Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 1 of 62 PageID #: 31933
`
`The cold stress response in mammalian cells
`
`A. Roobol et al.
`
`Coomassie
`37°
`0 2 4 6 8 1012h
`
`27°
`0 2 4 6 8 1012 h
`
`lmmunoblot
`t0_5 > 12 h
`Grp75
`
`t0_5 > 12h
`
`hsp60
`
`'o.s = 10 h
`
`t0_5 > 12 h
`
`CCT8
`
`io.s = 7.1 h
`
`t0_5 > 12h
`
`Fig. 6. The half-life of proteins is increased upon exposure to mild
`cold stress. CHOK1 cells maintained at 37 or 27 °C were then
`exposed to growth medium containing 50 µg·ml- 1 cycloheximide.
`At the indicated times, cells were extracted, and 20 µg of protein
`was resolved by SOS/PAGE, and then detected either by Coomas(cid:173)
`sie stain (upper panel) or by probing immunoblots for the indicated
`proteins (lower panel). Molecular mass markers as in Fig. 4.
`
`a different mechanism from that involved during a
`'classical' recovery from heat shock, during which the
`inducible form of Hsp70 is robustly expressed.
`Transcription of inducible heat shock genes is acti(cid:173)
`vated by the binding of heat shock factors (HSFs) to
`heat shock elements
`in
`their promoter-proximal
`regions [18,19],
`the best understood being that of
`HSFl. In unstressed cells, HSFl exists as a constitu-
`
`Grp75
`
`hsc73
`
`hsp72
`
`hsp60
`
`CCT0
`
`37 6 h cold shock at 6 h cold shock at 1 h x 43
`4 10 20 27
`4 10 20 27
`then 37
`No recovery
`then 5 h x 37
`0.5 h 5 h
`
`Fig. 7. Marked changes in synthesis rate do not correlate with
`large changes in overall amounts of relatively abundant proteins.
`CHOK1 cells maintained at 37 °C, or exposed to the indicated tem(cid:173)
`perature changes, were extracted, and 20 µg of protein was
`resolved by SOS/PAGE and then detected by Coomassie stain (A)
`or by probing immunoblots for the indicated proteins (B).
`
`tively phosphorylated monomer in the cytoplasm, but
`during heat stress, HSFl undergoes trimerization [20]
`It is
`and becomes hyperphosphorylated [21].
`this
`hyperphosphorylated, trimeric form that accumulates
`in the nucleus and binds to heat shock elements,
`thereby activating transcription [21]. Figure 9B shows
`the basal level of constitutive phosphorylation of
`HSFl determined using immunoblots of HSFl in cell
`extracts prepared in the presence of protein phospha(cid:173)
`tase inhibitors (Fig. 9B, as a cluster of bands ~ 85-
`90 kDa). The hyperphosphorylation occurring during
`heat shock could also be
`readily demonstrated
`(Fig. 9B). Cold shock produced a much more subtle
`change in the HSFl banding pattern, evident immedi(cid:173)
`ately after cold shock and then slowly returning to the
`
`294
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation © 2008 FEBS
`
`GNE-HER_003001877
`
`Appx393
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 2 of 62 PageID #: 31934
`
`A. Roobol et al.
`
`The cold stress response in mammalian cells
`
`A
`
`hsc73
`
`0.1
`
`hsp60
`
`0.1
`
`ERp57
`
`0.1
`
`I
`
`.T
`
`i
`I
`
`lb 2h 4h 6h
`0
`Actinomycin D exposure time
`
`37° 27° csr csr
`lb Sh
`
`Fig. 8. Specific mRNAs are longer-lived at
`27 °C than at 37 °C. (A) CHOK1 cells main(cid:173)
`tained at 37 °C (squares) or 27 °C (dia(cid:173)
`monds) were then exposed to growth
`medium containing 2 µg·ml- 1 actinomy-
`cin D at the same temperatures. (B) CHOK1
`cells maintained at 37 °C or held at 27 °C
`for 6 h without or with a recovery period
`(crs, cold shock recovery) at 37 °C for 1 h or
`5 h. At the indicated times, total RNA was
`extracted from the cells and the indicated
`mRNAs were quantified by qRT-PCR. Data
`are normalized to the initial mRNA content
`at 37 or 27 °c.
`
`constitutive pattern during a subsequent 5 h recovery.
`This cold shock-induced phosphorylation change in
`HSFl was more pronounced with increasing hypother(cid:173)
`mia, and was most evident in the very cold-sensitive
`Pl9 cells.
`Trimerization was assessed by chemical cross-link(cid:173)
`ing analysis, using ethylene glycol bis(succinimidylsuc(cid:173)
`for SDS/PAGE
`cinate),
`to
`stabilize
`the
`trimer
`resolution prior to immunoblot detection of HSFl.
`Heat shock-induced trimerization of HSFl, i.e. the
`hyperthermic response, was extensive, so that imme(cid:173)
`diately after heat shock, almost all HSFl was in the
`hyperphosphorylated, trimeric form (Fig. 9C, lower
`panel). In contrast, little trimeric HSFl was evident
`immediately after cold (hypothermic) shock, and only
`modest amounts were present during recovery from
`
`this cold stress, even though the synthesis rates of
`constitutive heat shock proteins were increased at
`this time. Once again, although this response was
`stronger in the most cold-sensitive cell line, Pl9, it
`was still weak in comparison to that observed upon
`heat stress. These findings collectively suggest that
`the recovery from cold stress, at least in rodent cells,
`does not initiate a classical heat shock response, and
`that any response initiated through HSFl is com(cid:173)
`paratively weak or restricted in comparison to a
`classical heat shock response.
`
`Discussion
`
`Here we report changes in the cellular architecture,
`and the synthesis and degradation rates, of specific
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation© 2008 FEBS
`
`295
`
`GNE-HER_003001878
`
`Appx394
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 3 of 62 PageID #: 31935
`
`The cold stress response in mammalian cells
`
`A. Roobol et al.
`
`A
`
`Cold shock
`
`Heat shock
`
`CHOKl
`B
`37
`
`27
`
`12 h cold shock
`4-37
`27-37 27-37
`4
`4-37
`O.Sh Sh
`O.Sh Sh
`
`1 h heat shock
`43
`43-37 43-37
`lb O.Sh
`Sh
`
`CHOKl 6hCS
`C
`37
`4 4-37 4-37
`
`lhHS
`43 43-37 43-37
`
`P19
`37
`
`lhHS
`6hCS
`4 4-37 4-37 43 43-37 43-37
`
`Fig. 9. A classical heat shock response is
`not initiated upon recovery of cold-stressed
`cells at 37 °C. (A) Proteins extracted from
`CHOK1 cells that had been maintained at
`37 °C, or held at 27 °C for 6 h and then
`transferred to 37 °C for 5 h (cold shock
`recovery), or held at 43 °C for 1 h and then
`transferred to 37 °C for 5 h (heat shock
`recovery), and then radiolabelled for
`a further 1 h at 37 °C, were resolved and
`detected as in Fig. 5. Only the area includ(cid:173)
`ing Grp75 (spot 2) to actin (spot 14) is
`shown; the spot numbers refer to the pro(cid:173)
`teins listed in Table 2. Hsp72 is arrowed. (B)
`An immunoblot of proteins extracted from
`CHOK1 cells maintained at 37 °C, or held at
`4 or 27 °C for 12 h, or held at 43 °C for 1 h,
`with or without subsequent recovery at
`37 °C for 0.5 h or 5 h, probed for HSF1. (C)
`lmmunoblots of SOS/PAGE resolutions
`(upper panels) or of nondenaturing gel reso(cid:173)
`lutions (lower panels) of proteins extracted
`from CHOK1 and P19 cells maintained at
`37 °C, or held at 4 °C for 6 h, or held at
`43 °C for 1 h, with or without subsequent
`recovery at 37 °C for 0.5 h or 5 h, probed
`for HSF1. Trimerization of HSF1 upon rec(cid:173)
`overy from cold stress is indicated by an
`asterisk. CS, cold stress; HS, heat stress.
`
`proteins in mammalian cells subjected to both mild
`and severe cold stress, and during recovery from hypo(cid:173)
`thermic shock. Collectively, they help to define the
`specific cellular responses and protein players during
`cold stress and recovery. The changes identified here in
`the synthesis and turnover rates reveal that adapta(cid:173)
`tions are easy to miss when comparing total protein
`levels monitored either by densitometry-based studies
`(typically, global proteomic 'snapshot' studies) or by
`immunoblot. Our studies have shown that subphysio(cid:173)
`logical temperatures induce specific changes in synthe(cid:173)
`sis rates for proteins involved in a wide spectrum of
`cellular activities, including energy metabolism, cyto(cid:173)
`skeletal organization, protein synthesis, purine biosyn-
`
`thesis, secretion and, most particularly, molecular
`chaperone function.
`three
`Representative molecular chaperones from
`intracellular compartments, the cytoplasm, the mito(cid:173)
`chondrion, and the ER, were all detected as part of
`the adaptive changes of cells exposed to mild hypo(cid:173)
`thermia and, more especially, in cells recovering from
`this state. It is of particular interest that the synthesis
`rates of the cytoplasmic molecular chaperones Hsc73
`and HOP/p60, and of the ER chaperone ERp57, were
`increased upon cold stress at 27 °C but not at 32 °C.
`The strength of hydrophobic interactions decreases
`with decreasing temperature, and so higher orders of
`protein structure become less stable at subphysiological
`
`296
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation © 2008 FEBS
`
`GNE-HER_003001879
`
`Appx395
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 4 of 62 PageID #: 31936
`
`A. Roobol et al.
`
`The cold stress response in mammalian cells
`
`temperatures [22]. Thus, at 27 °C, this must become
`problematic and generate unfolding of existing proteins
`and/or compromise the folding of newly synthesized
`proteins, as appreciable protein synthesis is still taking
`place at this temperature. Furthermore, as protein
`degradation becomes undetectable at 27 °C, the cell
`responds to the unfolded protein load by increasing
`the synthesis of selected molecular chaperones
`to
`sequester unfolded proteins until more favourable con(cid:173)
`ditions, including revival of turnover apparatus, are
`restored.
`Rapid recovery of protein synthesis capacity upon
`rewarming after cold stress would be expected to
`increase
`the requirement for molecular chaperones
`involved in protein folding, particularly in the cyto(cid:173)
`plasm. However, we also observed increases in the
`synthesis rates of chaperones in the mitochondrion and
`the ER after restoration to normothermic conditions.
`This will undoubtedly be, in part, a response to the
`overall increase in protein synthesis activity, but the
`fact that two of these chaperones, Grp75 and ERp57,
`that
`the
`are
`redox-sensitive chaperones
`indicates
`resumption of metabolic activity upon rewarming
`increases the free radical load on the cell, as might be
`expected. As the synthesis of the mitochondrial chaper(cid:173)
`ones did not increase during cold shock at 27 °C, this
`further supports the idea that it is a change in the
`redox state upon rewarming that is the main stimulus
`for the increased synthesis rate of the mitochondrial
`chaperones during recovery from cold stress.
`During recovery from cold stress, we also detected
`increased synthesis of several constitutive heat shock
`proteins but not of the classical heat shock protein,
`inducible Hsp72. Kaneko et al. [23] also reported no
`increase in Hsp72 mRNA upon rewarming NIH 3T3
`cells from 32 to 37 °C. Earlier studies using human cell
`lines did detect increased amounts of Hsp72 upon rew(cid:173)
`arming after cold shock [16]. An explanation for this
`discrepancy is that in human cells, Hsp72 is constitu(cid:173)
`tively expressed, whereas in rodent cell lines it is
`strictly inducible [17]. It would appear, then, that the
`heat shock proteins induced during recovery from cold
`stress are the constitutive heat shock proteins, not the
`strictly inducible ones. Specifically with regard to heat
`shock protein induction, our findings show that the
`HSFl activation process during recovery from cold
`stress is different from that induced during the classical
`heat shock response. The degree of HSFl hyper(cid:173)
`phosphorylation varies from robust in the normal heat
`shock response to only a partial response as reported
`here for cold shock recovery, but also following expo(cid:173)
`sure to certain antimicrotubule drugs used in cancer
`chemotherapy [24]. Under these latter circumstances,
`
`not only HSFl hyperphosphorylation but also HSFl
`trimerization occurred at a reduced level, and only
`induction of the constitutive heat shock proteins
`Grp75 and Hsp60, not of inducible Hsp72, was
`detected.
`It is generally accepted that cold stress results in the
`attenuation of mRNA translation, although we show
`here that at mildly hypothermic temperatures (27 and
`37 °C), protein synthesis is active, although reduced,
`and that both the banding pattern and relative intensity
`of polypeptides synthesized at these lower temperatures
`remain very similar to those observed at 37 °C. Transla(cid:173)
`tion is a tightly controlled process, modulated greatly by
`the ( de )phosphorylation of key initiation and elongation
`factors. Previous studies have shown that mutant initia(cid:173)
`tion factors can elevate the effects of such a slowdown
`in mRNA translation upon cold stress [25]. Here, we
`observed that cold stress at 32 °C results in reduced
`levels of newly synthesized eIF3i, a subunit of initiation
`factor 3. Upon recovery, this is reversed and eIF3i levels
`are increased. Although eIF3i is essential for mRNA
`translation in vivo [26-28], it is not essential for the
`reconstruction of initiation complexes that can scan and
`find the AUG start codon [29]. Therefore, its role in vivo
`is likely to be related to regulation of initiation. Further(cid:173)
`more, overexpression of eIF3i has been shown to be
`associated with increased cell proliferation, an acceler(cid:173)
`ated cell cycle, and an increase in cell size, whereas the
`knockdown (by RNA interference) of eIF3i resulted in
`the reverse of these effects [30,31]. These opposing con(cid:173)
`sequences of eIF3i knockdown or overexpression are
`mirrored in
`the observations here of the cellular
`responses to cold stress at 32 °C and recovery, respec(cid:173)
`tively. It is therefore likely that eIF3i plays a pivotal role
`in directing cell growth and proliferation upon cold
`stress and subsequent recovery.
`It has been reported elsewhere that cells cultivated
`under mildly hypothermic conditions undergo cell cycle
`arrest, predominantly in G 1, but also in Gi/M [32], and
`it has recently been suggested that this is in part due to
`expression of the RNA-binding cold shock proteins Cirp
`and Rbm3, as their overexpression under normothermic
`conditions can lead to cell cycle arrest [9]. Previous
`reports, however, have shown that p53-deficient mam(cid:173)
`malian cells do not show cell cycle arrest at mildly hypo(cid:173)
`thermic temperatures [33,34], and that at 4--20 °C, p53
`induces p21 (WAFl) expression [34]. Our results sup(cid:173)
`port this mechanism of p53-mediated cell cycle arrest.
`p53 in CHOKl cells has a point mutation that confers
`unusual stability on this protein and prevents these cells
`undergoing a normal response to DNA damage, i.e.
`induction of p21 and consequent cell cycle arrest in G 1
`[15]. Nevertheless, during mild cold stress, we observed
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation© 2008 FEBS
`
`297
`
`GNE-HER_003001880
`
`Appx396
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 5 of 62 PageID #: 31937
`
`The cold stress response in mammalian cells
`
`A. Roobol et al.
`
`an increase in the level of p53 in CHOKl cells, a change
`in p53 isoform pattern due to post-translational modifi(cid:173)
`cation, and induction of p21 expression. Furthermore,
`re-entry of cells into the cell cycle upon return to normo(cid:173)
`thermic conditions could be mediated by the increased
`synthesis of Grp75 that we observed under these condi(cid:173)
`tions. Expression of Grp75 has a two-fold positive effect
`on cell cycle progression. When present in the cyto(cid:173)
`plasm, it sequesters p53 [35], thereby preventing entry
`into the nucleus and subsequent activation of p21 tran(cid:173)
`scription. Furthermore, p53 binding to the centrosome
`[36,37], which is inhibitory to centrosome duplication, is
`antagonized by Grp75 [38]. Additionally, Grp75 itself
`binds to the centrosome, thereby activating Mpsl pro(cid:173)
`tein kinase, the activity of which is essential for the initi(cid:173)
`ation of centrosome duplication [39]. Under this model,
`cell cycle arrest upon cold stress and then re-entry upon
`recovery is modulated and controlled via the balance
`ofp53 and Grp75 levels.
`Finally, our electron microscopy studies and Oil
`Red O staining show the presence of lipid-containing
`vesicle-type structures under conditions of severe cold
`stress. These vesicle-like structures may be the result of
`lipid material being secreted from the cell, or alterna(cid:173)
`tively, these vesicles may only be observed under severe
`cold stress because
`the membrane rigidity and/or
`membrane-associated cell functions are so severely
`compromised at very low temperatures that this results
`in the arrest of the vesicles before secretion, whereas at
`higher temperatures these are secreted efficiently and
`hence not observed. It is well known that cold stress
`results in membrane rearrangements [40], and changes
`in cellular lipids have been linked to the heat shock
`response in yeast [41]. More recent research has shown
`that changes in the lipid composition of the cell mem(cid:173)
`brane
`induce
`the phosphorylation of p53 by the
`ataxia-telangiectasia and Rad-3 related kinase [42],
`and we are now investigating whether cold stress(cid:173)
`induced cell cycle arrest is due to this ataxia-telangiec(cid:173)
`tasia and Rad-3 related kinase activation of the
`p53-p21 signalling pathway.
`In conclusion, we have here identified a number of
`mechanisms
`involved
`in
`the
`response of in vitro
`cultured mammalian cells to mild and severe cold
`stress, and in recovery from such stress. In addition to
`a global decrease in mRNA and protein turnover, the
`synthesis of specific proteins involved in regulating cell
`growth, proliferation and mRNA
`translation are
`upregulated or downregulated during cold stress and
`recovery. Furthermore, changes in the lipid composi(cid:173)
`tion of the cell may underpin these responses, espe(cid:173)
`cially upon severe cold stress. On the basis of the
`results presented here, we suggest that the cytoskele-
`
`ton, and the balance in the levels of p53, Grp75 and
`eIF3i, are likely to be of particular importance during
`the response to, and recovery from, cold stress that
`allows mammalian cells to survive and recover from
`low-temperature stress.
`
`Experimental procedures
`
`Cell lines, routine culture conditions, and
`treatment conditions
`
`CHOKl cells were sourced from the European Collection
`of Cell Cultures and P19 cells from P. Andrews, University
`of Sheffield, UK. Cells were
`routinely cultured
`in
`DMEM/F12 (Invitrogen, Paisley, UK) supplemented with
`200 mM L-glutamine, 500 µM glutamic acid, 500 µM aspara(cid:173)
`gine, 30 µM adenosine, 30 µM guanosine, 30 µM cytidine,
`30 µM uridine, 10 µM thymidine, 1 % nonessential amino
`acids (Invitrogen, Paisley, UK), and 10% (v/v) heat-inacti(cid:173)
`vated fetal bovine serum (PAA Laboratories Ltd, Yeovil,
`UK) at 37 °C in a 5% CO2 atmosphere. NIH 3T3 cells
`were also sourced from the European Collection of Cell
`Cultures and maintained as above, except that DMEM was
`used in place of DMEM/F12. For radiolabelling, the
`routine maintenance media were replaced with cysteine/
`methionine-deficient DMEM (Sigma-Aldrich, Poole, UK)
`supplemented with 10% (v/v) dialysed, heat-inactivated
`fetal bovine serum, 2 mM glutamine and 1770 kBq·mL- 1
`Pro-Mix L-[3 5S] cell labelling mix (GE Healthcare, Chalfont
`St Giles, UK), and then incubated for 1 h at the indicated
`temperature. Uptake and incorporation of the 35S-labelled
`amino acids was as previously described [43]. Cold shock
`was undertaken in routine medium for 6 h or 30 h at 4, 10,
`20, 27 and 32 °C in appropriately regulated incubators.
`Heat shock was also undertaken in the routine culture med(cid:173)
`ium for 1 h by flotation in a water bath at 43 °C. Treat(cid:173)
`ment of cells with the antimicrotubule drug nocodazole was
`performed in routine medium at 1-3 µg·mL- 1 for 2 h at
`37 °C. Recovery incubations were undertaken in routine
`culture medium at 37 °C for 0.5, 1.5 and 5 h. For the deter(cid:173)
`mination of mRNA half-lives, cells were incubated in
`routine culture medium containing 2 µg·mL- 1 actinomycin
`D. For protein half-life determinations, cells were incubated
`in routine culture medium containing 50 µg·mL- 1 cyclo(cid:173)
`heximide.
`
`Extraction of RNA and protein from cell pellets
`
`Total RNA was prepared from intact cells using the com(cid:173)
`mercially available RNeasy kit (Qiagen). Cell extracts for
`protein analyses were prepared by lysing cells into ice-cold
`extraction buffer [20 mM Hepes/NaOH, pH 7.2, containing
`100 mM NaCl, 1 % (w/v) Triton X-100, protease inhibitors
`(10 µL·mL- 1 leupeptin, 2 µg·mL- 1 pepstatin, 0.2 mM phen-
`
`298
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation © 2008 FEBS
`
`GNE-HER_003001881
`
`Appx397
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 6 of 62 PageID #: 31938
`
`A. Roobol et al.
`
`The cold stress response in mammalian cells
`
`ylmethanesulfonyl fluoride) and protein phosphatase inhibi(cid:173)
`tors (50 mM NaF, 1 mM activated Na3VO4)]. Cell lysates
`were then centrifuged at 16 000 g for 2 min at 4 °C, and
`the resulting supernatants were retained for further analy(cid:173)
`sis. For the determination and detection of HSFl trimer
`formation levels, cell extracts were cross-linked with ethyl(cid:173)
`ene glycol bis(succinimidylsuccinate) (Sigma) at room tem(cid:173)
`perature for 30 min, and
`then blocked with 50 mM
`Tris/HCl (pH 7.5) at room temperature for 15 min.
`
`Gel electrophoresis analysis of protein extracts
`
`For SDS/PAGE analysis, 10% separation gels were uti(cid:173)
`lized according to the procedure of Laemmli [44]. Prior to
`NEPHGE-SDS/PAGE, the proteins in cell extracts were
`precipitated overnight with four volumes of acetone at
`Following NEPHGE-SDS/PAGE,
`-20 °C.
`resolved
`proteins were detected by Coomassie staining and/or
`autoradiography using Hyperfilm MP (GE). Gel images
`were
`analysed
`using
`the
`commercially
`available
`PROGENESIS PG200 software package (Nonlinear Dynam(cid:173)
`ics, Newcastle-upon-Tyne, UK) to determine spots that
`had changed in abundance. Spot detection was under(cid:173)
`taken using the spot detection wizard with the parameters
`set as follows: minimum spot area, 16; split factor, 7;
`peak location, use centre of mass as peak. Manual split(cid:173)
`ting of nonsplit spots and deletion of noise were then
`undertaken. Following spot detection, background sub(cid:173)
`traction was achieved using the mode of nonspot option
`with a margin of 45. In-gel tryptic digestion of excised
`spots and protein identification by MALDI-TOF MS were
`undertaken according to Smales et al. [45]. Analysis was
`undertaken on
`triplicate biological samples, and only
`spots whose abundance was changed at the 95% confi(cid:173)
`dence level (P < 0.05) relative to the 37 °C control were
`considered to show significant changes in polypeptide syn(cid:173)
`thesis rates.
`
`Determination of mRNA levels by qRT-PCR
`
`qRT-PCR was used to determine the relative mRNA levels
`of target genes using the commercially available BioRad
`iScript qRT-PCR kit according
`to
`the manufacturer's
`instructions, and the appropriate primers to amplify CHO
`sequences as listed in Table 2. All reactions were performed
`using a BioRad DNA Engine Chromo4 Continuous Fluo(cid:173)
`rescence Detector thermocycler (BioRad, Heme! Hemp(cid:173)
`stead, UK). Cycling conditions
`included a
`reverse
`transcription step by incubation at 50 °C for 20 min,
`followed by heating at 95 °C for 15 min. Sequentially, the
`target templates were amplified using 39 cycles (30 s at
`98 °C, 15 sat 55 °C). The fluorescence threshold value (Ct)
`was calculated using OPTICON MONITOR software (version
`3.1; BioRad). For normalization purposes, all levels were
`normalized to control levels at 3 7 °C.
`
`Table 2. Primers used for qRT-PCR experiments described in this
`article.
`
`Name
`
`Hsc73F
`Hsc73R
`Hsp60F
`Hsp60R
`ERp57F
`ERp57R
`
`Sequence (5'- to -3')
`
`CGACAAGAAGGACATCAGCGAG
`GAATCGAGCACGGGTAATGGAG
`TGCTCATCGTAAGCCCTTGGTC
`TTCTCCAAACACCGCACCAC
`AACTACAGATTTGCACACACC
`CAGTATATACCACAGTTTTGTC
`
`lmmunoblot analysis
`
`PAGE-resolved polypeptides were transferred to nitrocel(cid:173)
`lulose using standard procedures, and then blocked with
`5% (w/v) nonfat milk in NaCVP; or for phosphoryla(cid:173)
`tion-dependent epitopes in 0.2% (w/v) Tween-20. Anti(cid:173)
`body probes against Ol-tubulin
`(TAT) and ~-tubulin
`(KMX)
`[46] were gifts
`from K. Gull
`(University of
`Oxford, UK), and the antibody 23c against STOP [13]
`was a gift from C. Bose and D. Job (Commisariat A
`L'Energie Atomique, Grenoble, France). Affinity-purified
`rabbit polyclonal antibodies against
`the C-termini of
`CCT subunits and against Hsc70 were as described
`[47]. Commercial antibodies against Grp75
`elsewhere
`(clone 30A5), Hsp60
`(clone LK-2) and HSFl
`(rabbit
`polyclonal) were from Stressgen, antibody against p53
`(clone DO-7) was from Dako, and antibody against p21
`was from Santa Cruz Biotechnology (Santa Cruz, CA,
`USA). Peroxidase-conjugated secondary antibodies were
`detected by enhanced chemiluminescence using Hyper(cid:173)
`film ECL (GE). Images were analysed using KODAK GEL
`LOGIC 100
`imaging system software. The
`linearity of
`antibody response over the concentration range of target
`protein used is shown in Fig. S4.
`
`lmmunofluorescence microscopy
`
`For immunofluorescence microscopy studies, cells were
`grown on 13 mm glass coverslips and then fixed with
`methanol at -20 °C
`for 5 min, or with 4%
`(w/v)
`paraformaldehyde in NaCVP;; this was followed by per(cid:173)
`meabilization with 0.1 % (w/v) Triton X-100 in NaCVP;.
`Cells were rehydrated after methanol fixation for 5 min
`m NaCVP;. All coverslips were
`then blocked
`for
`15-30 min in 3% (w/v) BSA in NaCVP;. Incubation with
`primary antibodies diluted in blocking solution (TAT,
`1 : 100; anti-hsp60, 1 : 100) was performed overnight at
`4 °C. The appropriate secondary antibodies (anti-mouse
`tetramethyl
`rhodamine
`iso-thiocyanate; Sigma) were
`diluted 1 : 100 before use. F-actin staining with rhoda(cid:173)
`mine-phalloidin (Molecular Probes, Invitrogen, Paisley,
`UK) was achieved according
`to
`the manufacturer's
`instructions. Cells were counterstained with 4',6-diamidi(cid:173)
`no-2-phenylindole, and coverslips were then mounted in
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation© 2008 FEBS
`
`299
`
`GNE-HER_003001882
`
`Appx398
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 7 of 62 PageID #: 31939
`
`The cold stress response in mammalian cells
`
`A. Roobol et al.
`
`Mowiol containing p-phenylenediamine as antifade. Cells
`were then examined under a Leica DMR fluorescence
`microscope, and
`images were captured with a Leica
`DC300F digital camera.
`
`Electron microscopy
`
`For electron microscopy cells, were grown at 37 °C or m
`the cold as described, and then fixed with 2.5% glutaralde(cid:173)
`hyde in NaCVP;, postfixed with 1 % osmium tetroxide, and
`dehydrated with a graded series of alcohols. After two
`changes of 100% ethanol, they were detached from the
`flasks by agitation in ethoxypropane, and then embedded in
`Agar Low Viscosity Resin. Sections were cut at 60-90 nm,
`stained with uranyl acetate and lead citrate, and examined
`in a Jeol 1230 transmission electron microscope (Jeol UK,
`Welwyn Garden City, UK) operating at 80 kV. Images
`were recorded with a Gatan Multiscan 600CW camera
`(Gatan UK, Oxford, UK).
`
`Acknowledgements
`
`supported by Grants
`This work was partially
`BB/C006569/l and BB/F018908/l from the Biotech(cid:173)
`nology and Biological Sciences Research Council
`(BBSRC), UK.
`
`References
`
`Al-Fageeh MB, Marchant RJ, Carden MJ & Smales
`CM (2006) The cold-shock response in cultured mam(cid:173)
`malian cells: harnessing the response for the improve(cid:173)
`ment of recombinant protein production. Biotechnol
`Bioeng 93, 829-835.
`2 Ermolenko DN & Makhatadze GI (2002) Bacterial
`cold-shock proteins. Cell Mol Life Sci 59, 1902-1913.
`3 Al-Fageeh MB & Smales CM (2006) Control and regu(cid:173)
`lation of the cellular responses to cold shock: the
`responses in yeast and mammalian systems. Biochem J
`397, 247-259.
`4 Sanna LA, Fujita J, Gaffin SL & Lilly CM (2002)
`Effects of heat and cold stress on mammalian gene
`expression. J Appl Physiol 92, 1725-17 42.
`5 Danna S, Nishiyama H, Higashitsuji H, Y okoi H, Xue
`JH, Itoh K, Matsuda T & Fujita J (1997) Increased
`transcript level of RBM3, a member of the glycine-rich
`RNA-binding protein family, in human cells in response
`to cold stress. Biochem Biophys Res Commun 236, 804-
`807.
`6 Nishiyama H, Higashitsuji H, Y okoi H, Itoh K, Danna
`S, Matsuda T & Fujita J (1997) Cloning and character(cid:173)
`ization of human CIRP (cold-inducible RNA-binding
`protein) cDNA and chromosomal assignment of the
`gene. Gene 204, 115-120.
`
`7 Dresios J, Aschrafi A, Owens GC, Vanderklish PW,
`Edelman GM & Mauro VP (2005) Cold stress-induced
`protein Rbm3 binds 60S ribosomal subunits, alters
`microRNA levels, and enhances global protein synthe(cid:173)
`sis. Proc Natl Acad Sci USA 102, 1865-1870.
`8 Marchant RJ, Al-Fageeh MB, Underhill MF, Racher
`AJ & Smales CM (2008) Metabolic rates, growth phase,
`and mRNA levels influence cell-specific antibody pro(cid:173)
`duction levels from in vitro-cultured mammalian cells
`at sub-physiological temperatures. Mol Biotechnol 39,
`69-77.
`9 Nishiyama H, Itoh K, Kaneko Y, Kishishita M, Yosh(cid:173)
`ida O & Fujita J (1997) A glycine-rich RNA-binding
`protein mediating cold-inducible suppression of mam(cid:173)
`malian cell growth. J Cell Biol 137, 899-908.
`10 De Brabander M, Geuens G, Nuydens R, Willebrords
`R, Aerts F & De Mey J (1986) Microtubule dynamics
`during the cell cycle: the effects of taxol and nocodazole
`on the microtubule system of Pt K2 cells at
`different stages of the mitotic cycle. Int Rev Cytol 101,
`215-274.
`11 Novakova M, Draberova E, Schurmann W, Czihak G,
`Viklicky V & Draber P (1996) Gamma-tubulin redistri(cid:173)
`bution in taxol-treated mitotic cells probed by monoclo(cid:173)
`nal antibodies. Cell Motil Cytoskeleton 33, 38-51.
`12 Denarier E, Fourest-Lieuvin A, Bose C, Pirollet F, Cha(cid:173)
`pel A, Margolis RL & Job D (1998) Nonneuronal iso(cid:173)
`forms of STOP protein are responsible for microtubule
`cold stability in mammalian fibroblasts. Proc Natl Acad
`Sci USA 95, 6055-6060.
`13 Galiano MR, Bose C, Schweitzer A, Andrieux A, Job
`D & Hallak ME (2004) Astrocytes and oligodendro(cid:173)
`cytes express different STOP protein isoforms. J Neuro(cid:173)
`sci Res 78, 329-337.
`14 Guillard L, Bose C, Fourest-Lieuvin A, Denarier E,
`Pirollet F, Lanfanechere L & Job D (1998) Stop pro(cid:173)
`teins are responsible for the high degree of microtubule
`stability observed in neuronal cells. J Cell Biol 142,
`167-179.
`15 Hu T, Miller CM, Ridder GM & Aardema MJ (1999)
`Characterization of p53 in Chinese hamster cell lines
`CHO-Kl, CHO-WBL, and CHL: implications for
`genotoxicity testing. Mutat Res 426, 51-62.
`16 Liu A Y-C, Bian H, Huang E & Lee YK (1994) Tran(cid:173)
`sient cold shock induces the heat shock response upon
`recovery at 37 °C in human cells. J Biol Chem 269,
`14768-14775.
`17 Brown CR, Martin RL, Hansen WJ, BecKmann RP &
`Welch WJ (1993) The constitutive and stress inducible
`forms of hsp70 exhibit functional similarities and inter(cid:173)
`act with one another in an ATP-dependent fashion.
`J Cell Biol 120, 1101-1112.
`18 Abravaya K, Myers MP, Murphy SP & Morimoto MI
`(1992) The human heat shock protein hsp70 interacts
`
`300
`
`FEBS Journal 276 (2009) 286-302 © 2008 The Authors Journal compilation © 2008 FEBS
`
`GNE-HER_003001883
`
`Appx399
`
`

`

`Case 1:18-cv-00924-CFC Document 418-2 Filed 10/14/19 Page 8 of 62 PageID #: 31940
`
`A. Roobol et al.
`
`The cold stress response in mammalian cells
`
`with HSF, the transcription factor that regulates heat
`shock gene expression. Genes Dev 6, 1153-1164.
`19 Morimoto RI (1998) Regulation of the heat shock tran(cid:173)
`scriptional response: cross talk between a family of heat
`shock factors, molecular chaperones, and negative regu(cid:173)
`lators. Genes Dev 12, 3788-3796.
`20 Sarge KD, Murphy SP & Morimoto RI (1993) Activa(cid:173)
`tion of heat shock gene transcription by heat shock
`factor 1 involves oligomerisation, acquisition of DNA(cid:173)
`binding activity, and nuclear localization and can
`occur in the absence of stress. Mol Cell Biol 13, 1392-
`1407.
`21 Cotto JJ, Kline M & Morimoto M (1996) Activation of
`heat shock factor 1 DNA binding precedes stress(cid:173)
`induced serine phosphorylation. J Biol Chem 271, 3355-
`3358.
`22 Lopez CF, Darst RK & Rossky PJ (2008) Mechanistic
`elements of protein cold denaturation. J Phys Chem B
`112, 5961-5967.
`23 Kaneko Y, Nishiyama H, Nonoguchi K, Higashitsuji
`H, Kishishita M & Fugita J (1997) A novel h