`To:
`Cc:
`Subject:
`Date:
`Attachments:
`
`srauake@qmail.com on behalf of Stephen Quake
`Leonard A. Herzenberg
`Christina Fan; Yajr Blumenfeld
`Re: favor re: pnas
`Wednesday, July 09, 2008 3:20:54 AM
`noninvasive v1.5.pdf
`
`sorry, here is the attachment...
`
`On 7/8/08, Leonard A. Herzenberg <LenHerz@darwin.stanford.edu> wrote:
`> Steve,
`> There was no attached mss.
`> Len
`>
`> -----Original Message-----
`> From: srquake@gmail.com [mailto:srquake@gmail.com] On Behalf Of Stephen Quake
`> Sent: Tuesday, July 08, 2008 2:47 PM
`>To: Leonard A. Herzenberg
`> Cc: Christina H. Fan; Yair Blumenfeld
`> Subject: Re: favor re: pnas
`>
`>Len,
`>
`> Here is the manuscript- hope you enjoy it!
`>
`> best,
`>
`>Steve
`>
`> On 7/1/08, Stephen Quake <quake@stanford.edu> wrote:
`> > Many thanks for doing this. I will get you the mss early next week.
`>>
`> >Steve
`> > ---------------
`> > Stephen Quake
`> > Professor of Bioengineering
`> > Stanford University
`> >
`> > NOTE NEW EMAIL: quake@stanford.edu
`>>
`>>
`> > -----Original Message-----
`> > From: "Leonard A. Herzenberg" <LenHerz@darwin.stanford.edu>
`>>
`> > Date: Tue, 1 Jul 2008 22:37:01
`> > To: quake@stanford.edu<quake@stanford.edu>
`> > Subject: RE: favor re: pnas
`>>
`>>
`> > Steve,
`> > I thought you would so I'm not disappointed. So send me the mss in form for PNAS and I'll send it
`to two of the three referees recommended by you plus Diana. That way I will maintain "secrecy".
`> > When can I expect your mss which I'll read first. If I accept it,
`> > I'll have the PNAS office send to the two referees.
`>>Len
`>>
`> >
`> > -----Original Message-----
`
`STANFORD EXHIBIT 2112
`SEQUENOM v. STANFORD
`C.A.SE IPR2013-00390
`
`
`
`> > From: Stephen Quake [mailto:guake@stanford.edu]
`> > Sent: Tuesday, July 01, 2008 10:27 PM
`> > To: Leonard A. Herzenberg
`> > Subject: Re: favor re: pnas
`> >
`> > Yes I know about microchimerism and we are not sensitive to it since we are effectively sampling
`dna from many cells, only a tiny fraction of which might be chimeric. I will put in a paragraph discussing
`this.
`> >
`> > Diana wouild be a great referee, I know about her work but didn't realize she trained with you.
`> >
`> > Best
`> >
`> >Steve
`> > ---------------
`> > Stephen Quake
`> > Professor of Bioengineering
`> > Stanford University
`> >
`> > NOTE NEW EMAIL: quake@stanford.edu
`>>
`> >
`> > -----Original Message-----
`> > From: "Leonard A. Herzenberg" <LenHerz@darwin.stanford.edu>
`> >
`> > Date: Tue, 1 Jul 2008 13:35:00
`> > To: Stephen Quake<quake@stanford.edu>
`> > Subject: RE: favor re: pnas
`> >
`> >
`> > Hi Steve,
`> > Do you know of microchimerism? The women (mothers here) who had received fetal cells from a
`former pregnancy or from their mothers or by exchange of blood with twins (non-identical) from a prior
`pregnancy maintain these cells, probably in their bone marrow. Then in tissues having an autoimmune
`manifestation will contain these microchimeric cells. That might lead to plasma having DNA from other
`sources than the current pregnancy.
`> > This was written up in a Scientific American Article by J. Lee Nelson earlier this year in Feb. I think.
`> > Has you mss taken this into account?
`> > If so, I'd like one of your reviewers be Diana Bianchi, a former med student of mine from the '70s,
`who discovered with me and my lab fetal cells in maternal blood. She is now a Prof at Tufts Univ Med
`School in Boston.
`> > If all goes well, I could communicate your mss to PNAS.
`>>Len
`> >
`> > -----Original Message-----
`> > From: srquake@gmail.com [majlto·srquake@gmajl com ] On Behalf Of Stephen Quake
`> > Sent: Tuesday, July 01, 2008 11:44 AM
`> > To: Leonard A. Herzenberg
`> > Subject: favor re: pnas
`> >
`> > Len,
`> >
`> > I have a favor to ask. We are doing a clinical study on cell-free DNA
`> > found in the blood of pregnant women. As you may know, a significant
`> > (rv3%) portion of this of fetal origin. We used next-generation
`> > sequencing to sequence huge amounts of this dna, and found, among
`> > other things, that we can map the fragments back to their chromosomes
`> > of origin and use the statistics of this mapping to diagnose whether
`> > or not the fetus has an aneuploidy such as down syndrome. this is a
`> > big deal as it enables a non-invasive test for down syndrome, so amnia
`
`
`
`> > and cvs (and the risk to the fetus that they pose) can be retired. we
`> > have been in a hot race with groups in hong kong and basel to achieve
`> >this, and i am worried that we might get scooped.
`>>
`> > would you be willing to communicate the manuscript to pnas for us, and
`> > fairly rapidly? if so, and if it would be useful to you, i have also
`> > found two distinguished scientists who work at the interface of
`> > genomics and human health who are willing to referee with a fast
`> > turnaround (i don't collaborate with either): mike snyder (yale) and
`> > eddy rubin (director of the doe joint genome institute).
`> >
`> > hope you are well,
`> >
`> >steve
`> > --
`> > -----------------------
`> >Stephen Quake
`> > Professor of Bioengineering
`> > Stanford University
`> >
`> > PLEASE REPLY TO: quake@stanford.edu
`> >
`>
`>
`> --
`> -----------------------
`> Stephen Quake
`> Professor of Bioengineering
`> Stanford University
`>
`> PLEASE REPLY TO: quake@stanford.edu
`>
`
`Stephen Quake
`Professor of Bioengineering
`Stanford University
`
`PLEASE REPLY TO: quake@stanford.edu
`
`
`
`Classification:
`Major- Biological Sciences
`Minor- Medical Sciences
`
`Title:
`Noninvasive Diagnosis of Fetal Aneuploidy by Shotgun Sequencing DNA from Maternal
`Blood
`
`Author affiliation:
`H. Christina Fan
`Yair J. Blumenfeldt
`Usher Chitkara t
`Louanne Hudginst
`Stephen R. Quake*
`
`*Department of Bioengineering, Stanford University and Howard Hughes Medical
`Institute, 318 Campus Dr, Clark Center, Rm E300, Stanford, California 94305, USA
`tDivision of Maternal and Fetal Medicine, Department of Obstetrics and Gynecology,
`Stanford University, Stanford, California 94305, USA
`tDivision of Genetics, Department of Pediatrics, Stanford University, Stanford,
`California 94305, USA
`
`Corresponding Author:
`Stephen R. Quake
`318 Campus Dr, Clark Center E300, Stanford CA 94305, USA
`guake@stanford.edu
`650-736-7890 (phone)
`650-736-1961 (fax)
`
`Manuscript Information:
`Number of text pages:
`Number of figure:
`Number of tables:
`
`Abbreviations:
`T21: trisomy 21
`
`1
`
`
`
`Abstract
`
`We directly sequenced cell-free DNA from plasma of pregnant women with high
`
`throughput shotgun sequencing technology, obtaining on average a few million sequence
`
`tags per patient sample. This enabled us to measure the over- and under-representation of
`
`chromosomes from an aneuploid fetus. The sequencing approach is polymorphism(cid:173)
`
`independent and therefore universally applicable for the non-invasive detection of fetal
`
`aneuploidy. Using this method we successfully identified all 7 cases of trisomy 21 (Down
`
`syndrome) in a cohort of 13 normal and aneuploid pregnancies; trisomy 21 was detected
`
`at gestational ages as early as the 14th week. Direct sequencing also allowed us to study
`
`the characteristics of cell-free plasma DNA, and we found evidence that this DNA is
`
`enriched for sequences from nucleosomes.
`
`2
`
`
`
`Introduction
`
`Fetal aneuploidy and other chromosomal aberrations affect 9 out of 1000 live births (1).
`
`The gold standard for diagnosing chromosomal abnormalities is karyotyping of fetal cells
`
`obtained via invasive procedures such as chorionic villus sampling and amniocentesis.
`
`These procedures impose small but potentially significant risks to both the fetus and the
`
`mother (2). Non-invasive screening of fetal aneuploidy using maternal serum markers
`
`and ultrasound are available but have limited reliability (3-5). There is therefore a desire
`
`to develop non-invasive genetic tests for fetal chromosomal abnormalities.
`
`Since the discovery of intact fetal cells in maternal blood, there has been intense interest
`
`in trying to use them as a diagnostic window into fetal genetics (6-8). While this has not
`
`yet moved into practical application (9), the later discovery that significant amounts of
`
`cell-free fetal nucleic acids also exist in maternal circulation has led to the development
`
`of new non-invasive prenatal genetic tests for a variety of traits (10, 11). However,
`
`measuring aneuploidy remains challenging due to the high background of maternal DNA;
`
`fetal DNA often constitutes <10% of total DNA in maternal cell-free plasma (12).
`
`Recently developed methods for aneuploidy detection focus on allelic variation between
`
`the mother and the fetus. Lo eta/. demonstrated that allelic ratios of placental specific
`
`mRNA in maternal plasma could be used to detect trisomy 21 in certain populations (13).
`
`Similarly, they also showed the use of allelic ratios of imprinted genes in maternal
`
`plasma DNA to diagnose trisomy 18 (14). Dhallan eta!. used fetal specific alleles in
`
`maternal plasma DNA to detect trisomy 21 (15). However, these methods are limited to
`
`specific populations because they depend on the presence of genetic polymorphisms at
`
`3
`
`
`
`specific loci. We and others argued that it should be possible in principle to use digital
`
`PCR to create a universal, polymorphism independent test for fetal aneuploidy using
`
`maternal plasma DNA (16-18), but due to technical challenges relating to the low fraction
`
`of fetal DNA such a test has not yet been practically realized.
`
`An alternative method to achieve digital quantification of DNA is direct sequencing
`
`followed by mapping to the chromosome of origin and enumeration of fragments per
`
`chromosome. Recent advances in DNA sequencing technology allow massively parallel
`
`sequencing ( 19), producing tens of millions of short sequence tags in a single run and
`
`enabling a deeper sampling than can be achieved by digital PCR. By counting the number
`
`of sequence tags mapped to each chromosome, the over- or under- representation of any
`
`chromosome in maternal plasma DNA contributed by an aneuploid fetus can be detected.
`
`This method does not require the differentiation of fetal versus maternal DNA, and with
`
`large enough tag counts it can be applied to arbitrarily small fractions of fetal DNA. We
`
`demonstrate here the successful use of massively parallel sequencing to detect fetal
`
`trisomy 21 (Down syndrome) non-invasively using cell-free fetal DNA in maternal
`
`plasma. This forms the basis of a universal, polymorphism-independent non-invasive
`
`diagnostic test for fetal aneuploidy. The sequence data also allowed us to characterize
`
`plasma DNA in unprecedented detail, suggesting that it is enriched for nucleosome bound
`
`fragments.
`
`4
`
`
`
`Results
`
`Direct Sequencing of Cell-free Plasma DNA
`
`Cell-free plasma DNA from 13 pregnant women and a male donor, as well as whole
`
`blood genomic DNA from the same male donor, were sequenced on the Solexa/Illumina
`
`platform. We obtained on average ,...,g million 25bp sequence tags per sample. About 50%
`
`(i.e. ,...,4 million) of the reads mapped uniquely to the human genome with at most 1
`
`mismatch against the human genome, covering ,...,3-4% of the entire genome. An average
`
`of ,...,60,000 sequence tags mapped to chromosome 21. The number of sequence tags for
`
`each sample is detailed in Supporting Information SI Table 1.
`
`We observed a non-uniform distribution of sequence tags across each chromosome. This
`
`pattern of intra-chromosomal variation was common among all samples, including
`
`randomly sheared genomic DNA, indicating the observed variation was most probably
`
`due to sequencing artifacts. We applied a sliding window of 50kb across each
`
`chromosome and counted the number of tags falling within each window. The median
`
`count per 50kb window for each chromosome was selected. The median of the autosomal
`
`values was used as a normalization constant to account for the differences in total number
`
`of sequence tags obtained for different samples. (From this point forward, 'sequence tag
`
`density' refers to the normalized value and is used for comparing different samples and
`
`for subsequent analysis). The inter-chromosomal variation within each sample was also
`
`consistent among all samples (including genomic DNA control) and seemed to vary with
`
`GC content of the chromosome. The chromosomes with highest GC content showed the
`
`greatest degree of variability in coverage; the chromosomes with lowest GC content
`
`5
`
`
`
`showed moderate variability in coverage, while the chromosomes with moderate GC
`
`content have the least variability (Figure 1a, SI Figure 1). The GC content of sequenced
`
`tags of all samples (including the genomic DNA control) was on average 12% higher
`
`than the value of the sequenced human genome ( 41%) (20)(SI Table 1 ), suggesting that
`
`there is a strong GC bias stemming from the sequencing process. We plotted in Figure 1a
`
`the sequence tag density for each chromosome relative to the corresponding value of the
`
`genomic DNA control to remove such bias.
`
`Detection of Fetal Aneuploidy
`
`The distribution of chromosome 21 sequence tag density for T21 pregnancies is clearly
`
`separated from that of normal pregnancies (p<10-6
`
`, Student's t-test) (Figure 1a and 1b).
`
`The coverage of chromosome 21 for T21 cases is about ~8-18% higher (average ~ 13%)
`
`than that of the normal cases. Because the sequence tag density of chromosome 21 for
`
`T21 cases should be ( 1 +c/2) of that of normal pregnancies, where E is the fraction of total
`
`plasma DNA originating from the fetus (see SI for derivations), such increase in
`
`chromosome 21 coverage in T21 cases corresponds to a fetal DNA fraction of~ 16% -
`
`35% (average ~26%). We constructed a 99% confidence interval of the distribution of
`
`chromosome 21 sequence tag density of normal pregnancies. The values for all 7 T21
`
`cases lie outside the upper boundary of the confidence interval and those for all 6 normal
`
`cases lie within the interval (Figure 1 b). If we used the upper bound of the confidence
`
`interval as a threshold value for detecting T21, the minimum fraction of fetal DNA that
`
`would be detected is ~4%.
`
`6
`
`
`
`Fetal DNA Fraction in Maternal Plasma
`
`Using digital Taqman PCR for a single locus on chromosome 1, we estimated the average
`
`cell-free DNA concentration to be 351GE/ml of plasma (range: 57 to 761 cell
`
`equivalent/ml plasma) (SI Table 1), in rough accordance to previously reported values
`
`(12). The cohort included 9 male pregnancies (6 normal cases and 3 T21 cases) and 4
`
`female pregnancies (all T21). DYS14, a multi-copy locus on chromosome Y, was
`
`detectable in maternal plasma by real-time PCR in all these pregnancies but not in any of
`
`the female pregnancies (data not shown). The fraction of fetal DNA in maternal cell-free
`
`plasma DNA is usually determined by comparing the amount of fetal specific locus (such
`
`as the SRY locus on chromosome Yin male pregnancies) to that of a locus on any
`
`autosome that is common to both the mother and the fetus using quantitative real-time
`
`PCR (12, 21, 22). We applied a similar duplex assay on a digital PCR platform (see
`
`Methods) to compare the counts of the SRY locus and a locus on chromosome 1 in male
`
`pregnancies. SRY locus was not detectable in any plasma DNA samples from female
`
`pregnancies. We found with digital PCR that on average, fetal DNA constituted ~10% of
`
`total DNA in maternal plasma (SI Table 1 ), agreeing with previously reported values
`
`(12).
`
`The percentage of fetal DNA among total cell-free DNA in maternal plasma can also be
`
`calculated from the density of sequence tags of the sex chromosomes for male
`
`pregnancies. By comparing the sequence tag density of chromosome Y of plasma DNA
`
`from male pregnancies to that of adult male plasma DNA, we estimated fetal DNA
`
`percentage to be on average~ 14% for normal male pregnancies and ~24% for T21 male
`
`7
`
`
`
`pregnancies. (SI Table 1 ). Because human males have 1 fewer chromosome X than
`
`human females, the sequence tag density of chromosome X in male pregnancies should
`
`be (1-c/2) ofthat of female pregnancies, where E is fetal DNA fraction (see SI for
`
`derivation). Based on the data from chromosome X, we estimated fetal DNA percentage
`
`to be on average ~13% for normal male pregnancies and ~27% for T21 male pregnancies
`
`(Figure 1c, SI Table 1). The fetal DNA percentage estimated from chromosomes X andY
`
`for each male pregnancy sample roughly agree with each other (SI Figure 2).
`
`Size Distribution of Cell-Free Plasma DNA
`
`We analyzed the sequencing libraries with a commercial lab-on-a-chip capillary
`
`electrophoresis system. There is a striking consistency in the peak fragment size, as well
`
`as the distribution around the peak, for all plasma DNA samples, including those from
`
`pregnant women and male donor. The peak fragment size was 260bp +/- 4 bp (SI Figure
`
`3). Subtracting the total length of the Solexa adaptors (92bp) from 260bp gives 168bp as
`
`the actual peak fragment size. This size corresponds to the length of DNA wrapped in a
`
`chromatosome, which is a nucleosome bound to a H1 histone (23). Because the library
`
`preparation includes an 18-cycle PCR, one might worry that this biases the distribution.
`
`To verify that the size distribution observed in the electropherograms is not an artifact of
`
`PCR, we also sequenced cell-free plasma DNA from a pregnant woman carrying a male
`
`fetus using the 454 platform. This does not require competitive PCR amplification of the
`
`sequencing libraries and is capable producing average read-length of about 250bp. The
`
`size distribution of the reads mapped to unique locations of the human genome resembled
`
`those ofthe Solexa sequencing libraries, with a predominant peak at 176bp, after
`
`8
`
`
`
`subtracting the length of 454 universal adaptors. (Figure 3 and SI Figure 3). These
`
`findings suggest that the majority of cell-free DNA in the plasma is derived from
`
`apoptotic cells, in accordance with previous findings (21, 22, 24, 25).
`
`Of particular interest is the size distribution of maternal and fetal DNA in maternal cell(cid:173)
`
`free plasma. Two groups have previously shown that the majority of fetal DNA has size
`
`range ofthat ofmono-nucleosome (<200-JOObp), while maternal DNA is longer.
`
`Because 454 sequencing has a maximum read-length of350bp, we suspected that the
`
`small peak at around 250bp (Figure 3 and SI Figure 3) was a result from the
`
`instrumentation limit of the sequencing of higher molecular weight fragments. We plotted
`
`the distribution of all reads and those mapped toY-chromosome (Figure 3). We observed
`
`a slight depletion of Y -chromosome reads in the higher end of the distribution. Reads
`
`<220bp constitute 94% and 87% ofY-chromosome and total reads respectively. Our
`
`results are not in complete agreement with previous findings in that we do not see as
`
`dramatic an enrichment of fetal DNA at short lengths (21, 22). Future studies will be
`
`needed to resolve this point, but it is worth noting that the ability to sequence single
`
`plasma samples permits one to measure the distribution in length enrichments across
`
`many individual patients rather than measuring the average length enrichment of pooled
`
`patient samples.
`
`Cell-Free Plasma DNA Shares Features ofNucleosomal DNA
`
`9
`
`
`
`Since our observations of the size distribution of cell-free plasma DNA suggested that
`
`plasma DNA is mainly apoptotic of origin, we investigated whether features of
`
`nucleosomal DNA and positioning are found in plasma DNA. One such feature is
`
`nucleosome positioning around transcription start sites. Experimental data from yeast and
`
`human have suggested that nucleosomes are depleted in promoters upstream of
`
`transcription start sites and nucleosomes are well-positioned near transcription start sites
`
`(26-29). We applied a 5bp window spanning+/- lOOObp of transcription start sites of all
`
`RefSeq genes and counted the number of tags mapping to the sense and antisense strands
`
`within each window. A peak in the sense strand represents the beginning of a nucleosome
`
`while a peak in the antisense strand represents the end. After smoothing, we saw that for
`
`most plasma DNA samples, at least 3 well-positioned nucleosomes downstream of
`
`transcription start sites could be detected, and in some cases, up to 5 well-positioned
`
`nucleosomes could be detected, in rough accordance to that of Schones et al. study (26)
`
`(Figure 4 and SI Figure 5). We applied the same analysis on sequence tags of randomly
`
`sheared genomic DNA and observed no obvious pattern in tag localization, although the
`
`density of tag was higher at the transcription start site (Figure 4).
`
`10
`
`
`
`Discussion
`
`Non-invasive prenatal diagnosis of aneuploidy has been a challenging problem because
`
`fetal DNA constitutes a small percentage of total DNA in maternal blood (12) and intact
`
`fetal cells are even rarer (7, 30, 31). We showed in this study the successful development
`
`of a truly universal, polymorphism-independent non-invasive test for fetal aneuploidy. By
`
`directly sequencing maternal plasma DNA, we could detect fetal trisomy 21 as early as
`
`14th week of gestation. Using cell-free DNA instead of intact cells allows one to avoid
`
`complexities associated with microchimerism and foreign cells that might have colonized
`
`the mother; these cells occur at such low numbers that their contribution to the cell-free
`
`DNA is negligible (32, 33). Furthermore, there is evidence that cell-free fetal DNA clears
`
`from the blood to undetectable levels within a few hours of delivery and therefore is not
`
`carried forward from one pregnancy to the next (34-36).
`
`We measured a higher fetal DNA percentage in T21 male cases than normal male cases:
`
`depletion of chromosome X sequence tags of T21 male cases is greater than that of
`
`normal male cases (p<0.05, Student's t-test). The coverage of chromosome Y ofT21
`
`male cases is also slightly higher than normal male cases, although the difference does
`
`not reach statistical significance. The observed trend agrees with previous findings that
`
`the concentration of fetal DNA in maternal circulation in T21 cases is higher than that in
`
`normal cases (39-44). It also appears that fetal DNA fraction correlates roughly with
`
`gestational age (Figure 2).
`
`11
`
`
`
`An advantage of using direct sequencing to measure aneuploidy non-invasively is that it
`
`is able to make full use of the sample, while PCR based methods analyze only a few
`
`targeted sequences. In this study, we obtained on average 4 million reads per sample in a
`
`single run, of which 60,000 mapped to chromosome 21. Since those 4 million reads
`
`represent only a portion of one human genome, in principle less than one genomic
`
`equivalent of DNA could be used for the detection of aneuploidy using direct
`
`sequencing,. In practice, a larger amount of DNA was used since there is sample loss
`
`during sequencing library preparation, but we note that it may be possible to further
`
`reduce the amount of plasma required for this analysis.
`
`We observed that certain chromosomes have large variation in counts of sequenced
`
`fragments from sample to sample. It is unclear at this point whether this stems from PCR
`
`artifacts during sequencing library preparation or cluster generation, the sequencing
`
`process itself, or whether it is a true biological effect relating to chromatin structure. It
`
`has a practical consequence since the sensitivity to aneuploidy detection will vary from
`
`chromosome to chromosome; fortunately the most common human aneuploidies (such as
`
`13, 18, and 21) have low variation and therefore high detection sensitivity. Both this
`
`problem and the sample volume limitations may possibly be resolved by the use of single
`
`molecule sequencing technologies, which do not require the use of PCR for library
`
`preparation ( 45).
`
`Plasma DNA samples used in this study were obtained about 15 to 30 minutes after
`
`amniocentesis or chorionic villus sampling. Since these invasive procedures disrupt the
`
`12
`
`
`
`interface between the placenta and maternal circulation, there have been discussions on
`
`the potential increase in the amount of fetal DNA in maternal following invasive
`
`procedures, although the changes in the fraction of fetal DNA in cell-free plasma has not
`
`been thoroughly examined ( 40, 46). It remains to be resolved if our ability to detect
`
`trisomy 21 with direct sequencing has been enhanced by using samples after the invasive
`
`procedures were performed. However, using digital PCR assay, we estimated that fetal
`
`DNA constituted :::;;10% of total cell-free DNA in our maternal plasma samples, which is
`
`within the range of previously reported values in maternal plasma samples obtained prior
`
`to invasive procedures (12).
`
`The average fetal DNA fraction estimated from sequencing data is higher than the values
`
`estimated from digital PCR data by nearly a factor of two (p<0.05, paired t-test). One
`
`possible explanation for this is that the PCR step during Solexa library preparation
`
`preferentially amplifies shorter fragments, which others have found to be enriched for
`
`fetal DNA (21, 22). Our own measurements of length distribution on one sample do not
`
`support this explanation, but nor can we reject it at this point. It should also be pointed
`
`out that using the sequence tags we find a fairly substantial variation of fetal fraction
`
`even in the same sample depending on which chromosome we use to make the
`
`calculation (SI Figure 2). This is most likely due to artifacts and errors in the sequencing
`
`and mapping processes, which are substantial- recall that only half of the sequence tags
`
`map to the human genome with one error or less. Finally, it is also possible that the PCR
`
`measurements are biased since they are only sampling a tiny fraction of the fetal genome.
`
`These discrepancies will be sorted out in future studies as sequencing reliability
`
`13
`
`
`
`improves, and our results show that they do not materially affect the ability to determine
`
`fetal aneuploidy.
`
`Our sequencing data suggest that the majority of cell-free plasma DNA is apoptotic of
`
`origin and shares feature of nucleosomal DNA. Since nucleosome occupancy throughout
`
`the eukaryotic genome is not necessarily uniform and depends on factors such as
`
`function, expression, or sequence of the region (29, 47), the representation of sequences
`
`from different loci in cell-free maternal plasma may not be equal, as in genomic DNA
`
`extracted from intact cells. Thus, the quantity of a particular locus may not be
`
`representative of the quantity of the entire chromosome and care must be taken when one
`
`would want to design assays that target at only a few loci to measure difference in gene
`
`dosage in cell-free maternal plasma DNA.
`
`Historically, due to risks associated with chorionic villus sampling and amniocentesis,
`
`invasive diagnosis of fetal aneuploidy was primarily offered to women who were
`
`considered at risk of carrying an aneuploid fetus based on evaluation of risk factors such
`
`as maternal age, levels of serum markers, and ultrasonographic findings. Recently, an
`
`American College of Obstetricians and Gynecologists (ACOG) Practice Bulletin
`
`recommended that "invasive diagnostic testing for aneuploidy should be available to all
`
`women, regardless of maternal age" and that "pretest counseling should include a
`
`discussion of the risks and benefits of invasive testing compared with screening tests"(2).
`
`If the risks of the noninvasive test described here are truly minimal, non-invasive
`
`aneuploidy testing could become a routine part of prenatal care in the near future. The
`
`14
`
`
`
`costs of the test are already fairly low; the sequencing cost per sample is about $700 and
`
`the cost of sequencing is expected to continue to drop dramatically in the near future.
`
`In conclusion, we demonstrated the first massively parallel sequencing of cell-free
`
`plasma DNA. Direct sequencing can potentially reveal many more previously unknown
`
`features of cell-free nucleic acids such as plasma mRNA distributions, as well as
`
`epigenetic features of plasma DNA such as DNA methylation and histone modification,
`
`in fields including perinatology, oncology and transplantation, thereby improving our
`
`understanding of the basic biology of pregnancy, early human development and disease.
`
`15
`
`
`
`Materials & Methods
`
`Subject Enrollment
`
`The study was approved by the Institutional Review Board of Stanford University.
`
`Pregnant women at risk for fetal aneuploidy were recruited at the Lucile Packard
`
`Children Hospital Perinatal Diagnostic Center of Stanford University during the period of
`
`April 2007 to May 2008. Informed consent was obtained from each participant prior to
`
`the blood draw. Blood was collected 15 to 30 minutes after amniocentesis or chorionic
`
`villus sampling. Karyotype analysis was performed via amniocentesis or chorionic villus
`
`sampling to confirm fetal karyotype. 7 trisomy 21 (T21) and 6 normal singleton
`
`pregnancies were included in this study. The gestational age of the subjects at the time of
`
`blood draw ranged from 11 to 35 weeks (SI Table 1). 12 blood samples were obtained
`
`during the second trimester while the remaining one, which was a T21 case, was obtained
`
`during the third trimester. Blood sample from a male donor was purchased from the
`
`Stanford Blood Center.
`
`Sample Processing and DNA Quantification
`
`7 to 15ml of peripheral blood drawn from each subject and donor was collected in EDTA
`
`tubes. Blood was centrifuged at 1600g for 10 minutes. Plasma was transferred to
`
`microcentrifuge tubes and centrifuged at 16000g for 10 minutes to remove residual cells.
`
`The two centrifugation steps were performed within 24 hours after blood collection. Cell(cid:173)
`
`free plasma was stored at -80C until further processing and was frozen and thawed only
`
`once before DNA extraction. DNA was extracted from cell-free plasma using QIAamp
`
`16
`
`
`
`DNA Micro Kit (Qiagen) or NucleoSpin Plasma Kit (Macherey-Nagel) according to
`
`manufacturers' instructions. Genomic DNA was extracted from 200J.!l whole blood of the
`
`donors using QIAamp DNA Blood Mini Kit (Qiagen). Microfluidic digital PCR
`
`(Fluidigm) was used to quantify the amount of total and fetal DNA using Taqman assays
`
`targeting at the EIF2C 1 locus on chromosome 1 (Forward: 5'
`
`GTTCGGCTTTCACCAGTCT 3'; Reverse: 5' CTCCATAGCTCTCCCCACTC 3';
`
`Probe: 5' HEX-CGCCCTGCCATGTGGAAGAT-BHQ1 3'; amplicon size: 81bp) and
`
`the SRY locus on chromosome Y (Forward: 5' CGCTTAACATAGCAGAAGCA 3';
`
`Reverse: 5' AGTTTCGAACTCTGGCACCT 3'; Probe: 5' FAM(cid:173)
`
`TGTCGCACTCTCCTTGTTTTTGACA-BHQ1 3'; amplicon size: 84bp) respectively. A
`
`Taqman assay targeting at DYS14 (Forward: 5' ATCGTCCATTTCCAGAATCA 3';
`
`Reverse: 5' GTTGACAGCCGTGGAATC 3'; Probe: 5' FAM(cid:173)
`
`TGCCACAGACTGAACTGAATGATTTTC-BHQ1 3'; amplicon size: 84bp), a multi(cid:173)
`
`copy locus on chromosome Y, was used for the initial determination of fetal sex from
`
`cell-free plasma DNA with traditional real-time PCR. PCR reactions were performed
`
`with 1x iQ Supermix (Bio-Rad), 0.1% Tween-20 (microfluidic digital PCR only), 300nM
`
`primers, and 150nM probes. The PCR thermal cycling protocol was 95C for 10 min,
`
`followed by 40 cycles of95C for 15s and 60C for 1 min. Primers and probes were
`
`purchased form IDT.
`
`Sequencing
`
`A total of 14 cell-free plasma DNA samples, including 13 from pregnant women and 1
`
`from a male blood donor, and genomic DNA sample from whole blood of the same male
`
`17
`
`
`
`donor, were sequenced on the Solexa/Illumina platform. ~2 to 8ng of DNA fragments
`
`extracted from 1.5 to 5.6ml cell-free plasma was used for sequencing library preparation
`
`(SI Table 1). Library preparation was carried out according to manufacturer's protocol
`
`with slight modifications. Because cell-free plasma DNA was fragmented in nature, no
`
`further fragmentation by nebulization or sonication was done on plasma DNA samples.
`
`Genomic DNA from male and female donor's whole blood was sonicated (Misonix XL-
`
`2020) (24 cycles of 30s sonication and 90s pause), yielding fragments with size between
`
`50 and 400bp, with a peak at 150bp. ~3ng of the sonicated genomic DNA was used for
`
`library preparation. Briefly, DNA samples were blunt ended and ligated to universal
`
`adaptors. The amount of adaptors used for ligation was 500 times less than written on the
`
`manufacturer's protocol. 18 cycles ofPCR were performed to enrich for fragments with
`
`adaptors using primers complementary to the adaptors. The size distributions of the
`
`sequencing libraries were analyzed with DNA 1000 Kit o