GEN]: MEDICINE
`
`_ wa.\m...,m:.,.\wgw.a-w_LA“; 4W”; 3. .»..
`
`,
`' g
`
`,4:
`
`A cross-disciplinary journal for research
`an the science of gene transfer and its
`clinical applications
`
`
`
`Official journal of
`
`The European Society of Gene ‘I‘hcrapy (ESGT)
`The lapan Society of Gene Therapy (JSGT)
`The Australasian Gene Therapy Society (ACTS)
`
`Sarepta Exhibit 1067, Page 1 of 9
`
`

`

`T
`
`Editorial Office
`Wiley Europe
`14 rue Saint Laurent
`60500 Chantilly, France
`Tel: -'-33 (0) 344 57 39 80
`Fax: +33 (0) 344 57 50 72
`e-mail: genmed@wiJey.co.uk
`Richard Edelstein
`Managing Editor
`Sandrine Deschrvver
`Assistant 1'\Jcmagitlg Editor
`
`Volume 4 Number 6
`
`Contents
`
`In this Issue
`
`The Journa l of
`
`111aw1111ett11
`
`November-December 2002
`
`Editors
`Shigetaka Asano
`University of Tokyo
`The Institute of
`M:edicaJ Scie'lce
`Tokyo 108··0071
`Japan
`Associate Editors
`Jean-Paul Behr
`University l.cmis Jlast('.Ur
`11 lkirch __ Fra.nce
`
`Olivier Danos
`G('.nCtbon
`CNRS URA 1923
`91002 Evry Cedex 2
`France
`
`Kay Davies
`University of Oxfrird
`De.partment of Human
`Anatomy and Genetics
`Oxfo1d OXl 3QX
`U.K.
`
`Pierre Lehn
`HOpital Robert Debn~
`Unite INSERM 458
`75019 PARIS
`France
`
`Richard Mulligan
`Th~- Child re n's Hospital
`Department of Genetics
`Boston, ~'lA 02115
`USA
`
`Xandra Breakefield Mary K. L. Collins Beverly Davidson Glenn Dranoff
`Mass;~chusetts General
`University Coll.ege
`Universitv of Iowa
`Dana Farber Cancer
`Ho.~ita I
`London, UK
`Iowa Cit"Y, USA
`lnslilUte
`Charlestown, USA
`Boston, USA
`Margaret Uu
`Thomas Wickham
`Transge.ne
`Gen Vee Inc.
`Strasbourg, Franc!!
`R0t:kville, USA
`
`Luigi Naldini
`University of Torino
`Torino, Italy
`
`Ernst Wagner
`Ludwig-Maximillians
`University
`Munich, (;ermany
`
`Yasafumi Kaneda
`Osaka University School
`of Medicine
`Osaka. Japan
`Jon A. Wolff
`University of Wfaconsin
`Madison, USA
`Section Editors
`Industry News
`Paul Martin
`Imtitl\te for the Study of Genetics, Biorisk and Society,
`University of Nottingharn, lJK
`
`Website
`Mohammad Abedi
`Hudding:e Hospitul
`Huddinge, Sweden
`
`Aims and Scope
`1'he,Jourrial of Gene Medicine is a print and electro11ir.journal which publishes art.ides on the science of gene transfer and its
`clinical applications. The,jm1roal will consider an.ides on all aspects of gene therapy induding design and production of vectors,
`research into the mcr.hanis:ms underlying· gene transfer, predini01l studies including animal models, <lf.'vdopmental a.'>l)e.cts
`(large-sc~le production, toxicology) .and clinical trials:. 111e editors particularly 1.vek:omf.i artidf.!S <kaling ·with rhe methodological
`aspecrs of gene transfer in viw, notably in the context of human studies. Anir.Jp_<;: !l.ddressing more fundamental biological issues
`whlch could open up avenues for more effective gene transfer are also welcome.
`Editorial Board
`Ian E. Al,EXANl)RR
`Westmcad, AustraHa
`Eric Al.TON
`tondnn, UK
`R. Michael Bl.Af.SE
`Newt()£1, LISA
`Claudio B0fW1GNON
`Mi!an,lta}y
`Gerry HOTH
`Nonh Rydc. Australia
`.Jeffrey CHAMBERLAJN
`Ann Arbor, USA
`Seng H. CHENG
`Ftamingh.am, US.A,
`Fran~is-LolC COSSF.1'
`Lyon., Fr.1.nr.0:-
`Matt CO'lTKN
`Vienna, Austria
`Charles COl!TELLE
`London, UK
`David T. CURIEi,
`Bitmlngharn. ltSA
`Nicole- DEGLON
`Lausanne, Swi12erlarn.1
`Georg<'? DICKSON
`Egha::n, UK
`Sime DIBLHR
`Stot:kht>lm, Sweden
`Yoshikatsu ETO
`
`Philip 1- FBWNER
`San Diego, USA
`Giuliana FERRARI
`Miian, ll<1ly
`Alain FISCHF.R
`Paris, France
`
`Eithan GALUN
`Jerusclem, brnel
`Bernd GANSMACflF.R
`Munich, Gennari.y
`Steph-e-.n P. GOFF
`New York. USA
`Hirofunti HAMADA
`Sapporo, Japan
`Jean-Michel HEARD
`Poris., France
`I..eafHUANG
`Pirtsburgh, lJSA
`Keith HUMPHRIRS
`Vancou,,-er, Can:-:ida
`Clare HUXLEY
`London, UK
`Stephen C, HYDE
`Oxford, UK
`~anos IOANNOU
`Victoria, Australia
`Doug!asJOIJ,Y
`Encinitas. USA
`St_efon.XARLSSQN
`
`Suayoung KIM
`Seoul, Korea
`David KLAT'LJ\,1ANN
`Puris, Fr.mce:
`Jeffrey M. LRIDEN
`Hoc.i on, USA
`Andrew l,EVER
`Cambcidge, IJK
`Song LI
`Pittsburgh, USA
`Bernard MASSIR
`Montreal, Canuda
`Fulvio MAVII.JO
`Milan, Jraly
`Patrick MIDOUX
`Orkans, FranC'.C
`l'h!Uppe MOULLIE.R
`Nan.te~, Fmncc
`Keiya 0'1-AWA
`Tochigi, J11pan
`Michel PBRRICAUDET
`Pads, Frn.m:e:
`David J. PORTEOUS
`EdinlmtRh, UK
`Colin PORTER
`l.oodon, UK
`John RASKO
`Nc,,v1011, Aus,nilia
`Jea~•S7rge RK\W
`
`Paul ROBBINS
`Pit~~b;.irgh, USA
`Steve RUSSEU.
`RochP.lirer, USA
`Michel SADELAIN
`New York, c:~A
`R, Jude SA."l\tllLSKI
`Chapel Hill, USA.
`Maurizio SCARPA
`Piidcr,..<1, It11l1
`T'Jhsh:i ,'iHTMADA
`Tokyo, Japan
`Jonathan W, SIMONS
`Baltimore, USA
`C. I. Edvard SMITH
`Srockholm. Sweden
`Ric.hard SNYDER
`Bo.ston, USA
`Groff SYMONDS
`Sydney, Altstrafoi
`Francis C. SZOKA Jr.
`San Francisco, USA
`Kenzaburo TANI
`Tokyo, Japan
`Naoml TAYI.OR
`Moiupe!Iicr, France
`J.:ris 'l'HUJ..EMANS
`Brus.~e!s, Beltum
`Didier TRONO
`
`ArtoUR'ITI
`Kupio. Jiitti3.ud
`Thierry
`VANDtiNDRJl:.SSCHE
`Leuven, Belgiun~
`M,muelVRGA
`Evry,f"uncr-.
`Thierry VBLU
`Brussels, Belgium
`Ind er \'1':RMA
`San Diego, USA
`Richard.VILE
`Rix'.tl~Ster, USA
`Michael J. WELSH
`1(1<,,'ffiCi~. USA
`David A. WILLIA:.'1:S
`Jndianapolls, USA
`James M. WILSON
`Phifarlelµbta, US,<\
`Jun YOSHmA
`Aichi,Japan
`
`Review Article
`Gene therapy for rheumatoid arthritis
`N. Bessis_, C. Doucet, V Cotwrd, A-M. Doum~ H. Fi.rat, C. Jorgensen_. M. Mezzina and M.-C. Boissier
`Research Articles
`Lack of specificity of cell-•surface protease targeting of a cytotoxic hyperfusogenic gibbon ape leukaemia virus
`envelope glycoprotein
`L. A Kirkham, A. R. Rat.eman, A. A Melcher, R. G. Vile and A K. Fielding
`Polybrene and interleukin-4: two opposing factors for re.t.roviral transduction of bone-manow-derived
`dcn<lritic cells
`S. Fresnay, D. E. Chctlmers, C. Ferrand, C. Colomba.in, I. Newton., \~ Yerly-Motta1 A. Lienard, P. Damde.s de Tailly,
`P. Herve, P Tiberghien and P. Saas
`
`Phenotypic rescue after adeno-associated virus-mediated delivery of 4-st:ifarase to r.he retinal pigment ep!theiium
`of feline mucopolysaccharidosis VI
`T. T . . ffo, A M. Maguire, G, D. Aguirre? B. M. Surace, V. Anand, Y. Zeng, A. Salvetti, J, J. Hopwood, M. E. Haskins and
`J. Bennett
`Rescue of rctroviral envelope fusion deficiencies by cationic liposomes
`C. D. Porter
`Nonvir:a l vt:·ctor loaded collagen sponges for sustained gene delivery in vitro and in viva
`F: Scherer., U. Schillinger, U. Putz, A. Sternberger and C. Plank
`
`Improved anrisense oligonudeotide induced exon skipping in the mdx mouse model of muscular dystrophy
`C. J_ t\-1ann_, K Honeymctn, G. McClorey_, S. Fletcher cmd S. n Wilt.on
`Li:;teria monocytogene.s mediated CFfR transgene transfer to mammalian cells
`S. Krmch, E. Domann_, M. Frings, A Zelmer, .iv!. Diener, T. Chakraborty and S. Weiss
`Controlled transgene expression by El-E4-defective adenovirus vecto;:s harbouring a "tet-on" sVtitch system
`P. Fender, L. Jea11son, M. A Ivanov, P. Collin, J .. .l\i1allet, J. F. Dedieu and i'v!. l.atta-.Matlieu
`Novel promoter/transactivator configurations for macrolide- and strepmgramin-responsive transgene expression
`in mammalian cells
`i,v, Weber~ B. P. Krame1; C. Ha, B. Kf!ller and M. Fu.,;senc:gger
`Society Communication
`Policy statement on the social, ethical and public awareness iss1.1es in gene
`
`VE0
`
`DEC 2 0 2002
`
`PERIODICALS Dept.
`UGA LIBRARIES
`
`Features
`Conference Calendar
`Thank you to our Reviewers
`Author Index
`Keyword Index
`Volume Contents
`
`/ Gene Med 4(6) 579-698 (2002)
`ISSN 1099-498X
`
`579
`
`581
`
`592
`
`601
`
`613
`
`622
`
`634
`
`644
`
`655
`
`668
`
`676
`
`687
`
`692
`693
`595
`697
`
`papers in this journal are available online
`ahead of the print issue
`Wiley tntel'Sc.tertce
`
`~EarlyView"
`
`www.interscience.wiley.com
`
`I I
`I
`
`

`

`The Journal of Gene Medicine
`
`Subscriptions
`The Journal of Gem~ MecJicinr. (Print TSSN 1099-498X;
`Online ISSN 1521-2254 at Wiley IntcrSdcnce,
`www.interscience.wiley.c.om) is published bi-monthly by
`John Wiley & Sons, Ltd., The Atrium, Southern Gatet
`Chichester, West Sussex PO.19 8SQ, UK
`Subscription Rates
`Volume 4 2002 6 issues
`Institutional
`Print only US$445.00.
`Electronic onlyUS$445.00.
`Print and Electronic US$468,00 indudes the subscription in
`both electronic and print formats,
`Personal US$335.00
`To suh.<,cribe, please contact Journals Subscriptions
`Depar\(nent, John Wiley & Sons., Ltd., 1 Oldlands Way,
`Bognor Regis, West Sussex. PO22 9SA, UK
`Tel: +44 (0) 1243 779777
`Fax: +44 (0) 1243 843232
`E-mail: cs-journals@wil~y.co.uk
`Sample Copies
`1f you are interested in subscribing, you may obtain a free
`sample <.:opy by contaf.'ting John Wiley & Sons, Ltd. at. the
`above address.
`Services
`Advertisements and Bulk Reprints
`For companies based outside North America contact:
`Advertisement Sales Department, Johr1 Wiley & Sons, Ltd.,
`The Atr.ium, Southern Gate, Chiche.o,rer, West Sussex
`PO19 SSQ, UK.
`Tel: +44 (OJ ]243 770351
`Fax: +44 (0) 1243 770432
`E•matl: adsales@wiley.co.uk
`or
`For companies based in North America contact:
`Advertisement Sales Department1 John Wiley & Sons, Inc.,
`111 River Street, Hoboken, NJ 07030, USA.
`Tel: + 1 (201) 748 6921
`Fax· + l (201) 748 6313
`E•mail'. kt.hompki@wik•.y.com
`
`General Enquiries
`'lei: +44 (0) 1243 779777
`Pax: +44 (0) 1243 775-S78
`Copyright
`Copyright@ 2002 John Wiley & Sons, Ltd.
`All Rights Reserved. No part of this publication may be
`reproduced, stored in a rcrrit.-val system, or lransmitted, in any
`form or by any means, electronic, mechanical, photocopying,
`recording, scanning or otherwise, except as described below,
`without the permission in writing of the Publisher.
`
`Copying of articles fa not permitted exr.ept for personal and
`internal use, to the extent permitted by national copyright
`law, or under t.he tenns of a licence issued by the na6ona1
`Reproduction Rights Organization (such as CopyTight
`Licensing Agency, 90 Tottenham Court Road, London Wl P
`9liE, UK or Copyright Clearance Center Inc,, 27 Congress
`Street, Salem, MA 01970, USAJ, The price per copy is $30.00.
`Requests for permission for other kinds of copying, such as
`copying for general distribution, for advertising or
`promotional purposes, for creating new collective works or
`for resale, and other enquiries should he addressed to the
`Publisher.
`Statements and opinions ex.pressed in the arrides and
`communications are those of the individual contributors and
`not the statements and opinions of John Wiley&. Soas, Ltd., or
`the European Society of Gene Therapy (ESGT), or the Japan
`Sociely of Gene Therapy (JSGT), or the Australasian Gene
`Therapy Society (AGTS). Wiley assumes no responsibility or
`liability for any damage or injury to persons or property
`arising out of the use of any materials. instructions, methods
`or ideas contained herein. \VH.ey ex:pressly disclaims any
`implied warranties or merchantability or fitness for a
`particular purpose. If expert assistance 1s required, the
`services of a competent professional person should be sought.
`
`Abstracting and Indexing
`The Journal of Gene J'vfedicine is covered by the following
`abstracting and indexing services: Biotechnology Citation
`Index® (ISi), Cambridge Scientific Abstracts, Current
`Contents®/Life Science, (!SI), EMBASf:.IExcerpta Medica
`(Elsevier), Index Medkus/MEDLINE, ISi Alerting Services
`and Science Citation Index Expanded (also known as
`SdSearch®J (!SI).
`
`Production Information
`Production Details
`Production Editor
`Freyja Tipping
`E·mail: ftipping@wiley.co.uk
`Printed on acid.free paper.
`Typeset by Laserwords Private Ltd, Chennai, India,
`Pnnted and bound in the Unlted l<"ingdorn by Henry Ling
`Umited, at the Dorset Press, Dorchester~ DTl lHD.
`Identification Statement
`T/u, Journal of Gene Mc<lidrie (ISSN 1099-498X, USPS 018-
`587) is published bi-monthly by John Wiley & Sons, Ltd., The
`Atrium, Southern Gate, Chichester, West. Sussex PO19 8SQ1
`UK. Periodicals postage paid at Rahway, NJ. Air freight and
`mailing in the USA by Mercury Airfreight Internatfonal Ltd
`Inc., 365 Blair Road, Avenel, NJ 07001, USA.
`USA POSTMASTER - send address changes to The Journal of
`Gene Medicine, c/o Mercury Airfreight International Lt<l Inc.,
`365 Blair Road, Avenel, N.J 07001., USA.
`
`nm JOURNAL or CF.~E MEIJ[CINE
`J Gene Med 2002; 4: 579--5$0,
`
`T he Journa l of
`
`u+awn+•1•1a1
`111 this. issue
`
`Gene therapy for rheumatoid
`arthritis : a review
`
`Rheumatoid arthritis (RA) is a severe.
`systemic autoimmune disease
`in
`which chronic synovial inflammation
`results in destrnction of the joints.
`There is no truly effective treat•
`ment for RA Bessis et a.l.. review
`the current status of a gene ther•
`apy approach. for the treatment of the
`disease. Potential strategies i.ndude
`down-regulating mediators of inflam(cid:173)
`mation or articular destruction (such
`as lNF-c, or IL-1) and up-regulating
`antiAintlarnmatory cytokines (such as
`IL--4 and IL--10). The authors also
`review the gene delivery systems that
`have been used and they consider
`local versus systcrnic. and in vivo ver·
`sus ex•vivo strategies. F.x vivo gene
`transfer has been investigated using
`syuovial cells, fibroblasts, T cells, den(cid:173)
`dritic cdls, and various xenogeneic
`cells. Clinical trials have started with
`retroviruses (ex vivo) expressing the
`IJ..-1 receptor ant.agonfat and have
`demonstrated the feasibility of the
`strategy. The best target molecuies
`remain to be dete1.mined and exten(cid:173)
`sive pre-clinical studies will need to
`be performed. (p. 581)
`
`Cell surface protease
`targeting of a cytotoxic
`GALVEnv?
`
`Kirkham et al. investigated the pos(cid:173)
`sibility of targeting the cytotoxic
`ac.tivity of a hyper.fusogenic Gib(cid:173)
`bon Ape Leukaemia vims (GALV)
`envelope glycoprotein
`therapeutic
`gene whilst simultaneously enhanc(cid:173)
`ing its immune stimulatory proper(cid:173)
`ties via local, matrix·metalloprotease
`(MMP)-mediated release of human
`GM-CSF. Hyperfusogenic GALV enve-(cid:173)
`lopes, whose e.xpression is kno"Wll to
`be highly cytotoxic, were fused at
`
`the N•terminus to 'blocking' domains
`via MMP-sensitive linkers or con(cid:173)
`trol linkers (non-cleavable or factor
`Xa protease-dcavable linkers) and
`their cytotoxicity wa~ assessed on
`MMP positive and negative cell lines.
`Unlike protease targeting in the con(cid:173)
`text of retroviral vectors, protease
`activation of the c·ytotoxicity of GALV
`envelope by cleavage of a fusion·
`blocking ligand did not appear to be
`specifically mediated by cell-surface
`MMPs. Thus, it appears that speci(cid:173)
`ficity of cell-cell fusion mediated by
`GALV envelope cannot be manipu(cid:173)
`lated in the same fashion as virus~cell
`fusion, (p. 592)
`
`Optimizing retroviral
`transduction of murine DCs
`
`Gene trru1sfer using retroviral trans•
`the advantage of
`duction offers
`long-term transgene expression when
`developing strategies that use den(cid:173)
`dritk cells (DC) for imrnllllothcr(cid:173)
`apy, The goal of this study was
`to define optimal conditions for the
`transduction of murine bone mar·
`row (BM)-derived DCs. Fresnay et al.
`report here that protamine sulfate
`and IL-4 allow to increase DC retrovi(cid:173)
`ral transduction, whereas polybrene
`induced DC apoptosis. DCs gener(cid:173)
`ated in GM-CSF plus IL-4 presented
`however a more mature phenotype.
`These findings have potential impli-(cid:173)
`cations in experimental gene therapy,
`(p. 601)
`
`Retina gene therapy in MPS
`VI cats
`
`Ho et al. successfully used an adeno(cid:173)
`associated virus (AAV) to treat the
`retinal manifostations of the lysoso·
`mal storage disease, mucopolysac(cid:173)
`charidosis VI (MPS VI),
`in a cat
`
`model. Subretinal injection of a
`recombinant .'\AV carrying the wild(cid:173)
`type version of the disease-causing
`arylsulfatase B gene resulted in cor(cid:173)
`rection of the disease phenotype in
`the affected retinal pigment epithe(cid:173)
`lium (HPE) even in MPS VI cats
`treated late in the disease process.
`Therapeutic effects persisted as long
`as 11 months after treatment. These
`results support the utility of AAV as
`a vector for the treatment of RPE(cid:173)
`specific as well as lysosomal storage
`diseases. (p, 613)
`
`Cationic liposomes for
`transduction by
`envelope-defective
`retroviruses
`
`ln order to investigate the mecha•
`nisms of !iposome-enhanced retTovi(cid:173)
`ral transduction, Porter complexed
`cationic lipids with retrovirus par(cid:173)
`ticles bearing wild-type, c:himaeric
`or no envelope proteins. Stable
`association of cationic
`.Uposomes
`with retrovirus particles enhanced
`cell binding in proportion to the
`increase of transduction kinetics.
`Bi.ndtng of virus without envelope
`protein and/or virus receptor was
`equivalent, indicating that a non(cid:173)
`specific interaction precedes recep~
`tor recognition. The intrinsic fuso•
`genicity of DOTAP enabled trans·
`duction by non-enveloped virus, in
`some cases at levels approaching that
`of enveloped virus. Moreover, DC~
`ChoVDOPE cationic liposomes sig(cid:173)
`nificantly enhanced ineffident entry
`of targeting domains-containing chi(cid:173)
`maeric envelopes. These data have
`important implications for the devel(cid:173)
`opment of retroviral vector targeting
`strategies from the perspet.iives of
`the specificity of target cell inrerac.
`tion and compensating for chimaeric
`envelope fusion deficiency. (p. 622)
`
`Copy.right~ 2002 Jo~n Wiley & Sons, 1:,;td.
`
`.I (,ri!ne Merl 2002: 4: S79-580
`
`

`

`RESEARCH ARTICLE
`THE JOURNAL OF GENE :v!ED[C!NE
`J Gene Med 2002; 4: 644-6S4.
`Published on.lint: 13 Auglt&I 2002 in Wiley lnn~rSciem:t! (www.inxerscience.wiley.com} DO!: 1fJ."HJ02/jgrn.295
`
`Improved antisense otigonudeo'tide induced exon
`skipping in the mdx mouse model of muscular
`dystrophy
`
`Christopher J. Mann
`Kaite Honeyman
`Graham McClorey
`Sue Fl.etcher
`Stephen D. Wilton*
`
`Australian. J',;euromuscular Research
`institute, Centre jor Neuronmscular
`and Neuro!ogic:.il Di.>orders,
`University of We~'ifern Amtralia,
`P1!.rthi West.em .A.ustralia, 6907
`
`*Correspondence to:
`Dr Stephen D. Wilton_, Univcrsi:;y of
`Western Australia, .Australian
`Neuromn!icular Researe;7 Institute,
`Centre for Neuromuscular and
`Neurological Disorders .. Perth,
`Western Australia, 690/. ENnwil:
`swi1ton@cyliene.uwa.edu.au
`
`Revised: 15 .Ap:-i! 2002
`A.:.::epted: 18 4ptil 2002
`
`Abstract
`Background Duchenne muscular dystrophy (DMI)) is a fatal genetic
`disorder c:iuscd by dystrophin gene :mtu:ations rhat p1edt1de ,;ynthesis of
`a functional protein. One potential treatmem 0f the disorder has udlised
`andscnse oiigoribonucleotides (AOs) to induce removal of diseas(;:.a.ssodated
`exons <luring pre·mRNA pmeessing. !nduced in-frame mRNA transcripts
`encode a shorter but functional dystrophi.n. We nave investigated and
`improved the desig.;1. of AOs cai)<:tble of rem"vin.g exon 23, and thus the
`disease-causing nonsense mutation, from mRNA in the nHir mouse model
`of DMD.
`
`Methods H<!It-•MSB rr1dx culmrcs were tra.:1sfoct~d with complexes of
`lipofectin and AOs. Exon skipping was ,ktected by RT-PCR and subsequent
`protein production was demonsn·ated by \Vestern blotting. AOs ~Nere delivered
`at a range of doses in order to compare relative effidencii.:.-s.
`
`Results
`\Ve describe effective and reproducible exon 23 saappmg with
`several AOs, including one as small as 17 nucleotides. Furthermore, the
`location of a sensitive cxon 23 target site has been refined, whil<;t minimum
`effective doses have been estimated in vitro. These doses are signiricantly
`lower than previously reported and were associated with the synthesis of
`dystrophl.n protein in vitro.
`
`Conclusions n1~se results demonstrate the increasing feasibility of an AO(cid:173)
`based thetdpy for treatment of DMD. By refining AO design we have been able
`to reduce the size and rhe effective dose of the AOs and have dramatically
`imprnved the efficiency of the technique. Cop;Tight @ 2002 John Wiley &
`Sons. Ltd.
`
`Keywords antisense oligonudeotides; dysrropbn; exon skipping; Dnchenne
`muscular dystrophy
`
`Introduction
`Dud1cnne muscular dystr;:.,phy (DMD) i.s a fatal neuromuscular condition
`resulting from an absence of dystrophin protein due to eirher nonsense or
`frame·sl~ifr mutations i.n the dystrophin gene [1]. In the absence of genetic
`sc!'eening; DMD has an incidence of 1 in 3500 Hve male births1 vvith 1 in 3
`cases resulting from a de novo mutation. Dystrophin-negative muscle fibres
`are weaker and undergo repetitive cycles of damage and repair following
`muse.le contraction. Cycles of degeneration and regeneration are evenwa.ily
`
`< '
`
`' '
`
`...
`, .
`'' ..
`
`.I.
`
`( l
`
`...
`
`Improved Dystrophin Exon Skipping
`
`exhausted and the muse.le is gradually replaced by adipose
`c1nd connective tissue until patients die from respinr,ory
`or cardiac.: failure, usually before the third decade of
`lite (2]. A milder allelic form of fhe disease, called
`Becker muscular dystrophy (BMD), is associared with
`a range of phenotypes ranging from mi.l<l to severe
`(borderline DMD). BMD dystrophin mutations typically
`give 1. ise to shortened; in-frame transcripts a~~ociatt.'d with
`a dystrophin pn)1:ein of reduced quamicy or qu;Jl.iry [3.l.
`Gene therapy strategi~s for the- ueatment of DMD have
`so far been rnet with disappointment. Gene replace(cid:173)
`ment has been hindered by host immune responses to
`fir~r-generation viral vectors i 4]; naked plasmid DNA
`transfer by direct intramuscular injection ts inefficient [5];
`myoblast transfer and stem ce1l therapy have respec(cid:173)
`tively fought re overcome poor survival of tnmspla.nted
`cdls [6] and very limited cell recruitment [7]; homol(cid:173)
`ogous gene (utrophin) upreguhtion may not c:olocaHsl:'.·
`neuronal nitric. oxide synthasf. (nNOS) [S] or compensa.:{.'
`for the absence of the various isofonm. of dystrophin [9];
`gene repair strategies mediated by chimeric oligonu •
`deoti.des (10] or short fragment homologous re<:.Jmbi-•
`narion D l] are inefficient to date but offer potential for
`t.x vivo correction of host myoblasts; and aminogJyco(cid:173)
`side therapy l12] is only applicable to a small subset of
`(nonsense) mutations that cause the disease.
`Recent v:ork by our g:cmp [13] and others [14] has
`revealed the potential for an a!ter.narive strategy- for trear(cid:173)
`ir.g DMD utilising antisense oligoribonucleoLides (A.Os)
`to induce targeted removal of d.isease-•causing ex.ons
`from pre-mRNA transcripts dwing splicing. Unlike most
`other ant.ise.nsc applications whk:h aim to destroy specific
`i<NA targets, such as targeting oncogenes in. cancPr ther(cid:173)
`apy (1.5], produdng viable dystrophin mRNA capable of
`being translated into a semi-functional protein is manda(cid:173)
`tmy. For the application of AOs to DMD ro be successful,
`the chemistry of the AOs must be such ,har targeted
`degradation of dystrophi.n :nRNA is avo.ided. Inclusion
`of a phosphorothioate (PS) backbone retains the anionic
`charge and increases resistance to nucleases. More impor(cid:173)
`tantly, methylation of the 2' oxygen generates an RNA-like
`molecule that will eva<le RNase H mediated degradation
`of the target induced by DNA : RNA hybrids [16].
`Inducing succe~sful exon skipping rcqJires <le1.ivering
`21-0~rnerhylared PS AOs to the nudeus of muscle cells
`and their hybridi'iarion to sequence motifs involved in
`spli.cing. Blocking these sequences interferes with spliceo·
`some assem~ly, thereby redirecting the sp!idi1g process
`into excluding the undesirable exon and the flanking
`introns from the mature mRNA transcript.. AO-modified
`splicmg with therapeutic potential has been reported
`for the dystrophin pre-mRNA (13,14,17-19], for the,~(cid:173)
`globm transcripts i11 rhalas:,emia [20t .in survival motor
`neuron 2 (SMN2) pre-mRNA (211, as well as a crypci.c
`splice ~ite .mutation in the cystic fil,msis t.mnsmembran.e
`cr;nducmr regulator {CFI'R) gene amongst ot'hers [22].
`A" ...,.,15% of point mutations that cause genetic dise.::ise
`affect pre-mH 'lA splicing, it is probable that the num(cid:173)
`ber of diseases/mutations capable of being treated with
`
`this type of therapy will inr::rease as new mutadons are
`identified [23J.
`An AO-based approach to DMD therapy has a rrn.mber
`of advantages over other therapeutk techniques for DMD.
`In fact, many of lhe characteristics of the dyst.ropb.in gene
`that make fr a challenge to work with may be regarded as
`pos'tive features for an AO-based tr..:atment. For exanmle,
`the dysrrophin gene located on rhe short arm of th~ X
`chromosome is in excess of 2,4 Mb in size and 79 -:-·xons are
`processed inrn a 14•kh -rnRNA tran.scr.ipt thr-..t encodes the
`full•length 427-•kDa muscle••Specific. dystrophin i.soform.
`Thb mRNA transcript i&
`larger than th~ packaging
`size that c:an be acconunociated by most conventional
`viral vectors. To address this i'i'.me, various mini-gene
`con.strut.'ts [24,25] and 'gutless' viral vectors have been
`<leveloped which can tolern\:e increased pay loads as
`1,vclJ as minimise host response to viral proteins [26].
`Despite'. the c.ontinuing problems of immune responses to
`the viral vector [27,28] and sometimes the introduced
`and exnressed xenotic dystrophin [291, these ;nini-gene.~
`have largely been successful in restoring dystmphin
`synthesis and providing sorne phenotypic improvements
`to transduced mustie fibres, Mini.gene. experiments
`have uneqmvocaHy demonstrated rhe potential for 01\:10
`therapy to succe('.d a:nd have shown tha:. not all of the
`dystrophin protein is required to rest.ore its expression and
`iocalisation. to the san::olernma of muscle fibres. However.
`there are three n:ajor fulHength dystrophin products an~i.
`numerous smaller isoforms: arising from buth alternative.
`splidng and at least seven differenr promoters scartered
`throughout the gene [9]. Replacement of one form of
`dystrophin or homologous gene upregulation is unlikely
`to compensate for these other .isoforms. By contrnst, AO
`therapy would utilise the existing control elements and
`could simultaneously target. all isoforms affected by the
`mutation, assuming access of the small AO molecules to
`the relevant Uss.ues. O.ne limitation cf AO therapy is rhai(cid:173)
`it cannot completely eure DMD or restore the lost musde
`tissue and depleted muscle precursor cell-; (mpcs) that are
`responsible for muscle regeneration. However, if patients
`could be treated before excessive muscle damage has
`occi.1.rred, it is possible that demands on mpcs for repair
`could be reduced.
`Most studies of AO-based therapie.s for Dl\.1D have
`so far been confined to the m.dx mouse model of
`the disease, although recently van Deurekom et al. [14J
`reported the application of AO-based therapy to priMary
`human DMD muscle cultures. 1n this t1lrrt:rn: study, we
`havr used conditionrillylli)mortaliseil ¢ulture<l my6tub<,s
`d¢HYed from a H 21>'-t:i.1158 mdx rnousi, to <leni<iristtatt
`vast improvements to AO design and the efficiency cf
`induced exon skipping. We evaluated a number of AOs
`d.ircr..:ted against the 5: (dono: ) spliL-e site of intron. .23
`designed to induce specific removal of exon 23 which
`contains a nonsense mutation in the nut.-c mouse [30]. A
`ra.n~e of doses of AOs were delivered with the car.ionic
`Eposome. Lipofoctin and the cells were then assessed
`for the presence of transcripts skipping exon 23 by
`RT-PCR, and for the production of dystroph.in protein
`
`

`

`hy Western blotting. We show here that an AO as small
`as 17 nucleotides can induce strong and consistent exon
`skipp.ing and subsequent" dysuophin. protein synthesis.
`One AO could induce. dystrophin protein at a dose as low
`as 5 nM. This dos€
`is orders of magnitude lowe1 than
`reported to cause exon skipping in om laboratory [13]
`and elsewhere [14,17].
`
`Materials and methods
`AO design
`
`VVe have adopted a nomenclature for naming AOs
`targeted againsr dystrophin pre--mR.i'\A that provides
`
`C. J. Mann et al.
`
`information about species specificity, the target site
`relative to the target exon and the exact annealing
`position (and thereby Uw AO :iize). Each AO name can be
`divided into two parts1 a descriptive component and an
`exact coordinate position, as suTllinarised !n Figure lA.
`A more detailed explanation of the nomenclature can
`be found on the Internet [31]. All AOs were 2'·
`O•me.thylphosphorothioatt molecules synthesised and
`HPLC-pw:ified by Gene works (Adelaide, Australia), The
`scqiwnce for intron 23 (Genbank accession .AF062380)
`was used to design the sequences, which are shown
`schematically in Figure lB. Several of the AOs have been
`described previously [13.l 9] and have been renamed here
`according to the nomenclature.
`
`A
`
`3' (A)cceptor or
`5' (D)onor splice site
`
`/
`Species:
`H
`A
`__ r-M1 r231101 1 (±xx ±yy) 1--
`H Homo sapiens
`L'.:J --~--l •·•·• ......... ., ..... --·•
`Mus muscul us
`M
`C = Canis familiaris
`C
`\
`exon number
`
`coordinates:
`x = first 5' base
`y = final 3' base
`+ = exonic position
`intronic position
`
`B
`
`Exon 23
`
`Intron 23
`
`+20
`..-10
`+01 -01
`-10
`-20
`-30
`I
`I
`I
`I
`I
`I
`I
`5'- ATAAACTTCGAAAATTTCAG gtaagccgaggtttggcctttaaactatat -3'
`UUUGAAGCUUlI'JAAAGUC ca
`GCUUUUAAAGUC cauucggc
`GCUUUUAAAGUC cauucggcuccaa
`UC cauucggcuccaaaccgg
`auucggcuccaaaccgg
`uuucggeuccaaac
`cggcuccaaaccgg
`uccaaaccggaaauuugaua
`
`M23Dt+ia-o::n
`M23D(+l2·08)
`M23D(+12·13)
`M23D(+02-l8)
`M23D (-02•18)
`M23D (-02·15)
`M23D ( ·05•18)
`M23D (-09-28)
`
`C
`
`i=59bp
`O=l85bp
`
`181bp
`
`146bp
`
`213bp
`
`ll4bp
`
`156bp
`
`i•32bp
`o=l02bp
`
`Figure 1. Nomenclature, sequence and location of antisense. oJigonucleotldes and PCR primers. (A) Proposed nomenclature for the
`naming of AOs targeted against dystrophh1 pre-inRNA ls divided into four parts: species, exon, (D)onor or (A)cc:eptor split.-e site
`and coordinates of the target site relative to the preAmRNA sequence. (B) Sequences and schematic allgnment.~ of the AOs targeted
`against the donor splice site of intron 23 of mouse dystrophin with detail& of the numbering employed to assign the AO coordinates,
`Exonic bases are 1n upper case and are assigned poi,itive ( +} numbers; intronic bases are in lower case and assigned negative
`(-) numbers. M23D(+12-08) was previously named AO 5'SS-20 [19]; M23D(+12-13) was previously named AO S'SS-25 [13]. All
`other AOs have not been previously reported. Sense and scrambled AOs designed as controls for M23D{+02~18) were also utilised
`and had the following sequences (5' - 31 ) AGGUAAGCCGAGGUUGGCC and CCUAUCGGCUCACAACCGUG, respectively. (C) Relative
`location of PCR primers and exon sizes for prediction of induced products: exons are represented by boxes and introns by lines
`{not to .scale). Exon sizes in base pa.irs are indicated. Inner (i) end outer (o) nested PCR primers amplify only a portion of exon 20
`or 26, which are also indicated. The sequence of PCR ptimers has been reported previously [13]
`
`ft
`
`~pyright '!!'! 20~2 John Wiley & ~ons, Ltd.
`
`Co.P.:rri.~l?-t e 2002 John wu_ey & ScJJ~ l.td.
`
`Figure 2. Detection of AO-Induced dystrophin mRNAs skipping exon 23 by nested RT-PCR. Cultured H-2Kb·tsAS8 mdx cells were
`tra.nsfucted with 1 l,lg of the respective AO complexed with Upofectin as described. PCR primers amplified products from within
`exons 20 and 26. FulUength unsktpped {901 bp) mRNA was amplified from all ceU extracts but not the PCR negative (-ve) control.
`Smaller products corresponding to ex.on 23 (688 bp) and exon 22 and 23 removal (550 bp} were detected In total RNA extracts from
`cells transfeeted with M23D( +02-18), M23D(--02-18) and M23D( + 12· 13). No other A Os or controls were able to induce consistent
`exon skipping. 1'he gel image represents .the PCR products after S 1 nuclease digestion oo remove ht.>t:eroduple.xe.s
`
`•• . ,
`
`1'-0
`
`••
`
`< ' ..,
`
`< ,
`
`...
`
`Improved Oystrophln Exon Skipping
`
`Cell culture and transfection
`
`H-2K'-tsA58 (H-2K) normal and mdx ceils were cultured
`exactly a& descri.bed previously [13]. Tram;fections were
`carried out as Follows. Complexes of Llpofeccin (Life
`Technologies, Melbourne, Australia) and AO were always
`prepared
`in a 2 : 1 Lipofectin/AO ratio (w/w)
`in
`serum-free Opti-MEM (Life Technologies) according ro
`the manufacturer\ instructions, and, unless specified,
`trnnsfections utilised 1 µg oi AO ( ~300 nM), For the
`titration experiments (Figure 3), the amount of AO and
`consequently l.ipofectin wai.: varied ac.cor<ling to the· dose,
`although the ratic was always maint,ained at 2: l (w/w).
`In a'l experiments, cells were exposed to AO/Lipofecrin
`complexes for :i h in serum-free Opti-MEM, after which
`the media was replaced with DMEM supplemented with
`5% horse serum. For the standard transfections and
`titrations (Figures 2 and 3. respectively), H-2K mdx cells
`were transfected 48 h after plating in a total volume
`of