`© 2009 by The American Society for Biochemistry and Molecular Biology, Inc.
`
`Both Php4 Function and Subcellular Localization Are
`Regulated by Iron via a Multistep Mechanism Involving the
`Glutaredoxin Grx4 and the Export in Crm 1 *~
`
`Received for publication,April16, 2009, and in revised form, May 21,2009 Published,JBC Papers in Press, June 5, 2009, DOI10.1074/jbc.M109.009563
`Alexandre Mercier 1 and Simon Labbe 1
`2
`'
`From the Departement de Biochimie, Faculte de Medecine et des Sciences de Ia Sante, Universite de Sherbrooke,
`Sherbrooke, Quebec J7 H 5N4, Canada
`
`In Schizosaccharomyces pombe, the CCAA T -binding factor is
`a multislibunit complex that contains the proteins Php2, Php3,
`Php4, and Php5. Under low iron conditions, Php4 acts as a neg(cid:173)
`ative regulatory subunit of the CCAAT-binding factor and fos(cid:173)
`ters repression of genes encoding iron-using proteins. Under
`conditions of iron excess, Php4 expression is turned off by the
`iron-dependent transcriptional repressor Fepl. In this study, we
`developed a biological system that allows us to unlink iron-de(cid:173)
`pendent behavior of Php4 protein from its transcriptional reg(cid:173)
`ulation by Fepl. Microscopic analyses revealed that a functional
`GFP-Php4 protein accumulates in the nucleus under conditions
`of iron starvation. Conversely, in cells undergoing a transition
`from low to high iron, GFP-Php4 is exported from the nucleus to
`the cytoplasm. We mapped a leucine-rich nuclear export signal
`that is necessary for nuclear exclusion of Php4. This latter proc(cid:173)
`ess was blocked by leptomycin B. By using coimmunoprecipita(cid:173)
`tion analysis, we showed that Php4 and Crml physically interact
`with each other. Although we determined that nuclear retention
`of Php4 per se is not sufficient to cause a constitutive repression
`of iron-using genes, we found that deletion of the grx4+ -en(cid:173)
`coded glutaredoxin-4 renders Php4 constitutively active and
`invariably localized in the nucleus. Further analysis by bimolec(cid:173)
`ular fluorescence complementation assay and by two-hybrid
`assays showed that Php4 and Grx4 are physically associated in
`vivo. Taken together, our findings indicate that Grx4 and Crml
`are novel components involved in the mechanism by which
`Php4 is inactivated by iron in a Fepl-independent manner.
`
`Iron is essential to the growth of the vast majority of orga(cid:173)
`nisms. Because of its capacity to act as both an electron acceptor
`and donor, iron has become an indispensable catalytic cofactor
`for a multitude of enzymes involved in several biological pro(cid:173)
`cesses ranging from respiration, to the tricarboxylic acid cycle,
`to DNA synthesis (1). Paradoxically, excess iron is toxic because
`of its ability to generate hydroxyl radicals via the Fenton chem(cid:173)
`istry reaction (2). High levels of hydroxyl radicals can produce
`
`*This work was supported in part by the Natural Sciences and Engineering
`Research Council of Canada Grant MOP-238238-01 (to S. L.).
`lilThe on-line version of this article (available at http://www.jbc.org) contains
`supplemental Fig. 51.
`1 Recipient of scholarships from the Fonds de Ia Recherche en Sante du
`Quebec.
`2 To whom correspondence should be addressed: 3001, 12e Ave. Nord, Sher(cid:173)
`brooke, Quebec J 1 H 5N4, Canada. Tel.: 819-820-6868 (Ext. 15460); Fax: 819-
`564-5340; E-mail: Simon.Labbe@USherbrooke.ca.
`
`cellular damage, including direct protein or enzyme inactiva(cid:173)
`tion, membrane impairment because of lipid peroxidation, and
`oxidative DNA damage (3). These two facets of iron require
`that cells must establish fine-tuned mechanisms to maintain
`sufficient but not excessive concentrations of iron, thereby
`keeping the delicate balance between essential and toxic levels
`of iron.
`In Schizosaccharomyces pombe, iron homeostasis is con(cid:173)
`trolled by two iron-regulated proteins, the GATA-type tran(cid:173)
`scription factor Fep1 and the CCAAT-binding factor Php4 (4,
`5). When iron levels are high, Fep1 binds to GATA cis-acting
`elements found in the promoter regions of genes involved in
`iron acquisition (e.g.fipl+,fiol+,frpl+, and strl+ 12+ /3+) and
`shuts down their expression to avoid deleterious consequences
`of iron overload ( 6, 7). When iron levels are low, Fep 1 is unable
`to bind DNA, resulting in the transcriptional induction of genes
`involved in iron acquisition (6, 8, 9). Analogous to S. pombe,
`other fungi use Fep 1 orthologs to repress transcription of target
`genes in response to high iron. Examples include Urbs1 in Usti(cid:173)
`lago maydis (10, 11), SRE in Neurospora crassa (12), SreA in
`Aspergillus nidulans (13, 14), Sfu1 in Candida albicans (15),
`and Cir1 in Cryptococcus neoformans (16).
`In the fission yeast S. pombe, one gene that is regulated in a
`Fep1-dependent manner is php4+. php4+ encodes a subunit of
`the CCAA T -binding protein complex, which includes three
`other subunits, denoted Php2, Php3, and Php5 (17, 18). Genes
`encoding Php2, Php3, and Php5 are constitutively expressed,
`whereas transcript levels of php4+ are induced under condi(cid:173)
`tions of iron starvation and repressed under iron-replete
`conditions (18). Php4 is responsible for the transcriptional
`repression capability of the Php complex and is not required
`for the DNA binding activity of the complex. A genome-wide
`microarray analysis revealed that Php4 is capable of coordi- ·
`nating the repression of 86 genes in response to iron starva(cid:173)
`tion (19). Among these ·genes, several encode proteins
`involved in iron-dependent metabolic pathways, such as the
`tricarboxylic acid cycle, mitochondrial respiration, heme
`biosynthesis, and
`iron-sulfur cluster assembly. DNA
`microarray analysis also showed that the gene encoding the
`iron-responsive transcriptional repressor Fep1 is down-reg(cid:173)
`ulated in response to iron deficiency in a Php4-dependent
`fashion. Based on these data, we proposed a model wherein
`tight regulation of intracellular iron levels is controlled by
`the interplay between Php4 and Fepl through mutual con(cid:173)
`trol of each other's expression (19).
`
`JULY 24, 2009·VOLUME 284·NUMBER 30
`
`JOURNAL OF BIOLOGICAL CHEMISTRY 20249
`
`
`
`Iron Inhibition of Php4 Function
`
`Down-regulation of iron-dependent pathways to optimize
`the utilization of limited available iron has previously been
`described in other organisms. When iron is limiting in Esche(cid:173)
`richia coli, the transcriptional repressor Fur is inactivated, lead(cid:173)
`ing to increased levels of RyhB, a small noncoding RNA (20).
`RyhB hybridizes to mRNAs encoding iron-using proteins and
`triggers their degradation through an RNase £-dependent
`process (21). In Saccharomyces cerevisiae, iron deprivation
`leads to the activation of the iron-responsive transcription fac(cid:173)
`tors Aft1 and Aft2 (22-27). Once activated, these two regula(cid:173)
`tors induce the expression of several genes, including those
`encoding proteins that function in iron uptake. Additional
`genes are also positively regulated by Aft1 and Aft2, including
`CTHl anQ.,,_CTH2, which encode two CCCH-type zinc finger
`mRNA-binding proteins that bind AU-rich elements within the
`3' -untranslated region of transcripts (28, 29). Among the tran(cid:173)
`scripts that Cth1 and Cth2 can bind and down-regulate in
`response to iron starvation, several encode iron-using proteins
`or enzymes that participate in biochemical pathways that use
`iron as cofactor (29).
`As for Aft1 and Aft2, iron-responsive Cth1- and Cth2-like
`proteins are found mainly in Saccharomycotina fungal species
`(1). The other fungal species such as Pezizomycotina, Taphri(cid:173)
`nomycotina, Basidiomycota, and Zygomycota appear to have a
`distinct pair of iron-responsive regulatory proteins that include
`a negative GAT A-type transcriptional regulator (e.g. Fep1 and
`SreA) and a negative regulatory subunit of the CCAA T -binding
`complex (e.g. Php4 and HapX) (1).
`In A. nidulans, a Php4 ortholog, denoted Hap X, can trigger
`down-regulation of genes encoding iron-using proteins during
`iron deficiency (30). Interestingly, both Php4 and HapX have
`been shown to be regulated post-translationally by iron (19, 30).
`Experiments have shown that Hap X dissociates from the HapE
`subunit of the CCAAT-binding complex (HapB-C-E) when
`iron is abundant (30). Using a one-hybrid approach in fission
`yeast, a constitutively expressed Gal4-Php4 fusion protein was
`shown to repress transcription as a function of iron availability
`when brought to a DNA promoter, revealing that Php4 has the
`ability to sense iron at the protein level (19). Recent data have
`provided additional clues with respect to iron sensing. One
`aspect is the requirement of GSH to allow Php4 to sense iron
`excess (19). InS. pombe, mutant cells defective in GSH biogen(cid:173)
`esis show markedly decreased transcription of genes encoding
`iron-using proteins as a result of constitutively active Php4.
`GSH has also been associated with cellular iron sensing in S.
`cerevisiae (31). As for Php4, Aft1 is constitutively active during
`GSH deficiency (31). Elegant studies have also determined that
`S. cerevisiae monothiol glutaredoxins Grx3 and Grx4 are key
`regulators of Aft1 (32, 33). When cells undergo a transition
`from iron-limiting to iron-sufficient conditions, it has been
`proposed that Grx3 and Grx4, with the aid of Fra1 and Fra2,
`transmit an as-yet-unidentified mitochondrial inhibitory sig(cid:173)
`nal, which contributes to inactivate Aft1 (32-34).
`In this study, we first expressed a functional GFP-php4+
`allele under the control of a constitutive GAT A-less php4+ pro(cid:173)
`moter. By use of this system, we ensured that any effects of iron
`on GFP-Php4 were independent of potential changes in GFP(cid:173)
`php4+ expression. Under low iron conditions, GFP-Php4 accu-
`
`mula ted in the nucleus, whereas the protein was exported to the
`cytoplasm within 60 min of the addition of iron. We identified a
`functional leucine-rich nuclear export signal (NES) 3 within the
`region of amino acids 93-100 of Php4. We showed that Php4
`binds to Crml and is sensitive to leptomycin B (LMB), abolish(cid:173)
`ing its nuclear export behavior. In the presence of LMB,
`although the GFP-Php4 fusion protein was localized in the
`nucleus under conditions of both low and high levels of iron, we
`observed that the protein can still be inactivated by iron, result(cid:173)
`ing in the derepression of isal + transcription in response to
`iron. Deletion of grx4+, on the other hand, led to permanent
`Php4 nuclear accumulation and constitutive repression of
`isal +. Further analysis by bimolecular fluorescence comple(cid:173)
`mentation assay and by two-hybrid assays revealed that Grx4 is
`a binding partner of Php4. In summary, these results demon(cid:173)
`strate that the Php4 subunit of the S. pombe CCAA T -binding
`complex translocates from the nucleus to the cytoplasm in an
`iron-, Grx4-, and Crm1-dependent manner.
`
`EXPERIMENTAl PROCEDURES
`Yeast Strains and Growth Conditions-The S. pombe strains
`used in this study were the wild-type FY435 (h+ his7-366
`leu1-32 ura4-b.18 ade6-M210) and four isogenic mutant
`strains, feplb. (h+ his7-366 leul-32 ura4-b.18 ade6-M210
`fepl.D..::ura4+), php4b. (h+ his7-366 leul-32 ura4-b.18 ade6-
`M210 php4.D..::KAN), grx4b. (h+ his7-366 leul-32 ura4-1118
`ade6-M210 grx4b.::KAN), and php411 grx411 (h+ his7-366
`leul-32 ura4-1118 ade6-M210 php4.D..::loxP grx4.D..::KAN} All
`five strains were grown in yeast extract medium containing
`0.5% yeast extract and 3% glucose that was further supple(cid:173)
`mented with 225 mg/liter of adenine, histidine, leucine, uracil,
`and lysine, unless otherwise stated. Strains for which plasmid
`transformation was required were grown in synthetic Edin(cid:173)
`burgh minimal medium lacking specific nutrients required for
`plasmid selection and maintenance. Cells were seeded to an
`A 600 of 0.5, grown to exponential phase (A 600 of~ 1.0), and then
`treated with 250 J.LM 2,2' -dipyridyl (Dip) or 100 MM FeS04 , or
`left untreated for 90 min, unless otherwise indicated. S. pombe
`grx411 and php411 grx411 disruption strains, as well as control
`strains, were cultivated in culture jars under microaerobic con(cid:173)
`ditions using the GazPack EZ system (BD Biosciences). For
`two-hybrid experiments, S. cerevisiae strain L40 (Mata
`his3.D..200 trpl-901 leu2-3, 112 ade2 LYS2::(lexAop) 4-HIS3
`URA3::(lexAop) 8-lacZ) (35) was grown in synthetic minimal
`medium containing 83 mg/liter histidine, adenine, uracil, and
`lysine, 2% dextrose, 50 mM MES buffer (pH 6.1), and 0.67% yeast
`nitrogen base minus copper and iron (MP Biomedicals, Solon,
`OH).
`Plasmids-The pJK-194'·'promphp4+ plasmid contains a
`194-bp DNA segment of the php4+ promoter harboring multi(cid:173)
`ple point mutations in the two iron-responsive GATA
`sequences (positions -188 to 133 and -165 to 160) found
`
`3 The abbreviations used are: NES, nuclear export signal; BiFC, bimolecular
`fluorescence complementation; DAPI, 4',6-diamidino-2-phenylindole;
`Dip, 2, 2'-dipyridyl; GFP, green fluorescent protein; GSH, glutathione; LMB,
`leptomycin B; ORF, open reading frame; WT, wild type; MES, 2-(N-morpho(cid:173)
`lino)ethanesulfonic acid; PCNA, proliferating cell nuclear antigen.
`
`20250 JOURNAL OF BIOLOGICAL CHEMISTRY
`
`VOLUME 284·NUMBER 30·JULY 24,2009
`
`
`
`in the php4+ promoter (19). The open reading frame (ORF)
`encoding GFP was PCR-amplified from the pSF-GP1 plasmid
`(36) and inserted into the Sail and Asp718 restriction sites of
`pJK-194*promphp4+
`to create pJK-194*promphp4+ -GFP.
`pJK-194*promphp4+ -GFP-php4+ was constructed through a
`three-piece ligation by simultaneously introducing a BamHI(cid:173)
`Sali PCR-amplified fragment containing the GFP gene and a
`Sall-Asp718 PCR-amplified fragment bearing the php4+ ORF
`into a BamHI-Asp718-digested pJK-194'~promphp4+ plasmid.
`The nmtl + promoter up to position -1178 from the start
`codon of the nmtl +gene was amplified by PCR from pREP-41X
`(37). Once generated, the promoter DNA fragment was
`inserted into the integrative vector pJK148 (38) at the Sacll and
`BamHI site~:,}'he construct was denoted pJKnmt41X. A DNA
`fragment encoding the GFP-php4+ allele was isolated from
`pJK-194*promphp4+ -GFP-php4+ and then inserted into the
`BamHI and Asp718 restriction sites of pJKnmt41X to create
`pJKnmt41X-GFP-php4+. To generate the php4 NES mutant
`allele (L93A, L94A, 197 A, and L100A), the plasmid pJK-
`194*promphp4+ -GFP-php4+ was used in conjunction with the
`overlap extension method (39) and the oligonucleotides 5'(cid:173)
`CGAGGCAGCTGAGCAGGCAGAGATGGCTCAGGCTC(cid:173)
`AGTTGAAGAATTCTACTTTGG-3' and 5'-GCCTGAGC(cid:173)
`CATCTCTGCCTGCTCAGCTGCCTCGTTGTTCTCCT(cid:173)
`TCTGTAACTTTCCG-3'
`(underlined
`letters
`represent
`nucleotide substitutions that gave rise to mutations) and two
`oligonucleotides corresponding to the start and stop codons of
`the ORF of php4+. The resulting PCR-amplified fragment was
`digested with Sail and Asp718 and cloned into pJKnmt41X-GFP,
`which was previously engineered by inserting the GFP gene into
`pJKnmt41X. The resulting construct was designated pJK(cid:173)
`nmt41X-GFP-php4NESmut. All nucleotide changes were con(cid:173)
`firmed by DNA sequencing. Plasmids pSP-1178nmt-GST-GFP
`and pSP-1178nmt-GST-GFP-Pap1 515NES533 were constructed
`by a strategy described previously (40). Plasmid pSP-1178nmt(cid:173)
`GST -GFP was digested with Spel and Sstl restriction enzymes
`and used to receive annealed synthetic DNA fragments encod(cid:173)
`ing wild-type and mutant versions of Php4 NES. Resulting plas(cid:173)
`mids were denoted pSP-1178nmt-GST-GFP-Php473NES122
`and pSP-1178nmt-GST -GFP-Php473NES 122mut, respectively.
`Plasmid pJK-194'~promphp4+-TAP-php4+ was constructed by
`replacing the GFPORF in pJK-194*promphp4+ -GFP-php4+ by
`a PCR-amplified TAP fragment isolated from pREP1-NTAP
`(41). The purified TAP fragment was also cloned into pJK-
`194*promphp4+ to create pJK-194*promphp4+-TAP. Both
`pJK-194'~promphp4+-TAP-php4+ and pJK-194'~promphp4+
`TAP were subsequently used as templates to subclone their
`DNA inserts into the pEA500 plasmid (42), creating pEA500-
`194'~promphp4+ -TAP-php4+ and pEA500-194*promphp4+(cid:173)
`TAP, respectively. The S. pombe crml+ promoter up to -1000
`from the start codon of the crml + gene was isolated by PCR
`and then inserted into the pSP1 vector (43) at the Apal and
`Pstl sites. The resulting plasmid was denoted pSP1-
`1000crml+prom. The full-length coding region of crml+ was
`isolated by PCR, using primers that corresponded to the initia(cid:173)
`tor and stop codons of the ORF. Because the primers contained
`Pstl and Xmal restriction sites, the purified DNA fragment was
`digested with these enzymes and cloned into the corresponding
`
`. Iron Inhibition of Php4 Function
`
`sites of pSP1-1000crml+prom. The resulting plasmid was
`named pSP1crml+. The Myc12 epitope, obtained from the
`pctr4+ -X-myc12 plasmid (44) using Xmal and Sstl restriction
`enzymes, was subsequently inserted 3' to the crml + gene in
`pSP1crml+. For two-hybrid interaction assay, the complete or
`truncated versions of the php4+ gene were inserted down(cid:173)
`stream of and in-frame to the VP16 coding sequence using
`BamHI and Asp718 restriction sites found in p VP16 (35). The
`bait plasmid pLexA-grx4+ was created by cloning a 747-bp
`BamHI-Pstl DNA fragment containing the full-length coding
`region of grx4+ into the same sites of pLexNA (35).
`RNA Isolation and Analysis-Total RNA was extracted by a
`hot phenol method as described previously (45). RNA samples
`were quantified spectrophotometrically, and 15 /Lg of RNA per
`sample were used for the RNase protection assay, which was
`carried out as described previously (19). To detect grx4+
`mRNA levels, plasmid pSKgrx4+ was created by inserting a
`191-bp BamHI-EcoRI fragment from the grx4+ gene into the
`same restriction sites of pBluescript SK (Stratagene, La Jolla,
`CA). The antisense RNA hybridizes to the region between posi(cid:173)
`tions +327 and +518 downstream from the A of the initiator
`codon ofgrx4+. To generate pSKVP 16, a 201-bp fragment from
`the VP 16 gene was amplified and cloned into the BamHI-EcoRI
`sites of pBluescript SK. Plasmids pSKisal +, pSKphp4+, and
`pSKactl+ (18) were used to produce antisense RNA probes,
`allowing the detection of steady-state levels of isal+, php4+,
`and actl + mRNAs, respectively. A riboprobe derived from the
`plasmid pKSACTl (46) was used to monitor the steady-state
`levels of ACTl mRNAs in experiments using the bakers' yeast
`strain 140.
`Protein Extraction and Immunoblotting-Total celllysates
`were prepared as described previously (18). Celllysates were
`quantitated using the Bradford assay ( 47), and equal amounts of
`each sample were subjected to electrophoresis on 9% SDS-poly(cid:173)
`acrylamide gels. After electrophoresis, protein samples were
`electroblotted as described previously (9). The following pri(cid:173)
`mary antisera were used for immunodetection: monoclonal
`anti-GFP antibody (B-2; Santa Cruz Biotechnology) and mono(cid:173)
`clonal anti-PCNA antibody (PC10; Sigma). After incubation
`with the primary antibodies, membranes were washed, then
`incubated with the appropriate horseradish peroxidase-conju(cid:173)
`gated secondary antibodies (Jackson ImmunoResearch, West
`Grove, P A), developed with ECL reagents (Amersham Bio(cid:173)
`sciences), and visualized by chemiluminescence.
`Fluorescence Microscopy-To analyze the cellular localiza(cid:173)
`tion of GFP-Php4, an integrative plasmid expressing its corre(cid:173)
`sponding allele under the control of the php4+ promoter was
`transformed into a php4D. strain. Liquid cultures were seeded to
`an A 600 of 0.5 and then grown to exponential phase. At log
`phase (A 600 of~ 1.0), cells were treated with either 250 fLM Dip
`or 100 fLM FeS04 • After treatment, direct fluorescence micros(cid:173)
`copy was conducted as described previously (48). php4D. or
`php4D. grx4D. cells expressing the wild-type or mutant version
`of Php4 NES under the control of the nmtl + promoter were
`precultivated in the presence of thiamine (15 fLM) to an A 600 of
`~ 1.0. At this growth point, cells were washed twice to remove
`thiamine and seeded to anA 600 of0.1 prior to a 16-h incubation
`at 30 oc. After this growth period, cells (A 600 of ~0.75) were
`
`JULY 24, 2009•VOLUME 284·NUMBER 30
`
`JOURNAL OF BIOLOGICAL CHEMISTRY 20251
`
`
`
`Iron Inhibition of Php4 Function
`
`treated 3 h with 250 f.LM Dip, thereby allowing nuclear targeting
`of GFP-Php4. At log phase (A 600 of ~LO), cells were washed
`twice to remove Dip and then grown in the presence of 15 f.LM
`thiamine to stop nmtl +-dependent gene expression. At this
`point, the nuclear pool of GFP-Php4 was analyzed under con(cid:173)
`ditions of low or high iron for 0, 15, 30, and 60 min. For treat(cid:173)
`ment with LMB (L-2913; Sigma), cells were divided in half and
`treated with either 100 ng/ml LMB (in 1.4% methanol) or left
`untreated (with 1.4% methanol as a control), and allowed to
`continue growing at 30 oc in the presence of 100 p.,M FeS04 • At
`relevant time points, aliquots of cells were removed from each
`half (with or without LMB) and viewed by direct fluorescence
`microscopy. Cell fields shown in this study are representative of
`experimellts repeated at least five times.
`BiFC A~;;,lysis-The coding region of VC was amplified by
`PCR from the template pFA6a-VC-kanMX6 ( 49) using primers
`that added unique Sall and Asp718 restriction sites. The PCR
`product was digested with Sall and Asp718 and cloned into
`pGEM-7Zf (Promega, Madison, WI). Subsequently, the full(cid:173)
`length coding region of grx4+ was isolated by PCR and placed
`in-frame with the VC coding region using the BamHI and Sall
`restriction sites. The resulting plasmid was designated pGEM(cid:173)
`grx4+-vc. To generate pJK-194*promphp4+-grx4+-vc and
`pSP1-194*promphp4+ -grx4+-VC plasmids, the BamHI-Xhoi
`DNA restriction fragment containing the grx4+- VC cassette
`(from plasmid pGEM-grx4+-VC) was subcloned into the
`plasmids pJK-194*promphp4+ and pSP1-194;~promphp4+,
`respectively. The coding regions of VN and php4+ were gener(cid:173)
`ated by PCR amplification with pFA6a-VN-kanMX6 (49) and
`pJK-194*promphp4+ -GFP-php4+ as templates, respectively. A
`first pair of primers that incorporates unique 5 1 and 3 1 BamHI
`and Sall restriction sites, respectively, was used for VN. With
`respect to php4+, we used a set of primers that introduces
`unique Sall and Asp718 sites at the 5 1 and 3 1 ends, respectively.
`The VN-php4+ allele was constructed by three-piece ligation
`by simultaneously introducing the BamHI-Sall PCR-amplified
`fragment containing VN and the Sall-Asp718 PCR-amplified
`fragment harboring php4+ into the BamHI-Asp718-digested
`pEA500-194*promphp4+ vector. Subsequently, the Sacii(cid:173)
`Asp718 DNA fragment containing the VN-php4+ allele under
`the control of a GAT A-less php4+ promoter was cloned into
`the integrative plasmid pJK210 (38). Microscopic images for
`BiFC were taken using a magnification of X 1000 with a trans(cid:173)
`mission window at 465-495 nm.
`Coimmunoprecipitation-For coimmunoprecipitation ex(cid:173)
`periments, php4!::. cells were cotransformed with pEA500-
`194*promphp4+ -TAP and pSPl-crml+ -myc12 or pEA500-
`194*promphp4+ -TAP-php4+ and pSPl-crml+ -myc12. Cells
`were grown to an A 600 of 0.75 and then incubated in the pres(cid:173)
`ence of 250 p.,M Dip for 3 h. After this growth period, cells were
`washed twice and then re-incubated in the presence of 100 p.,M
`FeS04 for 15 min. Total celllysates were obtained by glass bead
`disruption in lysis buffer (10 mM Tris-HCl (pH 7.9), 0.1% Triton
`X-100, 0.5 mM EDTA, 20% glycerol, 100 mM NaCl, 1 mM phen(cid:173)
`ylmethylsulfonyl fluoride) containing a mixture of protease
`inhibitors (P -8340; Sigma). Typically, 8 -10 mg of total protein
`were added to a 15-p.,l bed volume of IgG-Sepharose 6 Fast(cid:173)
`Flow beads (GE Healthcare), and the mixture was tumbled for
`
`30 min at 4 oc. Beads were washed four times with 1 ml of lysis
`buffer, with the beads transferred to a fresh microtube before
`the last wash. The immunoprecipitates were resuspended in 60
`p.,l of SDS loading buffer, incubated for 5 min at 95 oc, and
`resolved by electrophoresis on a 9% SDS-polyacrylamide gel.
`For protein analysis of Crml-myc 12, TAP-Php4, and PCNA,
`the following primary antisera were used: monoclonal anti(cid:173)
`Myc antibody 9E10 (Roche Applied Science); polyclonal anti(cid:173)
`mouse IgG antibody (ICN Biomedicals, Aurora, OH); and
`monoclonal anti-PCNA antibody PClO (Sigma).
`Two-hybrid Analysis-Pre-cultures of each L40 cotransfor(cid:173)
`mant strain harboring the indicated bait and prey plasmids
`were grown to anA 600 of 0.5. Samples were withdrawn from the
`cultures, and quantitative measurements of J3-galactosidase
`activity were assayed using buffers and the substrate o-nitro(cid:173)
`phenyl-f3-D-galactopyranoside as described previously (50).
`Levels of J3-galactosidase activity were measured within the lin(cid:173)
`ear response range and expressed in standard units (51). Values
`shown are the average of triplicate assays of three independent
`cotransformants. For protein expression analysis, the antibod(cid:173)
`ies used were the monoclonal anti-LexA 2-12 directed against
`the LexA DNA binding domain and anti-VP16 1-21 directed
`against the VP16 activation domain (both from Santa Cruz Bio(cid:173)
`technology). A monoclonal anti-3-phosphoglycerate kinase
`antibody (Molecular Probes, Eugene, OR) was used to detect
`the phosphoglycerate kinase protein as an internal control.
`
`RESULTS
`Inactivation ofPhp4 by a Fepl-independent Mechanism-As
`we have previously shown (18, 19) inactivation of Php4 in
`response to iron is regulated at two distinct levels. First, in the
`presence of iron, Fepl associates with GATA elements in the
`php4+ promoter to repress transcription, ensuring the extinc(cid:173)
`tion of most php4+ transcripts. Second, we observed that in the
`absence of Fepl, although php4+ mRNA levels are constitutive
`and unresponsive to iron for repression, the gene product
`(Php4) can still be inactivated by iron. Iron-mediated inhibition
`of Php4 results in transcriptional induction of the regulon of
`genes controlled by Php4 (19). To begin to characterize the
`mechanism by which Php4 activity is regulated by iron in a
`Fepl-independent manner, we developed a biological system in
`which php4+ and GFP-php4+ alleles were expressed under the
`control of a GAT A-less php4+ promoter. By use of this system,
`we determined that php4!::. mutant cells expressing php4+ or
`GFP-php4+ exhibited php4+ mRNA levels that were constitu(cid:173)
`tively expressed under both low and high iron concentrations
`(Fig. lA). As control for normal transcriptional regulation, the
`steady-state levels of php4+ were down-regulated when wild(cid:173)
`type cells were grown under basal and iron-replete conditions
`(Fig. lA, WI). As controls for signal specificity, cells harboring
`an inactivatedfepl+ gene (jepl!::.) exhibited a constitutive tran(cid:173)
`scription of php4+, and php4+ mRNA was absent in php4!::. null
`cells (Fig. lA). Subsequently, we examined the effect of a sus(cid:173)
`tained php4+ or GFP-php4+ expression on the transcriptional
`profile of isal+, a Php4-regulated target gene (Fig. lB). When
`Php4 was constitutively expressed, we observed that the repres(cid:173)
`sion of isal + occurs only under low iron conditions, suggesting
`
`20252 JOURNAL OF BIOLOGICAL CHEMISTRY
`
`VOLUME 284·NUMBER 30·JULY 24,2009
`
`
`
`WT
`
`php4tJ
`
`(epltJ
`
`phpr
`
`GFP-php4+
`
`GAT A-less
`
`A
`
`B
`
`GAT A-less
`+
`+
`Dip -=- ~ Dip -=- ...!::._ Dip -=- ..!::__ Dip -=- ...!::._ Dip -=- ..!::__
`
`act]+-+--·-··----------
`
`wr
`
`php4tJ
`
`(epltJ
`
`GAT A-less
`
`+
`
`php4+
`
`GAT A-less
`+
`
`GFP-php4'
`
`c
`
`vector
`alone
`
`WT GATA
`
`GATA-less
`
`Dip
`
`M
`
`72-
`55-
`
`43- -
`
`Fe Dip
`
`-
`
`Fe
`
`............ ..-GFP-Php4
`
`34- ______ _ . -reNA
`
`26-
`
`FIGURE 1. Php4 is inactivated in a Fep1-independent manner.A, logarith(cid:173)
`mic phase cultures ofisogenic strains FY 435 (wn, AMY15 (php41l), and BPY1 0
`(fep 7/l) were untreated (-) or treated in the presence of Dip (250 f.LM) or
`Fe504 (Fe) (1 00 f.LM) for90 min. After treatment, total RNA was prepared from
`each sample and analyzed by RNase protection assays. Steady-state levels of
`php4+ and actl + mRNAs (indicated with arrows) were analyzed in the wild(cid:173)
`type strain and strains lacking the php4+ or fep7+ allele. When indicated,
`php41l cells were
`transformed with
`the
`integrative plasmids pJK-
`194*promphp4+ -php4+ (GAT A-less + php4+) and pJK-194*promphp4+ -GFP(cid:173)
`php4+ (GAT A-less + GFP-php4+). 8, aliquots of the cultures described for A
`were examined by RNase protection assays for steady-state levels of isa 7 +
`mRNA. The arrows indicate signals corresponding to isa7+ and act7+ tran(cid:173)
`scripts. RNase protection data shown in A and B are representative of three
`independent experiments. C, cells carrying a disrupted php41l allele were
`transformed with an empty plasmid (vector alone), or plasmids expressing
`GFP-php4+ under the control of the wild-type php4+ promoter (WT GATA), or
`under the regulation of a GATA-Iess php4+ promoter (GATA-/ess). Trans(cid:173)
`formed cells were grown under basal (-)or iron-deficient conditions (250 f.LM
`Dip) or with excess iron (1 00 f.LM Fe504 ) (Fe). Whole-cell extracts were pre(cid:173)
`pared and analyzed by immunoblotting with anti-GFP or anti-PCNA (as an
`internal control) antibody. M, the positions of the molecular weight standards
`are indicated to the left.
`
`that in the absence of Fep1 or its iron-responsive cis-acting
`elements iron can still trigger the inactivation ofPhp4 (Fig. 1B).
`To ensure that fusion of GFP to theN terminus of Php4 did
`not interfere with its function, we analyzed if iron limitation(cid:173)
`dependent down-regulationof isal+ gene expression was cor(cid:173)
`rected by integrating a GFP-php4+ allele expressed from both
`the wild-type php4+ promoter (data not shown) and its deriv(cid:173)
`ative version containing mutated GAT A elements. As shown in
`Fig. 1B, GFP-php4+ repressed isal + mRNA levels under iron(cid:173)
`limiting conditions in a manner similar to that of the wild-type
`php4+ allele. Furthermore, the ability of GFP-Php4 to repress
`isal + transcript levels occurred with both types of php4+ pro(cid:173)
`moter, native and GAT A-less. To further investigate the effect
`of iron on Php4 itself, we analyzed steady-state levels of GFP-
`
`Iron Inhibition of Php4 Function
`
`Php4 (predicted mass of 59.8 kDa) when expressed under the
`control of the GATA-less promoter. Immunoblot analyses
`revealed that GFP-Php4 is stable and present in similar relative
`amounts in iron-deficient and iron-replete cells, suggesting
`that the mechanism of Php4 inactivation was not operated
`through iron-regulated changes in protein synthesis or stability
`(Fig. 1C). On the other hand, we observed that steady-state
`levels of GFP-Php4 were dramatically reduced in cells grown in
`the presence of iron (or left untreated) when the fusion allele
`was under the control of the wild-type php4+ promoter (Fig.
`1C). Therefore, despite a constitutively expressed GFP-Php4,
`either from afepl!J. strain or a GAT A-less promoter, the Php4
`target gene isal + was only repressed under low iron conditions.
`These results strongly suggest that iron can trigger the inacti(cid:173)
`vation of Php4 function through an additional mechanism that
`is independent of Fep1-mediated transcriptional repression.
`Iron Starvation Induces Nuclear Accumulation of GFP-Php4-
`T o further investigate the mechanism by which Php4 activity is
`regulated, we examined the localization of Php4 in response to
`changes in iron levels. To perform these experiments, we used a
`php4/J. mutant strain where expression of the GFP-php4+ allele
`was under the control of a GAT A-less php4+ promoter. Cells
`were grown in minimal medium (under basal conditions) to
`exponential phase and then treated with the iron chelator Dip
`(250 J.LM) or FeS04 (100 J.LM) for 3 h. Following treatment with
`Dip, GFP-Php4localized to the nucleus (Fig. 2). Consistent with
`this observation, GFP-Php4 fluorescence colocalized with the
`DNA-staining dye DAPI, which was -used as a marker for
`nuclear staining. When cells were treated with FeS04 , GFP(cid:173)
`Php4 was viewed primarily in the cytoplasm (Fig. 2). Before
`treatment (at the zero time point; minimal medium contained
`74 nM iron), GFP-Php4 displayed a