Vol. 12 Suppl. 1, October 2002
`'N LJromuscular disorders : NMD.
`'o~P _ General Collection
`W1 NE337GB
`11 _ 12, suppl. 1
`;Qc;t- 2002
`
`.
`
`. .
`
`12 (Suppl. 1) S1-S174
`ISSN 0960-8966
`
`.
`
`·.~®{[lCT®[]](]]~@(]]DOOIT··
`
`.
`
`'
`
`'.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`.
`
`·-, ·
`
`. i
`
`.
`
`.
`
`, _ • . ,,
`
`'
`
`.
`
`.
`
`.
`
`Supplement
`ENMC CENTENNIAL WORKSHOP ON THERAPEUTIC
`POSSIBILITIES IN DUCHENNE MUSCULAR DYSTROPHY
`Naarden, The Netherlands, 30 November-2 December, 2001
`Guest Editor: V Dubowitz
`
`Editor-in-Chief
`V Dubowitz UK
`Associate Editors
`AG Engel USA
`E P Hoffman USA
`L Merlini Italy
`F M S Tome France
`
`(
`
`N
`
`°' M
`'° "-
`"-
`00
`00
`
`PERGAMON
`
`Th ismateri~~f~1 J
`0Urna1
`3 tthe NU.,.,andmayli-e
`Seu,bjectUSCop,yrightLaws
`
`Of thA \l\t-~1...1 1111 .. -
`
`- • -
`
`""'
`
`

`

`© 2002, Elsevier Science 13.V. All rights reserved
`This journal and the individual contributions contained in it arc protected under copyright by Elsevier Science ll.V., and the following terms
`and conditions apply to their use:
`Photocopyini.:
`Single photocopies of single articles may be made for personal use as allowed by national copyright laws. Permission of the Publisher and
`payment of a fee is required for all other photocopying, including multiple or systematic copying, copying for advertising or promotional
`purposes, resale, and all forms of document delivery. Special rates arc available for educational institutions that wish to make photocopies for
`non-profit educational classroom use.
`Permissions may be sought directly from Elsevier Science via their homepage (http://www.clscvier.com) by selecting "Customer support"
`and then "Permissions". Alternatively you can send an e-mail to: pcrmissions@clsevier.co.uk, or fax to: ( +44) 1865 853333.
`In the USA, users may clear permissions and make payment through the Copyright Clearance Center, Inc., 222 Rosewood Drive, Danvers,
`MA 0 I 923, USA; phone: (+I) (978) 7508400, fax: (+I) (978) 7504744, and in the UK through the Copyright Licensing Agency Rapid
`Clearance Service (CLARCS), 90 Tottenham Court Road, London WI P OLP, UK; phone: ( +44) 20 7631 5555; fax: ( + 44) 20 7631 5500.
`Other countries may have a local rcprographic rights agency for payments.
`Deriv:itive Works
`Subscribers may reproduce tables or contents or prepare lists of articles including abstracts for internal circulation within their institutions.
`Permission of the Publisher is required for resale or distribution outside the institution.
`Permission of the Publisher is required for all other derivative works, including compilations and translations.
`Electronic Storage or Usage
`Permission of the Publisher is required to store or use electronically any material contained in this journal, including any article or part of an
`article.
`
`Except as outlined above, no part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any
`means, electronic, mechanical, photocopying, recording or otherwise, without prior written permission of the Publisher.
`Address permissions requests to: Elsevier Science Global Rights Department, at the mail, fax and e-mail addresses noted above.
`Notice
`No responsibility is assumed hy the Publisher for any injury and/or damage to persons or property as a mallcr or products liability, negligence
`or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because or rapid
`advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made.
`Although all advertising material is expected to conform to ethical (medical) standards, inclusion in this publication docs not constitute a
`guarantee or endorsement of the quality or value of such product or of the claims made of it by its manufocturcr.
`@ The paper used in this publication meets the requirements of ANSI/NISO Z39.48- I 992 (Permanence of Paper).
`Printed in The United Kingdom
`
`Author enquiries
`ror enquiries relating to tht: suh111ission of aniclcs (including electronic submission), the status or accepted articles through our Online
`Article Status Information Systt:111 (( >ASISJ, author Frequt:ntly Asked ()uestions and any other enquiries relating to Elsevier Science, please
`consul I http://www.clscvicr.c<H11/I< ,catd;u1th1 ,rs/
`For specific enquiries rn1 thc prcparatio11 of ckctrnnic artwork, co11s11l1 http://www.elscvicr.com/locatc/authorartwork/
`Contact details for questirn1s arising ;din mTcpt;111ce or a11 :11ticlt:, especially thost: relating to proofs, arc provided when an article is accepted
`for publication.
`
`

`

`([)
`Neuromuscular
`Disorders
`
`Editor-in-Chief
`V Dubowitz
`
`Volume 12 Supplement 1 (2002)
`
`Therapeutic Possibilities in Duchenne Muscular Dystrophy
`
`Proceedings of the Special Centennial International ENMC Workshop
`
`Naarden, The Netherlands, 30 November-2 December 2001
`
`Guest Editor:
`
`Victor Dubowitz
`
`PERGAMON
`
`

`

`Neuromuscular Disorders
`October 2002
`Volume 12 Suppl. 1
`Cited in: Current Contents/Life Sciences, Elsevier BIOBASE/Current Awareness in Biological Sciences,
`Index Medicus, MEDLINE, Neuroscience Citation Index, Reference Update, Research Alert,
`Science Citation Index, SciSearch
`
`S61
`
`S67
`
`CONTENTS
`
`Foreword
`V. Dubowitz
`Myoblast transplantation
`T. Partridge
`Myogenic stem cells from the bone marrow: a
`therapeutic alternative for muscular dystro(cid:173)
`phy?
`G. Ferrari, F. Mavilio
`Gene transfer studies in animals: what do they
`really tell us about the prospects for gene
`therapy in DMD?
`D.J. Wells, K.E. Wells
`Viral vectors for gene transfer of micro-, mini-,
`or full-length dystrophin
`J.M. Scott, S. Li, S.Q. Harper, R. Welikson,
`D. Bourque, C. DelloRusso, S.D. Hauschka,
`J.S. Chamberlain
`Strategies for muscle-specific targeting of
`adenoviral gene transfer vectors
`C. Thirion, N. Larochelle, C. Volpers, P. Dunant,
`R. Stucka, P. Holland, J. Nalbantoglu,
`s. Kochanek, H. Lochmuller
`Recombinant micro-genes and dystrophin
`viral vectors
`G. Dickson, M.L. Roberts, D.J. Wells, S.A. Fabb
`Current protocol of a research phase I clinical
`trial of full-length dystrophin plasmid DNA in
`Duchenne/Becker muscular dystrophies
`Part II: clinical protocol
`N.B. Romero, 0 . Benveniste, C. Payan, S. Braun,
`P. Squiban, S. Herson, M. Fardeau
`Current protocol of a research phase I clinical
`trial of full-length dystrophin plasmid DNA in
`Duchenne/Becker muscular dystrophies
`Part I: rationale
`C. Thioudellet, S. Blot, P. Squiban, M. Fardeau,
`S. Braun
`
`Current protocol of a research phase I clinical
`trial of full-length dystrophin plasmid DNA in
`Duchenne/Becker muscular dystrophies
`Part Ill. Ethical considerations
`M. Fardeau
`
`S1
`
`S3
`
`S7
`
`S11
`
`S23
`
`S30
`
`S40
`
`S45
`
`S49
`
`S52
`
`Oligonucleotide-mediated gene therapy for
`muscular dystrophies
`T.A. Rando
`
`S55
`
`CD45 fraction bone marrow cells as potential
`delivery vehicles for genetically corrected
`dystrophin loci
`R.M .I. Kapsa, S.H.A. Wong, I. Bertoncello,
`A.F. Quigley, B. Williams, K. Sells, R. Marotta,
`M. Kita, P. Simmons, E. Byrne, A.J . Kornberg
`Screening for antisense modulation of dystro(cid:173)
`phin pre-mRNA splicing
`G. Dickson, V. Hill, I.R. Graham
`Targeted exon skipping as a potential gene
`correction therapy for Duchenne muscular
`dystrophy
`A. Aartsma-Rus, M. Bremmer-Bout,
`A.A.M. Janson, J.T. den Dunnen,
`G.-J.B. van Ommen, J.C.T. van Deutekom
`The role of utrophin in the potential therapy of
`Duchenne muscular dystrophy
`K.J. Perkins, K.E. Davies
`functional
`the
`Multivariate evaluation of
`recovery obtained by the overexpression of
`in skeletal muscles of the mdx
`utrophin
`mouse
`J.-M. Gillis
`Glucocorticoid-mediated regulation of utro(cid:173)
`phin levels in human muscle fibers
`I. Courdier-Fruh, L. Barman, A. Briguet, T. Meier
`Dystrophin and functionally related proteins
`in the nematode Caenorhabditis e/egans
`I t
`L S ·
`. ega a
`Dystrobrevin dynamics in muscle-~e_ll signal(cid:173)
`ling: a possible target for therapeutic interven(cid:173)
`tion in Duchenne muscular dystrophy?
`D.J. Blake
`Expression profiling in stably re~~nerating
`skeletal muscle of dystrophin-def1c1ent mdx
`mice
`J.M. Boer, E.J. de Meijer, E.M. Mank,
`G.B. van Ommen, J.T. den Dunnen
`e of
`· t
`A web-accessible complete transcnp om
`normal human and DMD muscle
`M. Bakay, P. Zhao, J. Chen, E.P. Hoffman
`in Duchenne dystrophy:
`Pre-clinical trials
`what animal models can tell us about potential
`drug effectiveness
`A. De Luca, S. Pierno, A. Liantonio, D. Conte
`Camerino
`
`S71
`
`S78
`
`S90
`
`S95
`
`S105
`
`S110
`
`S118
`
`S125
`
`S142
`
`

`

`Collaborative translational research leading
`in Duchenne
`to multicenter clinical trials
`muscular dystrophy: the Cooperative Interna(cid:173)
`tional Neuromuscular Research Group
`(CINRG)
`D.M. Escolar, E.K. Henricson, L. Pasquali,
`K. Gorni, E.P. Hoffman
`Pharmacological control of cellular calcium
`handling in dystrophic skeletal muscle
`U.T. Ruegg, V. Nicolas-Metral, C. Challet,
`K. Bernard-Helary, O.M. Dorchies, S. Wagner,
`T.M. Buetler
`
`S147
`
`S155
`
`Steroids in Duchenne muscular dystrophy:
`from clinical trials to genomic research
`F. Muntoni, I. Fisher, J.E. Morgan, D. Abraham S162
`Considerations to the policy of future clinical
`therapeutic trials in DMD
`B. Reitter
`
`S166
`
`An effective, low-dosage, intermittent sche-
`dule of prednisolone in the long-term treat(cid:173)
`ment of early cases of Duchenne dystrophy
`M. Kinali, E. Mercuri , M. Main, F. Muntoni,
`V. Dubowitz
`
`S169
`
`

`

`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`PERGAMON
`
`Ncurn11n1scular Disorders 12 (2002) S7 I-S77
`
`<15
`
`www.clscvicr.co111/locatc/n111d
`
`Targeted exon skipping as a potential gene correction therapy for
`Duchenne 1nuscular dystrophy
`Anncmieke Aartsma-Rus, Mattie Bremmer-Bout, Anneke A.M. Janson, Johan T. den Dunnen,
`Gert-Jan B. van Ommen, Judith C.T. van Deutekom*
`lhp11r1111e111 <f llu11w11 Gcneti,·s. /,cidl'11 /J11il'cr.\·i1_1• Medirnl Cr·nler, IV11s.\'l'11twrseH'eg 72, 2333 ;\L /.eide11, '/'he Netlll'rl<111tl.1·
`
`Abstract
`Duchenne muscular dystrophy is primarily caused by frame-disrupting mutations in the Duchenne 111uscular dystrophy gene which abort
`dyst rophin synthesis. We have explored a gene correction therapy aimed at restoration of the reading frame in Duchcnne muscular dystrophy
`patients. Through the binding of antisense oligoribonucleotides to ex on-internal sequences in the pre-mRNA, the splicing can be manipulated
`in such a manner that the targeted cxon is skipped and a slightly shorter, but in-frame, transcript is generated. We recently showed that
`anlisense oligoribonuclcotidc-mediated skipping of exon 46 efficiently induced dystrophin synthesis in cultured muscle cells from Duchenne
`muscular dystrophy patients carrying an cxon 45 deletion. In this study we have identified antisense oligoribonucleotides with which the
`skipping of 11 other Duchennc muscular dystrophy exons could be induced in cultured human 111usclc cells. The targeted skipping of only
`one particular exon may restore the reading frame in a series of patients with different mutations. Accordingly, these antisense oligoriho(cid:173)
`nucleotides would allow correction of over 50% of deletions and 22% of duplications reported in the Leiden DMD-mutation Database.
`© 2002 Elsevier Science B.V. /\II rights reserved.
`Keyll'!,rd.,·: Dud1c11m: muscular dystrophy: Gene correction thnapy; /\ntisensc oligorihonuclcotidc; Exon skipping
`
`I. Introduction
`
`Duchcnnc muscular dystrophy (DMD) is predominantly
`caused by mutations in the DMD gene that disrupt the open
`reading frame of the transcript 11-31. Consequently, the
`translation of the transcript into the dystrophin protein is
`aborted. Since dystrophin plays an important role in the
`muscle fiber's structure and function f l,4-7J, dystrophin
`deficiency leads to a severe and progressive muscle degen(cid:173)
`to premature death of DMD
`eration and, eventually,
`patients.
`Many gene therapy studies on DMD have focused on the
`gene addition strategy aiming to introduce into the patient's
`muscle tissue a cloned DMD coding sequence that can
`replace the function of the original defective DMD gene.
`However, the various gene delivery systems using either
`viral or non-viral vectors, have, notwithstanding the chal(cid:173)
`lenge of the large size of the coding sequence ( 11 kb), only
`been modestly capable of transducing sufficient muscle
`fibers for long time-periods 18]. Therel<ire, other strategies,
`such as pharmacological therapy or gene correction, have
`recently gained increasing allention. We have been studying
`
`* Corresponding author. Tel.: + 31-71-527-6080: fax: +31-71-527-(1075.
`f:'-11111i/ 11ddrl's.1·: dculckom(a11umc.nl (J.C:r. van Dcutckom).
`0%0-8%(1/()2/$ - SL'L' front matter 10 2002 Elsevier Science.: 11.V. /\II rights reserved.
`I'll: S0%0-8%(1(02)0008(1-X
`
`the feasibility of targeted exon skipping lo modulate the
`splicing of the DMD gene in such a manner that the transla(cid:173)
`tional open reading frame is restored in muscle cells from
`DMD patients. Theoretically, this may be therapeutically
`applicable to the majority of DMD mutations. In case of
`deletions, exon skipping would result in slightly shorter,
`but in-frame, transcripts, similar to those found in the corre(cid:173)
`sponding Becker muscular dystrophy (BMD) patients,
`longer life
`having milder phenotypes and signilicantly
`expectancies when compared to DMD patients 12,3 \. Exon
`skipping in DMD patients carrying single cxon duplications
`should be even more effective, because of the double target
`dosage and the generation of a true wild-type dystrophin as
`the product resulting from skipping one of the two exons.
`Finally, point mutations in any of the 'in-frame' cxons in the
`DMD gene may also be bypassed by single exon skipping,
`inducing a small in-frame cxon deletion which is often asso(cid:173)
`ciated with a Becker-like dystrophin protein.
`The mechanism of cxon skipping is based upon antisensc
`oligoribonucleotides (AONs), small synthetic RNA mole(cid:173)
`cules that can bind to spccilic sequences within the DMD
`pre-mRNA I 9-121. Several studies have shown the reasibi 1-
`ity of AON-mediated exon skipping by targeting sequences
`involved in the splicing process. In muscle cells of the nulx
`mouse, a DMD mouse model carrying a nonsense mutation
`
`

`

`S72
`
`lee (Belgium) or by lsogcn Bioscience BY (The Nether(cid:173)
`lands).
`
`0
`
`•
`
`0
`
`2. Materials and methods
`
`2.1. A ON.1· and 11ri111cr.1·
`
`A series of AONs (two per cxon. sec Table I) was
`designed to hind to exon-inlcrnal target sequences showing
`a relatively high purine-content and, prcf'crahly, an open
`secondary pre-mRNA structure (al 37 °C), as predicted by
`the RNA mfold version 3.1 server 122]. The AONs varied in
`length between 15 and 24 bp, with G/C contents between 26
`and 67%. They were synthesized with the following chemi(cid:173)
`cal modifications: a 5 1-fluorcscein group (6-rAM), a full(cid:173)
`length phosphorothioate backbone and 21-O-mcthyl modi(cid:173)
`fied ribosc molecules (Eurogentec, Belgium). The primers
`used for reverse transcription-polymerase chain reaction
`(RT- PCR) analysis (Table 2) were synthesized by Eurogcn-
`
`A. 1\11rt.1m11-Rw et 11/. I Ne11m11111srn/11r l>i.wrders 12 /2002) S7!-S77
`in exon 23 I 131, AONs directed lo the 3' or 5' splice sites
`induced cxon 23 skipping and so restored the rcadino frame
`to therapeutic levels 114-161. However, these splice site-
`specific AONs also caused less predictable skipping of mldi(cid:173)
`tional, adjacent exons. As this may be explained by non(cid:173)
`specific interference with the splicing machinery, splice
`sites may be less optimal targets for AON-mediated cxon
`skipping. In another study [17,181, the skipping of cxon 19
`was specifically induced in human muscle cells, usino
`AONs directed to an cxon-intcrnal sequence that wa:
`considered to be a splicing enhancer sequence 119,201.
`Similarly, we showed specific exon 46 skipping in mouse
`and human muscle cells using cxon-intcrnal AONs. These
`AONs targeted a sequence in exon 46 with a relatively hioh
`purine-content, that was predicted to have an open, acces-
`sible, secondary RNA structure, and, by resembling an cxon
`recognition site r I 9,20 I, was suggested to be involved in the
`splicing process. Following transfection of these AONs into
`muscle cells from two unrelated Duchcnnc patients affected
`by an exon 45 deletion, the interrupted open reading frame
`was corrected and the synthesis of a slightly shorter dystro(cid:173)
`phin induced in at least 75% of treated muscle cells [21 ].
`Based on the fact that there are more mildly affected Becker
`dystrophy patients with a deletion of both exons 45 and 46,
`this shorter protein is expected lo be largely functional.
`In this follow-up study, we further tested the in vitro
`feasibility of exon skipping using AONs directed to cxon(cid:173)
`internal sequences. The skipping of a single exon from a
`normal mature mRNA generates either an out-of-frame or
`an in-frame transcript. We designed and tested a series of'
`AONs directed to eight out-of-frame cxons (cxons 2, 43, 44,
`45, 46, 50, 51 and 53) and seven in-frame cxons (cxons 29,
`40, 41, 42, 47, 48, and 4')). Skipping of these cxons would
`correct the majority of the most frequently occurring Duch(cid:173)
`enne deletions (> (,0%) and d11plicat ions ( /22<ft, ). and
`various DMD-causing point nHllalions. The efficacy of the
`AONs and, hence, the 'skipahilily' of the targeted cxons was
`analyzed in cultured hu111an 111yo1uhes.
`
`2.2. !11 vitro experi11u'11/s
`
`Primary human myoblasts were isolated from a muscle
`biopsy from a non-affected individual (KM 108) by enzy(cid:173)
`matic dissociation. Briefly, the tissue was homogenized in
`a solution containing 5 mg/ml collagcnase type VIII
`(Sigma), 5 mg/ml bovine albumin fraction V (Sigma), 1 r;;,
`trypsin (Gibco BRL) in Pl3S (Gibco BRL). Following serial
`incubation steps or 15 min al 37 °C, suspensions containing
`the dissociated cells were added to, and pooled in, an equal
`volume of proliferation medium (Nut.Mix r- lO (HAM)
`with GlutaMax-1, Gibco BRL) supplemented with 20%
`fetal bovine scrum (Gibco BRL) and f <¼, penicillin/strepto(cid:173)
`mycin solution (Gibco BRL). After centrifugation, the cells
`were plated and further cultured in proliferation medium,
`using flasks that were pre-coated with purified bovine
`dermal collagen (Yitrogcn I 00; Cohesion). The myogenic
`cell content of the culture, as determined by the percentage
`or dcsmin-positivc cells in an immunohistochcmical assay,
`was improved to 58% by repetitive prcplating 123 I.
`Myotubes were obtained from confluent myoblast cultures
`following 7-14 days of incubation in low-scrum medium
`(DMEM (Gibco BRL), supplemented with 2% GlutaMax-
`1, I% glucose, 2% fetal bovine scrum and I% penicillin/
`streptomycin solution). ror transfcction of the myotube
`cultures, we used polycthylcniminc (PEI; ExGcn 500)
`according to the manufacturer' s instructions (MUI rcrmcn(cid:173)
`las). The cultures were transfcctcd for 3 h in low-scrum
`medium with I µ,M of each AON linked to PEI at a ratio(cid:173)
`equivalent of 3.5.
`
`2.3. RNA isolation and RT-PCR (llW/ysis
`
`Al 24 h posl-lransfcction, total RNA was isolated from
`the myotubc cultures using RNAzol B according lo the
`manufacturer's instructions (Campro Scientific, The Neth(cid:173)
`erland~. One microgram of RNA was then used for RT(cid:173)
`PCR analysis using C. thcn11 polymerase (Roche Diagnos(cid:173)
`tics) in a 20-p,I reaction al (10 °C ror 30 min, primed with
`dilfcrcnl DMD gene-specific reverse (RT) primers (Table
`2). l'rin1ary l'Cl{s were carried out with outer primer sets
`(sec Table 2), for 20 cycles or ')4 ''C (40 s), (10 °C (,,0 s), and
`72 ''(' (90 s). O11c micrnlitcr or this reaction was then rc(cid:173)
`a111plified in nested PC'Rs using the appropriate primer
`combinations (Table 2) for 32 cycles or 'J4 "(' (110 s), (i0
`°C (40 s), and 72 "C ((i0 s). l'CR products were analy1.cd on
`1.5 or 2% agarosc gels.
`
`2.4. Scq11c1u ·1' a11alysi.1·
`
`RT- PCR products were isolated from agarnse gels using
`the QIAquick Gel Exlraclion kit (()iagen). Direct DNA
`sequencing was carried m11 by the Leiden Genome Teclrnol(cid:173)
`ogy Center (LGTC) using the BigDye Terminator Cycle
`
`

`

`A. At1rt.1mt1-U11.1· et t1!. I N,·11m11111.n-11/ur f)i.Hmlers 12 ( 2002) S7 I-S77
`
`S73
`
`Table I
`Charac1eris1ics of 1hc AONs used 10 sl11<ly lhc 1arge1cd sk ipping of 15 differenl DMD cxons·'
`
`Name
`
`Antiscnsc scqucm:e (5 1-3 1
`
`)
`
`Lenglh (hp)
`
`GIC'¼,
`
`U/C%
`
`Exon skip
`
`Transcript
`
`h2AON I
`h2AON 2
`h29AON I
`h29AON 2
`h40AON I
`h40AON 2
`h41AON I
`h4 IAO 2
`h42AON l
`h42AON 2
`b43AON I
`h43AON 2
`h44AON I
`h44AON 2
`h45AON I
`h45AON 2
`h46i\ON 41>
`h4(1AON 81,
`h47AON I
`h47AON 2
`h48AON I
`h48AON 2
`h4lJAON l
`h4lJAON 2
`h50AON I
`h50AON 2
`h5IAON I
`h5IAON 2
`h53AON I
`h53AON 2
`
`cccauuuugugaauguuuucuuuu
`uugugcauuuacccauuuugug
`uauccucugaaugucgcauc
`gguuauccucugaaugucgc
`gagccuuuuuucuucuuug
`uccuuucgucucugggcuc
`cuccucuuucuu c uucugc
`cuucgaaacugagcaaa uuu
`cuugugagacaugagug
`cagagacuccucuugcuu
`ugcugcugucuucuugcu
`uuguuaacuuuuucccauu
`cgccgccauuu cucaacag
`uuuguauuuagcauguuccc
`gcugaauuauuucuucccc
`uuuuucugucugacagcu g
`cugcuuccuccaacc
`gcuuuucuuuuaguugcugc
`ucuugcucuucugggcuu
`cuugagcuuauuuucaag uuu
`uuucuccuuguuucuc
`ccauaaauuuccaacugauuc
`cuuccacauccgguuguuu
`guggcugguuuuuccuugu
`cucagagcucagaucuu
`ggcugcuuugcccuc
`ucaaggaagauggcauuucu
`ccucuguga uuuu a uaacuugau
`cuguugccuccgguucug
`uuggcucuggccuguccu
`
`24
`22
`20
`20
`19
`19
`19
`20
`17
`18
`18
`19
`19
`20
`19
`19
`15
`20
`18
`21
`16
`21
`19
`19
`17
`15
`20
`2J
`18
`18
`
`29
`36
`45
`50
`37
`58
`47
`35
`47
`50
`50
`26
`58
`35
`42
`42
`60
`40
`50
`29
`38
`33
`47
`47
`47
`67
`40
`30
`61
`(1 l
`
`75
`(18
`(15
`60
`79
`79
`95
`50
`41
`(17
`78
`79
`63
`70
`74
`68
`80
`75
`78
`67
`9-1
`62
`74
`(18
`59
`73
`45
`65
`72
`72
`
`+
`
`+
`+
`+
`+
`+
`+
`+
`+
`
`+
`+
`+
`
`+
`+
`
`+
`+
`+
`
`+
`+
`+
`
`OF
`OF
`Ir
`IF
`lF
`Ir
`lF
`IF
`IF
`IF
`OF
`OF
`OF
`OF
`OF
`OF
`OF
`OF
`IF
`ff
`Ir
`IF
`lF
`lF
`OF
`OF
`OF
`OF
`OF
`OF
`
`" Two AONs were tested per cxon. Their different lengths and G/C contents (';f,) did not corrclale to 1hcir cffectivity in cxon skipping (+, induced skipping,
`- , no skipping). The AONs were direc1cd to purine (A/G) -rich sequences as indicalcd by 1hcir (anlisense) U/C con1cn1 ('lr). Skippi ng of the 1argc1 exons
`rcsullcd in either an in-frame (IF) or an oul-of-framc (OF) transcripl.
`h van Deutckom cl al ., 200 l 121 ].
`
`Table 2
`Primer sets used for the RT-PCR analyses to ,h:tect 1he skipping of the
`targcled exons"
`
`Sequencing Ready Reaction kit (PE Applied Biosystems),
`and analyzed on an ABI 3700 Sequencer (PE Applied
`Biosystems).
`
`Target cxon
`
`RT-primer
`
`Primary PCR
`primer set
`
`Nested l'CR
`primer set
`
`3. Results
`
`2
`2
`29
`-10
`-ll
`-12
`43
`,M
`-15
`-l(1
`47
`48
`4')
`50
`51
`5.1
`
`h4r
`h9r
`h3 Ir
`h-14r
`h44r
`h-1-lr
`h47r
`h47r
`h47r
`h-l8r
`h52r
`h52r
`h52r
`h52r
`h53r
`h55r
`
`h lf'l-h4r
`h l fl-h9r
`h25f- h3 l r
`h38f- h44 r
`h38f-h-14r
`h38f-h-l-lr
`h-11 f- h47r
`h-11 f-h47r
`h-11 f-h47r
`h-l-lf-h48r
`h44f- h52r
`h4-lf-h52r
`h-l-lf- h52r
`h4-lf-h52r
`h47f- h53r
`h50f-h55r
`
`h I f2-h3 r
`h l f2-h8r
`h261'- h30r
`h3lJf- h-13r
`h39f-h43r
`hWf-h43r
`h42f- h-l6r
`h42f-h46r
`h-l2f- h-lfa
`h45f- h47r
`h46f- h5 Ir
`h46f-h5 l r
`h461'-h5lr
`h46f- h5 l r
`h-llJf-h52r
`h5 I f- h54r
`
`·' Primer sequences an: availabk upnn rcqucsl.
`
`3.1. /11 1·itro e.ron skip11i11g
`
`AONs were empirically analyzed ror the induction of
`cxon skipping following transfection into human control
`myotube cultures, using the cationic polymer polycthyleni(cid:173)
`mine (PEI). As determined by the nuclear uptake of the
`fluorescent AONs, average transfcction efficiencies of 60-
`80% were obtained. At 24 h posl-transfcction, transcripts
`were analyzed by RT-PCR using different primer combina(cid:173)
`tions e ncompassing the targeted cxons (Table 2). Of the 30
`AONs tested, a total of 20 (67%) reproducibly generated
`shorter transcript fragment s with sizes corresponding to
`the specific skipping of the targeted cxons (Pig. 1 and
`Table 1 ). In fact, as confirmed by sequence analysis of the
`shorter transcripts (data not shown), we could induce the
`
`

`

`S74
`
`A. Aar1.1·111a-R11s er al. I Ne111·1111111.1·rn/ar /)i.1·ordl'l'.1· 12 (2/J/12) S7 I-S77
`
`a.
`.n
`0
`0
`
`1--
`z
`
`z
`0
`<(
`N
`.c
`
`Q_
`
`0:: u
`..,:.
`0::
`
`a.
`.c
`0
`0
`
`1-(cid:173)z
`
`z
`0
`<(
`N
`.c
`
`Q_
`
`0:: u
`..,:.
`0::
`
`a.
`.n
`0
`0
`
`1-(cid:173)z
`
`0:: u
`Q_
`..,:.
`0::
`
`-!26!27!28!29!30!
`-l2sl 21l2sl 301
`-1261271301
`
`-IJTITI]
`-OTIJ
`
`a
`
`a.
`.c
`0
`0
`
`1-(cid:173)z
`
`z
`0
`<(
`0 .,.
`.c
`
`z
`0
`~ .,.
`<(
`
`.c
`
`z
`0
`<(
`N .,.
`.c
`
`0:: u
`0..
`..,:.
`0::
`
`-DTIITJ
`-ITII]
`
`b
`
`a.
`.c
`0
`0
`
`1--z
`
`N z
`0
`"' .,.
`<(
`
`.c
`
`z
`0
`<( .,. .,.
`
`.c
`
`z
`0
`ll) .,.
`<(
`.c
`
`0:: u
`Q_
`..,:.
`0::
`
`C
`
`C.
`.n
`0
`0
`
`ro z
`~ <D .,.
`
`.c
`
`Q_
`
`0:: u
`..,:.
`0::
`
`1-(cid:173)z
`
`'i•.
`
`:7:t
`:,:: - 1391401411421431
`, __, 39 41 42 43
`9 40 4? 43
`".:' \
`!39!40!41143!
`
`-1421•3144145146!
`_!42143145146!
`-142!441•514sl
`
`d
`
`a.
`.c
`0
`0
`
`N z z z z
`0 0 0 0
`<( <( <( <(
`I-!;;: ~ ~ ~
`Z.c.c.c.c
`
`0:: u a.
`..,:.
`0::
`
`e
`
`z ~ a::
`0 0 2r
`
`c.
`~
`<( <(
`..,:.
`ol-LOL00:::
`z
`.c
`.c
`
`f
`
`C.
`.n
`0
`0
`
`Q_
`
`~ 0::
`z
`u
`0
`..,:.
`<(
`"'
`"'
`0::
`.c
`
`1--
`z
`
`-!49!5ol51's2I
`-!491 sol ls2I
`-!49!50!52!
`
`-~
`
`g
`
`h
`
`Fig. I. RT- l'CR analysis ol' 1111111:111 dy,1 rophi11 111RNA in 1hc rq!io11, L'lll'0111passi11g Ilic: cxo11, lal'f'l'lcd for ,kippi11g. Shol'ln, 11ovl'I 1ra11,,rip1 frag111L'IIIS 11\'l'L'
`ohsl'rVL'd following 1ra11skclion ll'ilh lhc dii'krl'nl AON, when n11nparl'd lo 11<111 -lr:111, fcL•il'!I 11Jyo111he ,11llllll 'S (N'l'J. S,·q11,·11ce a11:al ysis (1101 ,how/I) conlirn1L·d
`lhc skipping of lhl' largl'll'd l'Xo11s. as indil'all'd hy lhl' lahds adjaec111 lo lhe i111agl's. i\lln11a1i vl'ly spliced pr111h1,·1s, d,·ILTl,·d in 11,v n·1•.io11s an11111d <'X<lll '.! (h).
`l'Xllll 21) (e). and cxon 51 (h). ll'l'l'l' scqlll'IIL'<'d and fo1111d lo he derived fro111 c:ill1er rn-skipping of adjacenl L'X011s or 11,:1gl' 111' a n yplic ,plin· ,i1,·. N11 as1wcilic
`(l{T- ) !'CR prod11c1s Wl'l'l' ol>1ai11cd. In so111l' analyses. addilional frag111rn1,. sligl1tly ,ltol'ln lhan thl' wild .Jypl' pnHIIIL'IS, wt·n· pll'S<'III. Tl1is wa, due lo
`hc1crod11pkx f'on11a1ion.
`
`speci lie skipping or 12 out or the I 5 cxons targeted (five out
`or the seven in-frame exons, and seven out or the eight out(cid:173)
`or-frame exons). No skipping or exons 45, 47 and 48 was
`detected {Fig. I e,g).
`In the specific transcript regions that were screened in
`these experiments, we ohserved in the non-transrected
`
`control myotubes alternative splicing patterns around
`exons 2 and 29 (Fig. I b,c). The alternative products were
`sequenced and found to be due to the skipping or cxrn1s 2- 7
`(in-frame), exons 'J- 7 (out-or-frame). cxons 28-2') (in(cid:173)
`frame), and cxons 27-29 (in-frame). This genuinely occur(cid:173)
`ring cxon skipping was also detected previously in human
`
`

`

`S75
`
`i\. 1\111·1.1·111"-1?11.1· ,., ol. I N/'11r,111111srn/"r l>i.rn rd,·r.1· 12 / 2002) S7 I-S77
`suggests a mutation-, i.e. a patient-, specific therapy, an
`skeletal muscle 124,251. Remarkably, the level of the alter(cid:173)
`important intrinsic advantage over ge ne addition is the
`native splicing was significantly enhanced by the AON(cid:173)
`simultaneous correction of most or all affected dystrophin
`treatment of the transfcct_cd myotube cultures. Noteworthy
`isof'orms, thus enabling the maintenance of the original
`also is the observation that h2AON I not only induced exon
`tissue-specific gene regulation . Moreover, an assessment
`2 skipping in the normal transcript, but also in one of the
`of the mutation spectrum shows that the skipping of one
`alternative transcripts consisting of exons I and 2 spliced to
`parlicular exon would theoretically be therapeutic lo a series
`exon 8 (rig. I b).
`of different mutations. For instance, the skipping of exon 51
`The majority or J\ONs induced the precise skipping of the
`would restore the reading fram e in pat ients carrying a dele(cid:173)
`targeted cxons, using the original splice sites of the adjacent
`tion of either exons 45- 50, 47-50, 48-50, 49- 50, 50, 52, or
`exons. However, in response to h5 I AON2, an in-frame
`52-63. In fact, skipping of the 12 di ITerent exons that were
`cryptic splice site was used in exon 51 (rig. I h). The
`successfully targeted in this study, would, in total , correct
`level of' this alternatively spliced product was variable in
`more than 50% or the deletions and 22%> of the duplications
`serial transfection experiments. f-inally, in some or the
`reported in the Leiden DMD-mutation Database (Table 3).
`transfcction experiments, additional aberrant splicing frag(cid:173)
`Therefore, the method, once established, would be widel y
`ments were detected due to the co-skipping of adjacent
`applicable. Another promising aspect is the efficiency of the
`exons. Their incidence, however, was inconsistent, and al
`skipping strategy. In a previous study we showed that hy
`very low levels.
`inducing exon 46 skipping in muscle cell cultures from
`DMD patients affected by an exon 45 deletion, an in(cid:173)
`frame transcript (lacking both exons 45 ancl 46) was gener(cid:173)
`ated at estimated levels of 15%, of total mRN A, which
`restored dystrophin synthesis to near normal le vels in over
`75 %, of myotubes 12 1 j. These results, together with those
`from mini-DMD gene addition studies in mice showing that
`only one third or normal dystrophin expression already
`ameliorates the dystrophic phenotype 126], underline the
`potential or the exon skipping strategy.
`To test the realistic applicability of the strategy to other
`exons and hence other mutations, we have targeted here 15
`different exons that we re selected on the basis of being
`located in the deletion hot spot region, thereby theo retically
`
`4. Discussion
`
`In the field of DMD gene therapy, gene correction by
`antiscnse-induccd exon skipping is gaining allention as a
`novel and promising tool in development. The feasibility
`and therapeutic potential of this strategy has been demon(cid:173)
`strated both in human muscle cells for exon 19 f 171 and
`exon 46 1211, and in mouse muscle cells for exon 23 114-
`161- The strategy is based upon anti sense oligoribonuclco(cid:173)
`lides, generally considered to be small and relatively safe
`therapeutic reagents, which bind to target sequences in the
`this
`induce exon skipping. Whilst
`pre-mRNA and so
`
`Table J
`
`Overview and frequency of the DMD-causing mutations in the Leiden DMD (LDMD) Database. thcoretic·ally rnrrectable by skipping one of the 12 exons
`succcssl'ully targeted in this study
`
`Skipablc cxon
`
`Therapeutic for DMD-mutations :
`
`Deleti ons (exons)
`
`';/, or <.klc1ions in
`LDMD Database
`
`Duplications (exons)
`
`% of duplications
`in LDMD
`Database
`
`No. of nonsense
`111utations in
`LDMD Dat ab;1sc
`
`2
`29
`40
`-11
`42
`-1.'l
`44
`
`5]
`
`] - 7, ]-19, ]-2 1
`
`2.9
`
`44, 44-47. 44-49. 44- 51
`5-4] , 14-4]. 19-4]. ] 0-
`4] , ]5-4], ]6-4]. 40-4],
`42-4].45, 45- 54
`2 1-45. 45, 47- 54,47- 56
`
`5 1. 5 1- 5], 5 1-55
`45- 50. 47- 50. 48- 50.
`4<)- 50. 50, 52, 52- 6.'\
`I 0- 52. 45- 52. 4(1 - 52.
`47- 52, 48-52. 49- 52.
`50- 52, 52
`
`3.7
`7.8
`
`5.6
`
`5.2
`17.5
`
`7.5
`
`2
`
`41
`44
`
`50
`5 1
`
`5
`l
`4
`0
`
`9.0
`
`J .0
`J.0
`
`1.0
`1.5
`
`

`

`S76
`
`A. Aart.mw-R11.1· et al. I Ne11m11111.1-c11/ar /)i.wm/n .1· 12 (2002) S7 I-S77
`
`applicable lo the majority of DMD deletions, and on being
`either in-frame (exons 29, 40, 41. 42, 47, 48, and 49) or out(cid:173)
`of-framc (exons 2, 43, 44, 45, 46, 50, 51 and 53). The 30
`AONs that were designed for these experiments differed in
`length and in G/C content. They were principally directed to
`relatively purine-rich sequences, which in most cases were
`predicted lo have an open secondary RNA structure al 37
`0 C. Using these AONs we were able lo induce the skipping
`of 12 out of the 15 targeted cxons. There was no significant
`difference in 'skipability' between in-frame exons or out-of(cid:173)
`frame exons, or between exons with weak (mostly in-frame)
`or strong splice-site consensus sequence values [27 [. It has
`been suggested that exons with weak splice site consensus
`values may require additional signals, such as secondary or
`tertiary structural motifs that interact with the splicing
`machinery, to ensure accurate splicing. Based on our results,
`we hypothesize that the binding of the AON to the cxon
`disturbs the local folding of