VOLUME 28 NUMBER 6 MARCH 15, 2000
`
`Nucleic Acids
`----------- Research
`
`OXFORD UNIVERSITY PRESS
`
`ISSN 0305 1048 Coden NARHAD
`
`

`

`Nucleic Acids Research
`Contents
`
`Volume 28 number 6, March 15, 2000
`
`SURVEY AND SUMMARY
`Transcription by RNA polymerases I and III
`
`RNA
`
`Cold shock induces the insertion of a cryptic exon in
`the neurofibromatosis type 1 (NFl) mRNA
`
`Interaction of the yeast DExH-box RNA helicase
`Prp22p with the 3' splice site during the second step
`of nuclear pre-mRNA splicing
`
`Characterisation of the U83 and U84 small nucleolar
`RN As: two novel 2' -O-ribose methylation guide RN As
`that lack complementarities to ribosomal RNAs
`
`Modified constructs of the tRNA T'¥C domain to
`probe substrate conformational requirements of m 1 A58
`and m5U54 tRNA methyltransferases
`Characterization of a cis-acting regulatory element in
`the protein coding region of thymidylate synthase
`mRNA
`
`A new double-stranded RNA-binding protein that
`interacts with PKR
`
`MOLECULAR BIOLOGY
`
`lntronic GIY-YIG endonuclease gene in the
`mitochondrial genome of Podospora curvicolla:
`evidence for mobility
`
`Interactions of the human, rat, Saccharomyces
`cerevisiae and Escherichia coli 3-methyladenine-DNA
`glycosylases with DNA containing dIMP residues
`
`Effects of RNA secondary structure on cellular
`antisense activity
`
`Identification of human MutY homolog (hMYH) as a
`repair enzyme for 2-hydroxyadenine in DNA and
`detection of multiple forms of hMYH located in nuclei
`and mitochondria
`
`Assembly of archaeal signal recognition particle from
`recombinant components
`
`Different roles for Abflp and a T-rich promoter
`element in nucleosome organization of the yeast
`RPS28A gene
`
`M.R.Paule and R.J.White
`
`1283- 1298
`
`E.Ars, E.Serra, S.de la Luna, X.Estivill and C.Lazaro
`
`1307-1312
`
`D.S.McPheeters, B.Schwer and P.Muhlenkamp
`
`1313-1321
`
`B.E.Jady and T.Kiss
`
`1348-1354
`
`R.Sengupta, S. Vainauskas, C. Yarian, E.Sochacka,
`A.Malkiewicz, R.H.Guenther, K.M .Koshlap and P.F.Agris
`
`1374- 1380
`
`X.Lin, L.A.Parsels, D.M.Voeller, CJ.Allegra, G.F.Maley,
`F.Maley and E.Chu
`
`138 1- 1389
`
`CJ.Coolidge and J.G.Patton
`
`1407- 1417
`
`C.Saguez, G.Lecellier and F.Koll
`
`M.Saparbaev, J.-C.Mani and J.Laval
`
`TA.Vickers, J.R.Wyatt and S.M.Freier
`
`T.Ohtsubo, K.Nishioka, Y.Imaiso, S.lwai, H.Shimokawa,
`H.Oda, T.Fujiwara and Y.Nakabeppu
`
`1299- 1306
`
`1332-1339
`
`1340-1347
`
`1355-1364
`
`S.H.Bhuiyan, K.Gowda, H.Hotokezaka and C.Zwieb
`
`1365- 1373
`
`R.F.Lascaris, E.de Groot, P.-8 .Hoen, W.H.Mager and
`R.J.Planta
`
`M Determination of Ll retrotransposition kinetics in
`cultured cells
`
`E.M.Ostertag, E.T.Luning Prak, R.J.DeBerardinis,
`J.V.Moran and H.H .Kazazian Jr
`
`Requirement for PCNA and RPA in interstrand
`crosslink-induced DNA synthesis
`
`L.Li , C.A.Peterson, X.Zhang and R.J.Legerski
`
`1390-1396
`
`1418- 1423
`
`1424-1427
`
`Continued
`
`

`

`Volume 28 number 6, March 15, 2000
`
`J .Lin and Y.M.Yogt
`
`1428- 1438
`
`A.Santel, ).Kaufmann , R.Hyl and and R.Renkawitz- Pohl
`
`1439-1446
`
`J.Tong, F.Barany and W.Cao
`
`N.S.Patil and K.M.Karrer
`
`1447- 1454
`
`1455-1464
`
`1465-1472
`
`Contents (Continued)
`
`Functional a-fragment of P-galactosidase can be
`expressed from the mobile group I intron PpLSU3
`embedded in yeast pre-ribosomal RNA derived from
`the chromosomal rDNA locus
`The initiator element of the Drosophila {12 tubuli11 gene
`core promoter contributes to gene expression in vivo
`but is not required for male germ-cell specific
`expression
`
`Ligation reaction specificities of an NAD + -dependent
`DNA Iigase from the hyperthermophile Aquifex
`aeolicus
`
`A developmentally regulated deletion element with
`long terminal repeats has cis-acting sequences in the
`flanking DNA
`
`Cloning and characterisation of the Sry-related
`transcription factor gene Sox8
`
`Species-specific regulation of alternative splicing in the
`C-terminal region of the p53 tumor suppressor gene
`
`GENOMICS
`
`Genome sequences of Chlamydia trachomatis MoPn
`and Chlamydia pneumoniae AR39
`
`STRUCTURAL BIOLOGY
`
`S The solution structure of [d(CGC)r(aaa)d(TTTGCG)h:
`hybrid junctions flanked by DNA duplexes
`
`COMPUTATIONAL BIOLOGY
`Analysis of the yeast transcriptome with structural
`and functional categories: characterizing highly
`expressed proteins
`
`Author index
`
`M, contains a novel method
`
`S, supplementary material available at NA R Online
`
`M Pre-selection of integration sites imparts repeatable
`transgene expression
`
`H.Wall ace, R.Ansell , J.Clark and J.McWhir
`
`G.E.Schepers, M.Bullejos, B.M.Hosking and P.Koopman
`
`1473- 1480
`
`M.Laverdiere, J .Beaudoin and A.Lavigueur
`
`1489- 1497
`
`T.D.Read, R.C. Brunham, C.Shen, S.R.Gill , J.F.Heidelberg,
`0 .White, E.K.Hickey, I .Peterson, T.Utterback, K.Berry,
`S.Bass, K.Linher, J.Weidman, H.Khouri , B.Craven,
`C.Bowman, R.Dodson, M.Gwinn, W.Nelson, R.DeBoy,
`J .Kolonay, G.McClarty, S.L.Sal zberg, J.Eisen and
`C.M.Fraser
`
`1397- 1406
`
`S.-T.Hsu, M.-T.Chou and J.-W.Cheng
`
`1322- 133 1
`
`R.Jansen and M.Gerstein
`
`1481- 1488
`
`NAR Methods Online
`
`(http://www. nar. oupjou rnals.org/methods)
`
`A rapid genetic screening system for identifying gene(cid:173)
`specific suppression constructs for use in human cells
`
`Endogenous oxidative DNA base modifications
`analysed with repair enzymes and GC/MS technique
`
`G.M.Arndt, M.Patrikak.i s and D.Atkins
`
`P.Jaruga, E.Speina, D.Gackowski , B.Tudek and R.Olinski
`
`e l5
`
`e l6
`
`

`

`Subscriptions
`
`Nucleic Acids Research is publi hed twice monthly (24 issues). Subscriptions
`are entered on a calendar year basis only and are available as a printed version
`(including online access) or as online access only at a discount of LO% (+VAT
`in UK). Prices include postage by surface mail or, for ubscribers in the USA
`and Canada by air freight, or in lndia, Japan, Australia and ew Zealand, by
`Air Speeded Post. Airmail rates are avai lable on request.
`
`Annual subscription rate (Volume 28, 2000):
`lnstit111io11al
`Print and Online site licence: UK and Europe£ I 065, Rest of World $ 1845.
`Personal
`Print and Online: UK and Europe £295, Re t of World $455.
`Back volume prices are available o n request. Please add ales tax to the prices
`quoted.
`
`Orders. Orders and payments from, or on behalf of, subscribers in the various
`geographical areas shown below should be sent to the Press office indicated.
`
`The Americas: Oxford University Press Inc., 200 1 Evans Road, Cary, NC
`275 13, USA.
`
`Japan : available from the following agents:
`Kinokuniya Company Ltd, Journal Department, PO Box 55, Chitose, Tokyo,
`156 Japan.
`Maruzen Company Ltd, Journal Division, PO Box 5050, Tokyo International,
`I 00-3 1 Japan.
`Usaco Corporation, 13- 12, Shimbashi 1-chome, Minato-ku, Tokyo, I 05 Japan.
`
`Rest of the World: Journals Subscriptions Department, Oxford University Press,
`Great Clarendon Street, Oxford OX2 6DP, UK.
`Tel: (+441 865 or 01865) 267907; Fax: (+441 865) 267485;
`Email: jnl.orders@oup.co.uk
`
`Advertising. To advertise in Nucleic Acids Research contact Oxford University
`Press (US office) in the Americas or Oxford University Press (U K office) in
`the Rest of the World (see addresses above).
`
`© Oxford Univer ity Pre s 2000. All rights reserved; no part of this publication
`may be reproduced, stored in a retrieval system, or transmitted in any form or
`by any means, electronic, mechanical, photocopying, recording, o r otherwise
`without either prior written permission of the Publishers, or a licence permitting
`restricted copying issued in the UK by the Copyright Licensing Agency Ltd,
`90 Tottenham Court Road, London WfP 9 HE, or in the USA by the Copyright
`Clearance Center, 222 Rosewood Drive, Danvers, MA 01923, USA. For those
`in the US/Canada not registered with CCC, articles can be obtained by fax in
`48 hours by calling: WJSE for Medicine™ i-800-667-WlSE.
`
`Back volumes of this journal are available in 16 mm microfilm, 35 mm microfilm
`and 105 microfiche from Uni versity Microfilms lnternational, 300 orth Zeeb
`Road, Ann Arbor, Ml 48106- 1346, USA. Copies of articles published are also
`available from UMI.
`
`Nucleic Acids Research (ISSN 0305- 1048) i published twice monthly by
`Oxford University Press, Oxford, UK. Annual sub cription price is US$ I 845.
`Nucleic Acids Research is distributed by Mercury International, 365 Blair
`Road, Avenel, NJ 0700 1, USA. Periodical postage paid at Rahway, NJ, USA
`and additional entry points.
`
`US POSTMASTER: send address change to Nucleic Acids Research, clo Mercury
`International, 365 Blair Road, NJ 0700 I, USA.
`
`Printed by Information Press Ltd, Oxford, UK on acid-free paper.
`
`Cover: Na cent transcripts made by RNA polymerases I and III (respectively, red and blue) were labelled with Br-UTP in the
`presence of 2 µg/rnJ a -amanitin, and immunolabelled with gold particles as described in Pombo et al. ( 1999) EMBO J., 18, 2241- 2253.
`Gold particles (5 nm) were overlaid with a circle 6 times their size to allow identification at this low magnification. Image
`corresponds to an area of 3.8 x 4.0 µm 2. For further details see the paper by Paule and White in this issue: Nucleic Acids Res. (2000)
`28, 1283- 1298.
`
`Acknowledgement
`Figure provided by Drs Ana Pombo and Peter Cook, of the Sir William Dunn School of Pathology, University of Oxford, South
`Parks Road, Oxford OXl 3RE, UK.
`
`

`

`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`1340-1347 Nucleic Acids Research, 2000, Vol. 28, No. 6
`
`© 2000 Oxford Unive rsity Press
`
`Effects of RNA secondary structure on cellular antisense
`activity
`
`Timothy A. Vickers*, Jacqueline R. Wyatt and Susan M. Freier
`
`Isis Pharmaceuticals, Department of Molecular and Structural Biology, 2280 Faraday Avenue, Carlsbad, CA 92008, USA
`
`Received December 9, 1999; Revised and Accepted January 26, 2000
`
`ABSTRACT
`
`The secondary and tertiary structures of a mRNA are
`known to effect hybridization efficiency and potency
`of antisense oligonucleotides in vitro. Additional factors
`including oligonucleotide stability and cellular
`uptake are also thought to contribute to antisense
`potency in vivo. Each of these factors can be affected
`by the sequence of the oligonucleotide. Although mRNA
`structure is presumed to be a critical determinant of
`antisense activity in cells, to date little direct experi(cid:173)
`mental evidence has addressed the significance of
`structure. In order to determine the importance of
`mRNA structure on antisense activity, oligonucleotide
`target sites were cloned into a luciferase reporter
`gene along with adjoining sequence to form known
`structures. This allowed us to study the effect of
`target secondary structure on oligonucleotide
`binding in the cellular environment without changing
`the sequence of the oligonucleotide. Our results
`show that structure does play a significant role in
`determining oligonucleotide efficacy in vivo. We also
`show that potency of oligonucleotides can be
`improved by altering chemistry to increase affinity
`for the mRNA target even in a region that is highly
`structured.
`
`INTRODUCTION
`
`implies, antisense oligonucleotides must
`the name
`As
`hybridjze to their target mR A to specifi call y degrade the
`mRNA, u ual ly via a R Nase H-dependent mechanism ( I).
`Thus, for an anti en e oligonuc leotide to be effecti ve, the
`complementary target seq uence must be avai lable fo r hybridi(cid:173)
`zatjon. This js not always the case as the RNA target is not a
`single-stranded random coil but contajns secondary and
`terti ary structures that have been shown to affect the affi nity
`and rate of oligonucleotide hybri dization (2- 6). The antisen e
`oligonucleotide may also need to compete with proteins th at
`bind to the same site on the message (7).
`Several factors are thought to influence antisense acti vity in
`cell culture and in vivo. These include chemi cal stability of the
`oligonucleotide (8), secondary structure of the oligonuc leotide
`(9), oligonucleotide deli very and bioavailablity (I 0) and the
`
`prox imity of the binding site to a fun cti onal site on the RNA
`uch as the CAP or tran lati onal start site ( 11 ). The potency of
`an antisense oligonucleotide may also depend on the type of
`cell being targeted (12- 14).
`Identi ficati on of pote nt antisense sequences has often been
`ba ed upon empirical approaches to oligonucleotide selecti on
`because the optimal target site on the mRNA cannot yet be
`predicted. M any inve ti gators employ oligonuc leotide ' walks' ,
`pac ing oligonucleotides of a given length at intervals along
`the RNA and choosing the one with the most acti vity (15- 2 I). It
`i general ly assumed that acti ve oligonucleotide are hybridizing
`to sequences that are available due to lack of secondary struc(cid:173)
`ture at the target site, however, to date little direct informati on
`ha been gathered on the effect of RNA secondary structure on
`hybridi zation of antisense oligonuc leotides in cells. Wh ile
`oligonuc leotides have been targeted to known structures with
`vary ing degree of succes
`(7,22-24), in al l of these cases
`acti vity was optimized by testing numerous oligonucleotides
`shifted either 5' or 3' of the initial site. These ex periments
`change not only the target site on the mRNA, but also the
`sequence and base composition of oligonucleotides. Any or all
`of these changes mi ght affect oligonuc leotide potency.
`In this study, we changed the strncture surrounding particular
`oligo nuc leotide target
`ites so that the same oligonucleotide
`could be used to evaluate binding to target ite
`in the context
`of varying degrees of structure. Thi s strategy abolished any
`effect that might be caused by changing the proximity of the
`oligonucleotide bindi ng site to fun cti onal sites on the message.
`More importantly, any effects due to sequence and base
`composition of the oligonucleotide were eliminated, permitting
`direct evaluation of the contribution of RNA target structure to
`antjsense potency . Resul ts suggest that structure in the target
`mRNA does indeed have a significant and predictable effect on
`antisense activity.
`
`MATERIALS AND METHODS
`
`Oligonucleotide synthesis
`
`Synthesis and puri ficati on of unmodi fied deoxypho phoro(cid:173)
`thi oate or chimeric deoxypho phorothioate/2'-O-methoxyethyl
`base oligonucleotides was performed u ing an Applied Biosystems
`380B automated DNA sy nthesizer as previously described
`(25). Sequences of oligonucleotide and pl aceme nt of 2'-O(cid:173)
`methoxyethyl modi ficat ions are detai led in Table I.
`
`*To whom correspondence should be addressed. Tel: + I 760 603 2367: Fax : + I 760 93 1 0209; Email : tvickers@ isisph.com
`
`

`

`Construction of luciferase expression clones
`
`DNA sequences encoding various oligonucleotide target sites
`and surrounding RNA structure were cloned into the luciferase
`expression vector pGL3-Control (Promega). For 5'-untranslated
`region (UTR) insertions, unique HindJil and Ncol sites in the
`vector were employed. Cleavage with the two enzymes
`releases a small portion of the 5'-UTR without affecting the
`promoter or the luciferase coding region. Inserts were prepared
`by annealing cDNA oligonucleotides containing the target
`sequences for known active antisense oligonucleotides and
`additional sequence necessary to form various RNA secondary
`structures. For cloning of 5132-S20 the following oligonucleotides
`were annealed at a concentration of 2 µg/µI by slow cooling
`from 95°C in lx ligase buffer (30 mM Tris- HCI pH 7.8, 10 mM
`MgCl 2): AGCTIGGCA TICCGGTGTAATGCA TGTCACA(cid:173)
`GGCGGGA TTCGTCCCGCCTGTGACA TGCA TTTGTTG(cid:173)
`GTAAAGAATTC and CATGGAATTCTTTACCAACAA(cid:173)
`A TGCATGTCACAGGCGGGACGAATCCCGCCTGTGAC(cid:173)
`A TGCA TT ACACCGGAATGCCA. This produces a double-
`tranded DNA fragment with a Hindill-compatible sticky 5'-end
`and an NcoI-compatible overhang on the 3'-end. An EcoRI site
`was also included near the 3'-end to allow analysis following
`cloning. The 5132 oligonucleotide target site is in bold. The
`insert was then diluted to 25 ng/µI and ligated into the pGL-3
`vector prepared as described above. Transformants were
`checked for the proper insert by digesting with Xbal and
`EcoRI, which release a 1600 bp digestion product unique to
`plasmids with inserts. The following oligonucleotide pairs
`were used
`to construct the remaining clones. 5132-S0,
`AGCTIGGCAITCCGGTACAATGCATGTCACAGGCG(cid:173)
`GGAGAA TIC and CATGGAA TTCTCCCGCCTGTGACA(cid:173)
`TGAATTGTACCGGAATGCCA ; 5132-S20-10-3, AGCIT(cid:173)
`CGGAGGACATGCAITGAACGTCGATTTCGATCGACG(cid:173)
`TTCAATGCATGTCACAGGCGGGACATGTTGGTAA(cid:173)
`AGAATTCandCATGGAATTCTTTACCTTCATGTCCCG(cid:173)
`CCTGTGACATGCATTGAACGTCGATCGAAATCGACG(cid:173)
`TTCAATGCATGTCCTCCGA; 5 l 32-S20- I 0-5, AGCTIGG(cid:173)
`CA ITCCGGTACAATGCATGTCACAGGCGGGAATCG(cid:173)
`ACGTTCTTCGGAACGTCGATTCCCGCCTGTGAAITC
`and CATGGAA TICACAGGCGGGAATCGACGTICCGAA(cid:173)
`GAACGTCGA ITCCCGCCTGTGACATGCA ITGT ACCG(cid:173)
`GAATGCCA;
`5132-Sl0-14, AGCITGGCATICCGGT(cid:173)
`ACAATGCATGTCACAGGCGGGAITCGGACATGCA(cid:173)
`TTGT ACCGTAAAGAA ITC and CATGGAA ITCTTT AC(cid:173)
`GGT ACAATGCATGTCCGAATCCCGCCTGTGACATGC(cid:173)
`ATTGTACCGGAATGCCA; 5132-Sl0-4, AGCITGGCAT(cid:173)
`fCCGGTACAATGCATGTCACAGGCGGGAITCGTCC(cid:173)
`CGCCTGITGGT AAAGAA ITC and CA TGGAA TTCTTT(cid:173)
`\CCAACAGGCGGGACGAA TCCCGCCTGTGACATGC(cid:173)
`I\ TTGT ACCGGAA TGCCA; 2302-S20, AGCTTGAAAAG(cid:173)
`TTCGT ACTGACGGA TGCCAGCTTGGGCTTCGGCCC(cid:173)
`AAGCTGGCATCCGTCATGITGGTAAAGAATTC
`and
`~ATGGAAITCTTTACCAACATGACGGATGCCAGCIT(cid:173)
`J GGCCGAAGCCCAAGCTGGCATCCGTCAGTACCGGA(cid:173)
`I\ TGCA; 2302-S0, AGCITGAAAAGTTCGT ACTGACGG(cid:173)
`ATGCCAGCTTGGGCTTCGCT AGACGGCGCTCTACA(cid:173)
`CGCTGTTGGT AAAGAA ITC and CATGGAA TTCTTT A(cid:173)
`~CAACAGCGTGTAGAGCGCCGTCTAGCGAAGCCCAAG(cid:173)
`t GGCATCCGTCAGT ACGAACTTTTCA; 18 l 19-S20, AGC(cid:173)
`TTGGCA TTCCGGTGTTGACACAAGA T AGAGTT AAC-
`
`Nucleic Acids Research, 2000, Vol. 28, No. 6 1341
`
`ITCGGITAACTCTATCTTGTGTCATGTTGGTAAAGA(cid:173)
`A TIC and CATGGAA ITCTTT ACCAACATGACACAA(cid:173)
`GAT AGAGTTAACCGAAGITAACTCT ATCITGTGTC(cid:173)
`AACACCGGAATGCCA; 18119-S0, AGCTIGGCA TICC(cid:173)
`GGTGTTGACACAAGATAGAGTTAACITCGATCAAA(cid:173)
`TCGATGIT ATGCCA TGTIGGT AAAGAA TIC and CATG(cid:173)
`GAA ITCTTT ACCAACA TGGCA T AACA TCGA TITGATC(cid:173)
`GAAGTIAACTCTATCTIGTGTCAACACCGGAATGCCA.
`The XbaI site in the 3'-UTR of the pGL-3 plasmid was also
`used for certain constructs. In this case, the plasmid was cut to
`completion with the enzyme, then treated with alkaline phos(cid:173)
`phatase. Oligonucleotides were synthesized to include the
`target site and surrounding structure as above and, in addition,
`an EcoRI site was included near the 5'-end of the insert. When
`annealed, both ends of the insert have overhangs compatible
`with Xbal. Oligonucleotides were synthesized with 5'-terminal
`phosphates
`to allow
`ligation
`to
`the phosphatase-treated
`plasmid. Orientation of the insert was evaluated by digestion
`with EcoRI and Hpal , which cut 160 bp downstream of the
`Xbal site. 3'-5132-S20, CTAGAATCCCTTTCGGACAATG(cid:173)
`CATGTCACAGGCGGGATTCGTCCCGCCTGTGACAT(cid:173)
`GCA TITGCT AGT AA TGAA TIT and CT AGAA A TICA T(cid:173)
`T ACTAGCAAATGCATGTCACAGGCGGGACGAATCC(cid:173)
`CGCCTGTGACATGCA ITGTCCGAAACCAA IT; 3'-5132-
`S0, CT AGAA ITCCTTTCGGACAATGCA TGTCACAGG(cid:173)
`CGGGATTCGTTCTGACAGACT ACTCAGGITGCT AGT(cid:173)
`AATGAATIT and CTAGAAATTCATTACTAGCAACCT(cid:173)
`GAGTAGTCTGTCAGAACGAATCCCGCCTGTGACATG(cid:173)
`CA TTGTCCGAAACCAA TT.
`
`RNA folding and t:i.G calculations
`RNA structures were predicted for each insert described above
`using RNAStructure 2.52. (26-29). The entire luciferase RNA
`with modified 5'-UTR was also folded for each construct to
`confirm the absence of long range interactions that might
`affect local
`tructure in the 5'-UTR. Overall stability of the
`oligonucleotide-RNA duplex formation was calculated using
`OligoWalk (30,31). The input RNA for this calculation was the
`fragment inserted between the HindIII and Ncol sites for each
`target. The overall t:i.G37 ° computed is the sum of the unfavorable
`free energy required to open the RNA base pairs at the oligo(cid:173)
`nucleotide binding site, the unfavorable free energy required to
`break up secondary structure in the oligonucleotide and the
`favorable free energy for pairing the antisense oligonucleotide
`to the target RNA. Thermodynamic parameters are not available
`for predicting secondary structure or hybrid duplex stabilities
`for modified oligonucleotides so DNA parameters were u ed
`for the unmodified deoxyphosphorothioate oligonucleotides
`and RNA parameters for the chimeric deoxyphosphorothioate/
`2'-O-methoxyethyl base oligonucleotides. Because the same
`oligonucleotide was used with each structure studied, any
`errors introduced by this approximation would contribute a
`constant free energy and would not affect relative values.
`
`Luciferase assays
`Plasmid (IO µg) was introduced into COS-7 cells at 70%
`confluency in a 10 cm dish using SuperFect Reagent (Qiagen).
`Following a 2 h treatment, cell were trypsinized and split into
`a 24-well plate. Cells were allowed to adhere for I h, then
`oligonucleotide was added in the pre ence of Lipofectin
`Reagent at 3 µg/ml/100 nM oligonucleotide. All oligonucleotide
`
`

`

`1342 Nucleic Acids Research, 2000, Vol. 28, No. 6
`
`treatments were done in duplicate or triplicate. Following the
`4 h oligonucleotide treatment, cells were washed and fresh
`DMEM + I 0% FCS was added. The cells were incubated over(cid:173)
`night at 37°C. The follow ing morning cells were harve ted in
`150 µI of Passive Lysis Buffer (Promega). An aliquot of 60 µI
`of lysate was added to each well of a black 96-well plate then
`50 µI Luciferase Assay Reagent (Promega) was added .
`Luminescence was measured using a Packard TopCount. Error
`bars represent the standard deviation from the mean of at least
`two independent oligonucleotide treatments.
`
`A
`
`B
`
`SV40 pm, --(cid:173)Hindxcol
`
`~-~ ~-~
`
`( target/structure sequence\
`
`Poly(A) ---
`
`Xbal
`
`RNA analysis
`
`R A levels were evaluated for each plasmid construct by
`northern analysis. Aliquots of 3 µg of each luciferase plasmid
`construct were co-transfected into cells along with 2 µg of
`pcmB7-2, a plasmid expressing murine B7-2 under control of
`the CMV promoter, usi ng SuperFect Reagent (Qiagen). After
`2 h the plasmid was removed and the cells incubated for an
`additional 4 h in complete medium. Total RNA was harvested using
`a ToTALLY RNA kit (Ambion) according to the manufacturer's
`protocol. RNA was separated on a 1.2% agarose gel containing
`1.1 % formaldehyde, then transferred to nylon membranes.
`Blots were hybridized with [32P]dCTP random prime labeled
`cDNA probes specific for luciferase and murine B7-2 for 2 h in
`Rapid-hyb solution (Amersham). Blots were washed with 2x
`SSC containing 0.1 % SDS at room temperature, foll owed by
`0.1 x SSC containing 0.1 % SDS at 60°C. Quantitation of RNA
`expression was performed using a Molecular Dynamics
`Phosphorimager.
`
`Synthesis of S20 RNAs for binding and RNase H experiments
`
`Forty-four base RNAs were synthesized from oli gon ucl eotide
`templates with T7 RNA polymerase. The bottom strand oli go(cid:173)
`nucleotides were complementary to the 44 bases of each stem(cid:173)
`loop fo llowed by sequence complementary to the T7 promoter
`at the 3'-end. These were annealed with a 22 base ol igo(cid:173)
`nucleotide corresponding to the T7 promoter (AA TTI A(cid:173)
`ATACGACTCACT ATAG) at a concentration of 100 µMeach
`strand in Ix T7 buffer. The partially si ngle strand template was
`used at 6 µM in a 20 µI reaction using a MaxiScript T7
`polymerase kit (Ambion) and [o:-32P]UTP. After 1 h incubation at
`37°C, the RNAs were purified by gel electrophoresis. Unlabeled
`RNAs were also produced using a T7 MegaShortScript kit
`(Ambion) according to the manufacturer's protocol. 5132 T7
`template, AA TGCATGTCACAGGCGGGACGAA TCCCGC(cid:173)
`CTGTGACATGCATTCCCT AT AGTGAGTCGT ATT AAATT;
`2302 T7 template, TGACGGATGCCAGCTTGGGCCGAA(cid:173)
`GCCCAAGCTGGCATCCGTCACCCT ATAGTGAGTCGT(cid:173)
`ATTAAATT.
`For the structured RN As, RNase H activity was determjned
`by combining the cold structured target RNA at 5 µM and
`25 000 c.p.m. of the labeled target RNA with 1 or 10 µM anti(cid:173)
`sense oligonucleotide in 10 µI of Ix RNase H assay buffer
`(20 mM Tris- HCI pH 7.5, 10 mM MgC1 2, 0.1 mM EDTA,
`0.1 mM DTT). Reactions were incubated for 3 h at 37°C. Aliquots
`of 0.5 U of Escherichia coli RNase H (US Biochemical) were
`added and the reaction incubated for an additional 20 min at
`the same temperature. Reactions were then heated to 90°C for
`2 min prior to separating products on a I 0% polyacrylamide
`gel with 50% (w/v) urea.
`
`S20
`
`so
`
`S2010-5'
`
`S2010-3'
`
`S10L4
`
`S10L14
`
`Figure l. (A) Cloning vector pGL3-Control. Modified 5'- and 3'-UTR
`seque nces were cloned into either the Hindlll and Nea l sites (5'-UTR) or the
`Xba l site as detailed in Materials and Methods. (B) Predicted structures of the
`resultin g target sequences. Bold lines represent the oligonucleotide binding
`site, thin dashed lines represent sequence complementary to the oligonucleotide
`binding site.
`
`Complementary 20 base RNAs were synthesized for each
`target at Genset (Paris). The RN As were radioactively labeled
`with [y-33P]ATP using polynucleotide kinase; labeled RNAs
`were purified on an acrylamide gel. Binding of oligonuc leotide
`to complement was determined by gel mobility shift assay.
`33P-end-labeled RNA (100 000 c.p.m.) was incubated with
`complementary oli gon ucleotide and I 00 ng of tRNA carrier in
`l x RNase H buffer for 1 h at room temperature. Bound was
`then separated from unbound by electrophoresis on a 12%
`native acrylamjde gel run in 1 x TBE at a constant power of
`10 Wat 4°C.
`
`RESULTS
`
`Effect of target structure
`
`In order to evaluate the effect of structure in the mRNA target on
`activity of an antisense oligonucleotide in cells, the structural
`context of tbe target site was altered. The binding site for a
`previously identified antisense oligonucleotide (ISIS 5132)
`which inhibits the expression of human c-raf kinase ( 15) was
`cloned into the 5'-UTR of the luciferase reporter plasmid
`pGL3-Control as detailed in Materials and Methods. ·sequence
`immediately adjacent to the target equence was altered as
`outlined in Figure 1 to form various predicted RNA secondary
`structures that included the 5132 target sequence. These structures
`ranged from one in which the entire target site was sequestered
`in a 20 base stem closed by a UUCG tetraloop (S20) to one that had
`little predicted secondary structure likely to inhibit hybridization of
`5132 to its target (SO). Like the S20 construct, S20- I 0-5 also
`had a 20 base stem with a tetraloop, however, only IO bases of
`the target site were contai ned within the stem on the 5'-side.
`S20- I 0-3 was similar except that the target site was on the 3'-side
`of the stem; thus the opposite half of the target site was
`contained in the stem. S 10-L4 has a 10 ba e stem complementary
`to the 5' -half of the oli gonucleotide with a tetraloop, while
`SI 0-L 14 had a IO base stem complementary to the 3'-half of
`the oli gonucleotide fo llowed by a I 4 base loop containing the
`remainder of the target sequence.
`
`

`

`C
`0
`
`.0
`.c
`C
`
`;f!.
`
`120
`
`100
`
`80
`
`60
`
`40
`
`20
`
`0
`
`0
`
`T
`
`~- - .... ----- Q----- .. - . -..
`
`75
`
`150
`
`225
`
`300
`
`nM 5132
`
`Figure 2. Inhi bition of alternate structure clones by ISIS 51 32. Cells were
`transfected with the luciferase reporter plas mids di agrammed in Figure I, then
`treated in duplicate with oligonucleotide at doses ranging from 40 to 300 nM .
`Luciferase ex pression was measured the followin g day. Results are percent
`luciferase ex pression compared to the no oligonucleotide control. Open triangle.
`S20; open circle, SO; inverted closed oiangle, S20- I0-5; closed square, S20- I 0-3;
`clo ed tri angle, SI 0-4; open square, SI 0- 14.
`
`Each con truct wa transfected into COS-7 cells as detailed
`in Materials and Methods. Transfected ceUs were seeded in 24-well
`plates and treated with ISIS 5 132 using cationic lipid at doses
`ranging from 40 to 300 nM. All oligonucleotide treatments
`were performed in duplicate or triplicate. Lysates from the
`treated cells were assayed for luciferase produced. Reduction
`in luciferase activity is correlated with degradation of mRNA
`mediated by antisense oligonucleotides. The results are shown
`in Figure 2. As expected, 5132 showed most activity against
`the construct with the least amount of secondary structure (SO).
`Agai nst the SO construct 5 I 32 had an IC50 of -60 nM. In
`contrast, 5132 showed very little activity against the S20
`construct even at
`the highest concentration
`tested. The
`remaining constructs showed intennediate activity with all
`IC50 values in the 300-400 nM range. Differences in activity
`could not be reliably determined among the intermediate
`constructs. The predicted overall !:iG3/
`for invasion and
`binding of the target was - 22. 1 kcal moI- 1 for the SO construct
`and +6.1 kcal mol- 1 for the S20 construct. Overall free energies
`fo r formation and binding of the intermediate constructs were
`similar to one another with /1G3/ values in the range - 13.4 to
`- I 0. 1 kcal moJ- 1• This correlates well with their intermediate
`levels of activity. An exception was the S20-10-5 construct,
`with a predicted overall /1G3/ of - 1 .4 kcal moI- 1. One would
`expect antisense oligonucleotides to be less effective against
`thi s target than the other three with intermediate antisense
`susceptibility based upon the predicted free energies, however,
`thi s was not the case. Thus, oligonucleotide efficacy was
`qualitatively, but not quantitatively, correlated with predicted
`RN A structure and oligonucleotide binding thermodynamics.
`To ensure that the observed effects were not the result of
`vari ations in the transcription efficiencies or mRNA stabilities
`of the constructs, RNA
`levels were evaluated for each
`construct by northern analysi as detailed in Material and
`Methods. Cells were co-transfected with a second plasmid
`construct expressing a cDNA for murine B7-2 to accou nt for
`
`Nucleic Acids Research, 2000, Vol. 28, No. 6 1343
`
`150
`
`120
`
`90
`
`60
`
`30
`
`e
`c
`0 u
`;,le
`
`'\
`-~-
`~-
`
`·,
`··'!!,-------·-&--------------------
`
`0
`
`60
`
`120
`
`180
`
`240
`
`300
`
`nM 5132
`
`Figure 3. Effect of sequence contex t on oligonucleotide effi cacy. The 5 132
`S20 and SO targets were inserted in the 3' UTR of pGL3-Co ntrol as detailed in
`Materials and Methods. Unmodified plasmid as well as plasmid containing the
`51 32 target site and structure were transfected into Cos-7 cells. Following the
`transfection cells were treated with 51 32 in the presence of cationic lipid for 4 h at
`doses ranging from 40 to 300 nM . Luciferase acti vity was measured the
`fo ll owing day. Results are given as percent of no oli gonucleotide control for
`each pl as mid. Open tri ang le, S20; open circle, SO; closed inverted tri ang le.
`pGL3-Control ; closed diamond, S20-3'; clo ed square, S0-3'.
`
`variation in transfection efficiency. Luciferase RNA expression
`normalized to levels of the mB7-2 RNA varied by <30% from
`the control expres ion vector pGL-3 (data not hown). The
`variation was not correlated with the amount of structure in the
`construct.
`
`Effect of sequence context
`In order to determ)ne if sequence context has an effect on
`oli gonucleotide efficacy, the 5132 SO and S20 sites were
`cloned into the 3'-UTR of pGL-3 using the unique XbaI site as
`detailed in Materials and Methods. The ability of 5132 to
`inhibit luciferase expression from these constructs was evaluated
`and compared with the original 5132 SO and S20 constructs
`(Fig. 3). Placement of the target within the me age had little
`effect on oligonucleotide potency. Luciferase production from
`the S20 constructs was not inhibited even at the highest dose of
`5132 tested. This was comparable to the construct without a
`target site at all. On the other hand, inhibition of the SO targets
`at either site in the message was almost identical at all doses. It
`seems to make little difference where the target is located
`within the RNA as long as RNA structure around the target site
`does not inhibit binding of the complementary oligonucleotide.
`
`Effect of oligonucleotide chemistry
`To date the most well characterized class of antisense oligo(cid:173)
`nucleotide are phosphorothioate oligodeoxynucleotide (32)
`that exert their activity primarily through a RNase H-mediated
`mechanism (33- 35). More recently other types of nucleotide
`modifications have been designed with the intent of improving
`the metabolic stability of the oligonucleotide as well as
`increasing affinity for the target RNA. Usually