness in the isobutanol biosynthetic pathway and hence
`
`increase isobutanol production. However, no such KARI enzyme has
`
`been reported.
`
`SUMMARY OF THE INVENTION
`
`Applicants have solved the stated problem by identifying a number
`
`of mutant ketol-acid reductoisomerase enzymes that either have a
`
`preference for specificity for NADH as opposed to NADPH or use NADH
`
`exclusively in their reaction. The method involves mutagenesis of certain
`
`specific residues in the KARI enzyme to produce the co-factor switching.
`
`Accordingly the invention provides A mutant ketol-acid
`
`reductoisomerase enzyme comprising the amino acid sequence as set
`
`forth in SEQ ID NO: 29; a nucleic acid molecule encoding a mutant ketol—
`
`acid reductoisomerase enzyme having the amino acid sequence as set
`
`forth in SEQ ID NO:19; a mutant ketol-acid reductoisomerase enzyme as
`
`set for in SEQ ID NO:19; a mutant ketol-acid reductoisomerase enzyme
`
`having the amino acid sequence selected from the group consisting of
`
`SEQ ID NO: 24, 25, 26, 27, 28, 67, 68, 70, 75, 79, 80, 81 and 82; and a
`
`mutant ketol-acid reductoisomerase enzyme as set forth in SEQ ID NO:17
`
`comprising at least one mutation at a residue selected from the group
`
`consisting of 24, 33, 47, 50, 52, 53, 61, 80, 115, 156,165, and 170.
`
`In another embodiment the invention provides a method for the
`
`evolution of an NADPH binding ketol-acid reductoisomerase enzyme to an
`
`NADH using form comprising:
`
`a) providing a ketol-acid reductoisomerase enzyme which uses
`
`NADPH having a specific native amino acid sequence;
`
`b) identifying the cofactor switching residues in the enzyme of (a)
`
`based on the amino acid sequence of the Pseudomonas
`
`fluorescens ketol-acid reductoisomerase enzyme as set for the
`
`in SEQ ID NO:17 wherein the cofactor switching residues are at
`
`positions selected from the group consisting of: 24, 33, 47, 50,
`
`52,53, 61,80, 115, 156,165, and 170; and
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`
`c) creating mutations in at least one ofthe cofactor switching
`
`residues of (b) to create a mutant enzyme wherein said mutant
`
`enzyme binds NADH.
`
`In another embodiment the invention provides a method for the
`
`production of isobutanol comprising:
`
`a) providing a recombinant microbial host cell comprising the
`
`following genetic constructs:
`
`i)
`
`at least one genetic construct encoding an acetolactate
`
`synthase enzyme for the conversion of pyruvate to
`
`acetolactate;
`
`ii) at least one genetic construct encoding a ketol—acid
`
`reductoisomerase enzyme of either of Claims 1 or 6;
`
`iii) at least one genetic construct encoding an acetohydroxy
`
`acid dehydratase for the conversion of 2,3-
`
`dihydroxyisovalerate to oi-ketoisovalerate, (pathway step
`
`0);
`
`iv) at least one genetic construct encoding a branched—chain
`
`keto acid decarboxylase, of the conversion of ci-
`
`ketoisovalerate to isobutyraldehyde, (pathway step d);
`
`v) at least one genetic construct encoding a branched—chain
`
`alcohol dehydrogenase for the conversion of
`
`isobutyraldehyde to isobutanol (pathway step e); and
`
`b) growing the host cell of (a) under conditions where iso-butanol is
`
`produced.
`
`In another embodiment the invention provides a method for the
`
`evolution and identification of an NADPH binding ketol—acid
`
`reductoisomerase enzyme to an NADH using form comprising:
`
`a) providing a ketol—acid reductoisomerase enzyme which uses
`
`NADPH having a specific native amino acid sequence;
`
`b) identifying the amino acid residues in the native amino acid
`
`sequence whose side chains are in close proximity to the
`
`adenosyl 2'-phosphate of NADPH as mutagenesis targets;
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`
`c) creating a library of mutant ketol-acid reductoisomerase enzymes
`
`from the class I ketol-acid reductoisomerase enzyme of step (a),
`
`having at least one mutation in at least one of the mutagenesis
`
`target sites of step (b); and
`
`5
`
`d) screening the library of mutant ketol-acid reductoisomerase
`
`enzymes of step (c) to identify NADH binding mutant of ketol-
`
`acid reductoisomerase enzyme.
`
`Alternatively the invention provides a method for evolution of an
`
`NADPH specific ketol-acid reductoisomerase enzyme to an NADH using
`
`10
`
`form comprising:
`
`a) providing a mutant enzyme having an amino acid sequence
`
`selected from the group consisting of SEQ ID NOs: 28, 67, 68, 69,
`
`70, and 84;
`
`b) constructing a site-saturation library targeting amino acid
`
`15
`
`positions 47, 50, 52 and 53 of the mutant enzyme of (a); and
`
`c) screening the site-saturation library of (b) to identify mutants
`
`which accept NADH instead of NADPH as cofactor.
`
`Similarly the invention provides a method for evolution of an
`
`NADPH specific ketol-acid reductoisomerase enzyme to an NADH using
`
`20
`
`form comprising:
`
`a) providing a DNA fragment encoding a mutant enzyme
`
`having an amino acid sequence selected from the group
`
`consisting of SEQ ID NOs: 85, 86, 87, 88, 89, 90, 91, 92, 93,
`
`94, 95, 96, 97, and 98 containing mutations in cofactor
`
`25
`
`specificity domain;
`
`b) producing a DNA fragment cofactor specificity domain of
`
`(8);
`
`c) providing a DNA fragment encoding a mutant enzyme
`
`having mutations in cofactor binding affinity domain selected
`
`30
`
`from the group consisting of SEQ ID NOs: 28, 67, 68, 69, 70,
`
`84 and 86;
`
`d) incorporating mutations of step (b) into mutants of step
`
`(c); and
`
`

`
`e) screening mutants of step (d) for mutant enzymes having
`
`a ratio of NADH/NADPH utilization is greater than one.
`
`BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE
`
`DESCRIPTIONS
`
`The invention can be more fully understood from the following
`
`detailed description, the Figures, and the accompanying sequence
`
`descriptions, which form part of this application.
`
`Figures 1A and 1B — Show four different isobutanol biosynthetic
`
`pathways. The steps labeled “a”,
`
`“e”, “f’,
`
`and “k”
`
`represent the substrate to product conversions described below.
`
`Figures 2A and 2B - Multiple sequence alignment (MSA) of KARI
`
`enzymes from different recourses; Figure 2A - MSA among three
`
`NADPH-requiring KARI enzymes; Figure 2B - MSA among PF5-KARI and
`
`other KARI enzymes, with promiscuous nucleotide specificity, where,
`
`MMC5 — is from Methanococcus maripaludis C5; MMS2 - is from
`
`Methanococcus maripaludis S2; MNSB — is from Methanococcus vanniellii
`
`SB; ilv5 — is from Saccharomyces cerevisiae ilv5; KARI —D1 — is from
`
`Sulfolobus solfataricus P2 ilvC; KARI—D2 — is from Pyrobaculum
`
`aerophilum P2iIvC; and KARI S1 — is from Ralstonia solanacearum
`
`GMI1 O00 ivIC.
`
`Figure 3 - Interaction of phosphate binding loop with NADPH based
`
`on homology modeling.
`
`Figure 4 - KARI activities of top performers from library C using
`
`cofactor NADH versus NADPH. Activity and standard deviation were
`
`derived from triple experiments. The mutation information is as follows:
`
`C3A7 = R47Y/S50A/T52D/V53W; C3A10 = R47Y/S50A/T52GN53W;
`
`C3B11 = R47F/S50A/T52DN53W; C3C8 = R47G/S50M/T52DN53W; and
`
`10
`
`15
`
`20
`
`25
`
`30
`
`C4D12 = R47C/S5OMT52DN53W
`
`Figures 5A and 5B — Figure 5A — Comparison of KARI activities of
`
`top performers from libraries E, F and G using cofactors NADH and
`
`NADPH. Figure 5B - KARI activities of positive control versus wild type
`
`6
`
`

`
`Pf5—ilvC using cofactors NADH. Activity and standard deviation were
`
`derived from at least three parallel experiments. “Wt” represents the wild
`
`type of Pf5—ilvC and “Neg” means negative control. Experiments for NADH
`
`and NADPH reactions in Figure 5A were 30 min; in Figure 5B were 10
`
`min.
`
`Figure 6 - Activities of top performers from library H using cofactors
`
`NADH versus NADPH. Activity and standard deviation were derived from
`
`triple experiments. Mutation information is as follows: 24F9 =
`
`R47P/S50G/T52D; 68F10 = R47P/T528; 83G10 = R47P/S50D/T528;
`
`10
`
`39G4 = R47P/S50G/T52D; 91A9 = R47P/S50CT52D; and C3B11 =
`
`R47F/S50A/T52DN53W and Wt is wild type.
`
`Figure 7 - Thermostability of wild type PF5—ilvC. The remaining
`
`activity of the enzyme after heating at certain temperatures for 10 min was
`
`the average number of triple experiments and normalized to the activity
`
`15
`
`measured at room temperature.
`
`Figure 8 - Multiple DNA sequence alignment among 5 naturally
`
`existing KARI molecules. The positions both bolded and boxed were
`
`identified by error prone PCR and the positions only boxed were targeted
`
`for mutagenesis.
`
`Figures 9A through 9k — Alignment of the twenty—four functionally
`
`verified KARI sequences. The GxGXX(G/A) motif involved in the binding of
`
`NAD(P)H is indicated below the alignment.
`
`Figures 10A and 10B - An example of the alignment of
`
`Pseudomonas fluorescens Pf—5 KARI to the profile HMM of KARI.
`
`The eleven positions that are responsible for co—factor switching are
`
`boxed.
`
`Figure 11 - (A) is a linear depiction of the KARI amino acid
`
`sequence with specific amino acids numbered. The cofactor
`
`specificity domain residues are shown in shaded rectangles. The
`
`cofactor binding domain is shown in dotted ovals. (Table A) shows
`
`changed amino acids, using single letter code, at numbered
`
`positions in four KARI mutants.
`
`20
`
`25
`
`30
`
`

`
`Figure 12 (A) is a linear depiction of the KARI amino acid sequence
`
`with specific amino acids numbered. The cofactor specificity domain
`
`residues are shown in shaded rectangles.
`
`(B) Depicts the first PCR step
`
`amplifying the mutated cofactor specificity domain residues. (C) is a linear
`
`depiction of the KARI amino acid sequence with specific amino acids of
`
`the cofactor binding domain shown in dotted ovals. (D) Depicts
`
`incorporation of the domain swapping library into the mutants containing
`
`KM improving mutations. Table (E) summaries the KM values for NADH for
`
`mutations resulting from combining mutations in the cofactor binding
`
`affinity domain with mutations in the cofactor specificity determining
`
`domain.
`
`Table 9 - is a table of the Profile HMM of the KARI enzymes
`
`described in Example 3. The eleven positions in the profile HMM
`
`representing the columns in the alignment which correspond to the eleven
`
`cofactor switching positions in Pseudomonas fluorescens Pf—5 KARI are
`
`identified as positions 24, 33, 47, 50, 52, 53, 61, 80, 115, 156, and 170.
`
`The lines corresponding to these positions in the model file are highlighted
`
`in yellow. Table 9 is submitted herewith electronically and is incorporated
`
`herein by reference.
`
`The following sequences conform with 37 C.F.R. 1.821—1.825
`
`(“Requirements for Patent Applications Containing Nucleotide Sequences
`
`and/or Amino Acid Sequence Disclosures — the Sequence Rules”) and are
`
`consistent with the World Intellectual Property Organization (WIPO)
`
`Standard ST.25 (1998) and the sequence listing requirements of the EPO
`
`and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the
`
`Administrative Instructions). The symbols and format used for nucleotide
`
`and amino acid sequence data comply with the rules set forth in
`
`37 C.F.R. §1.822.
`
`TABLE 1
`
`Oligonucleotide Primers Used In This Invention
`
`10
`
`15
`
`20
`
`25
`
`30
`
`SEQUENCE ID
`
`SEQUENCE
`
`Description
`
`Reverse Primer for
`
`No.
`
`1
`
`TGATGAACATCTTCGCGTATTCGCCGTCCT
`
`

`
`2
`
`3
`
`4
`
`5
`
`7
`
`20
`
`21
`
`pBAD vector
`
`GCGTAGACGTGACTGTTGGCCTGNNTAAAGGCNN
`
`Forward primer
`
`GGCTNNCTGGGCCAAGGCT GAAGCCCACGGCTTG library C
`
`GCGTAGACGTGACTGTTGGCCTGNNTAAAGGCTCG |ibraryE
`
`GCTACCGTTGCCAAGGCTGAAGCCCACGGCTTG
`
`GCGTAGACGTGACTGTTGGCCTGCGTAAAGGCNNT Forward primerfor
`GCTACCGTTGCCAAGGCTGAAGCCCACGGCTTG
`
`Forward primerfor
`
`GCGTAGACGTGACTGTTGGCCTGCGTAAAGGCTCG Forward primer for
`
`GCTNNTGTTGCCAAGGCTGAAGCCCACGGCTTG
`
`library G
`
`GCGTAGACGTGACTGTTGGCCTGNNTAAAGGCNNT
`
`Forward primer for
`
`GCTNNTGTTGCCAAGGCTGAAGCCCACGGCTTG
`
`library H
`
`AAGATTAGCGGATCCTACCT
`
`AACAGCCAAGCTTTTAGTTC
`
`Sequencing primer
`
`(forward)
`
`Sequencing primer
`
`(reverse)
`
`CTCTCTACTGTTTCTCCATACCCG
`
`pBAD_266-O21308f
`
`CAAGCCGTGGGCTTCAGCCTTGGCKNN
`
`PF5_53MtO22908r
`
`CGGTTTCAGTCTCGTCCTTGAAG
`
`pBAD_866-021308
`
`GCTCAAGCANNKAACCTGAAGG
`
`pBAD-405-
`
`CCTTCAGGTTKNNTGCTTGAGC
`
`pBAD-427-—
`
`GTAGACGTG NNKGTTGGCCTG
`
`pBAD-435-
`
`-—
`
`CAGGCCAACKNNCACGTCTAC
`
`pBAD-456-
`
`52
`
`53
`
`54
`
`55
`
`56
`
`57
`
`CTGAAGCCN NKGGCNN KAAAGTGAC
`
`pBAD-484-
`
`H59L61_O90808f
`
`GTCACTTTKNNGCCKNNGGCTTCAG
`
`pBAD-509-
`
`GCAGCCGTTNNKGGTGCCGACT
`
`AGTCGGCACC KN NAACGG CTGC
`
`CATGATCCTGNNKCCGGACGAG
`
`H59L61_090808r
`
`pBAD-519-
`
`A71_090808f
`
`pBAD-541-
`
`A71_O9O 808r
`
`pBAD-545-
`
`T80_O90808f
`
`

`
`58
`
`59
`
`60
`
`61
`
`62
`
`71
`
`72
`
`CTCGTCCGG KN NCAGGATCATG
`
`CAAGAAGGGCNN KACTCTGGCCT
`
`AGGCCAGAGTKNNGCCCTTCTTG
`
`GTTGTGCCTNNKGCCGACCTCG
`
`CGAGGTCGGCKNNAGGCACAAC
`
`pBAD-567-
`
`T80_O90808r
`
`pBAD-608-
`
`A101_O90808f
`
`pBAD-631-
`
`A101_O90808r
`
`pBAD-663-
`
`R119_O90808f
`
`pBAD-685-
`
`R119_O90808r
`
`GTAGACGTGACTGTTGGCCTGNNKAAAGGCNNKGC PF5_4Mt111008.f
`
`TNNKNNKGCCAAGGCTGAAGCCCACGG
`
`CCGTGGGCTTCAGCCTTGGCKNNKNNAGCKNNGC
`CTTTKN NCAGGCCAACAGTCACGTCTAC
`
`PF5_4Mt111008.r
`
`AAGATTAGCGGATCCTACCT
`
`pBAD_230.f
`
`GAGTGGCGCCCTTCTTGATGTTCG
`
`pBAD_601_O21308r
`
`Additional sequences used in the application are listed below. The
`
`abbreviated gene names in bracket are used in this disclosure.
`
`SEQ ID NO: 9 - Methanococcus maripaludis C5-ilvC (MMC5) - GenBank
`
`Accession Number NC_009135.1 Region: 901034..902026
`
`SEQ ID NO: 10 is the Methanococcus maripaludis S2-ilvC (MMS2) —
`
`GenBank Accession Number NC_005791.1 Region: 645729..646721
`
`SEQ ID NO: 1 1
`
`is the Methanococcus vannielii SB—ilv5 (MVSB) — GenBank
`
`10
`
`15
`
`Accession Number NZ_AAWX01000OO2.1 Region: 302214..303206
`
`SEQ ID NO: 12 is the Saccharomyces cerevisiae iIv5 (iIv5) - GenBank
`
`Accession Number NC_001144.4 Region: 838065..839252
`
`SEQ ID NO: 13 is the Sulfolobus solfataricus P2 ilvC (KARI-D1) -
`
`GenBank Accession Number NC_O02754.1 Region: 506253..507260
`
`SEQ ID NO: 14 is the Pyrobaculum aerophilum str. IM2 iIvC (KARI-D2) -
`
`GenBank Accession Number NC_003364.1 Region: 1976281 ..1977267
`
`SEQ ID NO: 15 is the Ralstonia solanacearum GMl1000 ilvC (KARI—S1) —
`
`GenBank Accession Number NC_003295.1 Region: 2248264..2249280
`
`SEQ ID NO: 16 is the Pseudomonas aeruginosa PAO1 ilvC — GenBank
`
`Accession Number NC_OO2516 Region: 5272455..5273471
`
`10
`
`

`
`SEQ ID NO: 17 is the Pseudomonas fluorescens PF5 ilvC — GenBank
`
`Accession Number NC_004129 Region: 6017379..6018395
`
`SEQ ID NO: 18 is the Spinacia oleracea ilvC (Spinach—KARI) — GenBank
`
`Accession Number NC_002516 Region: 1..2050.
`
`SEQ ID NO: 19 is the amino acid sequence of the mutant (Y24F/R47Y/
`
`S50A/T52DN53A/L61 F/ G170A) of the ilvC native protein of
`
`Pseudomonas fluorescens.
`
`SEQ ID NO: 23 is the DNA SEQ of the the mutant (Y24F/R47Y/S50A/
`
`T52DN53A/L61F/ G170A) of the ilvC native protein of Pseudomonas
`
`10
`
`fluorescens.
`
`SEQ ID NO: 24 is the amino acid SEQ of the mutant ZB1
`
`(Y24 F/ R47Y/S50A/T52 D/V53A/ L61 F/A156V)
`
`SEQ ID NO: 25 is the amino acid SEQ of the mutant ZF3
`
`(Y24F/C33L/R47Y/S50A/T52D/V53A/L61 F)
`
`15
`
`SEQ ID NO: 26 is the amino acid SEQ of the mutant ZF2
`
`(Y24F/C33L/R47Y/S50A/T52DN53A/L61 F/A156V)
`
`SEQ ID NO: 27 is the amino acid SEQ of the mutant ZB3
`
`(Y24F/C33L/R47Y/S50A/T52DN53A/L61 F/G170A)
`
`SEQ ID NO: 28 is the amino acid SEQ of the mutant Z4B8
`
`(C33L/ R47Y/S50A/T52 D/V53A/ L61 F/T80I/A156V/G170A)
`
`SEQ ID NO: 29 is a consensus amino acid sequence comprising all
`
`experimentally verified KARI point mutations as based on SEQ ID NO:17.
`
`SEQ ID NO: 30 is the amino acid sequence for KARI from Natronomonas
`
`pharaonis DSM 2160
`
`SEQ ID NO: 31 is the amino acid sequence for KARI from Bacillus subtilis
`
`subsp. subtilis str. 168
`
`SEQ ID NO: 32 is the amino acid sequence for KARI from
`
`Corynebacterium glutamicum ATCC13032
`
`20
`
`25
`
`SEQ ID NO: 33 is the amino acid sequence for KARI from Phaeospirilum
`
`30
`
`molischianum
`
`SEQ ID NO: 34 is the amino acid sequence for KARI from Zymomonas
`
`mobilis subsp. mobilis ZM4
`
`11
`
`

`
`SEQ ID NO: 35 is the amino acid sequence for KARI Alkalilimnicola
`
`ehrlichei MLHE—1
`
`SEQ ID NO: 36 is the amino acid sequence for KARI from Campylobacter
`
`/ari RM21OO
`
`SEQ ID NO: 37 is the amino acid sequence for KARI from Marinobacter
`
`aquaeolei VT8
`
`SEQ ID NO: 38 is the amino acid sequence for KARI Psychrobacter
`
`arcticus 273-4
`
`SEQ ID NO: 39 is the amino acid sequence for KARI from Hahella
`
`10
`
`chejuensis KCTC2396
`
`SEQ ID NO: 40 is the amino acid sequence for KARI from Thiobacillus
`
`denitrificans ATCC25259
`
`SEQ ID NO: 41 is the amino acid sequence for KARI from Azotobacter
`
`vinelandii AVOP
`
`15
`
`SEQ ID NO: 42 is the amino acid sequence for KARI from Pseudomonas
`
`syringae pv. syringae B728a
`
`SEQ ID NO: 43 is the amino acid sequence for KARI from Pseudomonas
`
`syringae pv. tomato str. DC3000
`
`SEQ ID NO: 44 is the amino acid sequence for KARI from Pseudomonas
`
`20
`
`putida KT2440
`
`SEQ ID NO: 45 is the amino acid sequence for KARI from Pseudomonas
`
`entomophila L48
`
`SEQ ID NO: 46 is the amino acid sequence for KARI from Pseudomonas
`
`mendocina ymp
`
`25
`
`SEQ ID NO: 47 is the amino acid sequence for KARI from Bacillus cereus
`
`ATCC10987 NP_977840.1
`
`SEQ ID NO: 48 is the amino acid sequence for KARI from Bacillus cereus
`
`ATCC10987 NP_978252.1
`
`SEQ ID NO: 63 is the amino acid sequence for KARI from Escherichia coli
`
`30
`
`— GenBank Accession Number PO5793
`
`SEQ ID NO: 64 is the amino acid sequence for KARI from Marine Gamma
`
`Proteobacterium HTCC2207 — Gen Bank Accession Number
`
`ZP_01224863.1
`
`12
`
`

`
`SEQ ID NO: 65 is the amino acid sequence for KARI from
`
`Desulfuromonas acetoxidans — Gen Bank Accession Number
`
`ZP_01313517.1
`
`SEQ ID NO: 66 is the amino acid sequence for KARI from Pisum sativum
`
`(Pea) — GenBank Accession Number O82043
`
`SEQ ID NO: 67 is the amino acid sequence for mutant 3361 G8
`
`(C33L/R47Y/S50A/T52D/V53A/L61 F/T8OI)
`
`SEQ ID NO: 68 is the amino acid sequence for mutant 2H10
`
`(Y24F/C33L/R47Y/S50A/T52DN53I/L61 F/T80I/A156V)
`
`SEQ ID NO: 69 is the amino acid sequence for mutant 1D2
`
`(Y24 F/ R47Y/S50A/T52 D/V53A/L61 F/T80I/A156V.
`
`SEQ ID NO: 70 is the amino acid sequence for mutant 3F12
`
`(Y24F/C33L/R47Y/S5OA/T52DN53A/L61 F/T80|/ A156V).
`
`SEQ ID NO: 75 is the amino acid sequence for mutant JB1C6
`
`(Y24 F/C33 L/R47H/S50D/T52Y/V53Y/ L61 F/T80I/A1 56V)
`
`SEQ ID NO: 76 is the amino acid sequence for mutant 16445E4
`
`(C33L/R47P/S50V/T52 DN53G/L61 F/T80I/A156V)
`
`SEQ ID NO: 77 is the amino acid sequence for mutant 16468D7
`
`(Y24F/C33L/R47T/S50I/T52 DN53R/L61 F/T80I/A1 56V)
`
`SEQ ID NO: 78 is the amino acid sequence for mutant 16469F3
`
`(C33L/R47E/S5OA/T52D/V53A/L61 F/T8OI)
`
`SEQ ID NO: 79 is the amino acid sequence for mutant JEA1
`
`(Y24F/C33L/R47P/S5OF/T52D/L61 F/T80I/A156V)
`
`SEQ ID NO: 80 is the amino acid sequence for mutant JEG2
`
`(Y24F/C33L/R47F/S50A/T52DN53A/L61 F/T80I/A156V)
`
`SEQ ID NO: 81 is the amino acid sequence for mutant JEG4
`
`(Y24F/C33L/R47N/S50N/T52D/V53A/L61F/T80|/A156V)
`
`SEQ ID NO: 82 is the amino acid sequence for mutant JEA7
`
`(Y24F/C33L/R47P/S5ON/T52D/V53A/L61F/T80|/A156V)
`
`SEQ ID NO: 83 is the amino acid sequence for mutant JED1
`
`(C33 L/R47N/S50N/T52 D/V53A/L61 F/T80I/A1 56V)
`
`SEQ ID NO: 84 is the amino acid sequence for mutant 3361 E1
`
`SEQ ID NO: 85 is the amino acid sequence for mutant C2F6
`
`13
`
`10
`
`15
`
`20
`
`25
`
`30
`
`

`
`SEQ ID NO: 86 is the amino acid sequence for mutant C3B11
`
`SEQ ID NO: 87 is the amino acid sequence for mutant C4D12
`
`SEQ ID NO: 88 is the amino acid sequence for mutant SE1
`
`SEQ ID NO: 89 is the amino acid sequence for mutant SE2
`
`SEQ ID NO: 90 is the amino acid sequence for mutant SB3
`
`SEQ ID NO: 91 is the amino acid sequence for mutant SD3
`
`SEQ ID NO: 92 is the amino acid sequence for mutant 9650E5
`
`SEQ ID NO: 93 is the amino acid sequence for mutant 9667A11
`
`SEQ ID NO: 94 is the amino acid sequence for mutant 9862B9
`
`SEQ ID NO: 95 is the amino acid sequence for mutant 9875B9
`
`SEQ ID NO: 96 is the amino acid sequence for mutant 11461 D8
`
`SEQ ID NO: 97 is the amino acid sequence for mutant 11463
`
`SEQ ID NO: 98 is the amino acid sequence for mutant 11518B4
`
`DETAILED DESCRIPTION OF THE INVENTION
`
`The present invention relates to the generation of mutated KARI
`
`enzymes to use NADH as opposed to NADPH. Such co-factor switched
`
`enzymes function more effectively in microbial systems designed to
`
`produce isobutanol. Isobutanol is an important industrial commodity
`
`chemical with a variety of applications, where its potential as a fuel or fuel
`
`additive is particularly significant. Although only a four—carbon alcohol,
`
`butanol has the energy content similar to that of gasoline and can be
`
`blended with any fossil fuel.
`
`Isobutanol is favored as a fuel or fuel additive
`
`as it yields only CO2 and little or no SOX or NOX when burned in the
`
`standard internal combustion engine. Additionally butanol is less corrosive
`
`than ethanol, the most preferred fuel additive to date.
`
`The following definitions and abbreviations are to be use for the
`
`interpretation of the claims and the specification.
`
`The term “invention” or “present invention” as used herein is meant
`
`to apply generally to all embodiments of the invention as described