Etfilfll’S:
`L
`
`-\
`
`Sarepta Exhibit 1048, Page 1 of 18
`
`

`

`General Information
`Oligonucleotides, a quarterly journal, discusses human-made substances and their effects on gene
`expression at the RNA and DNA levels. It provides a forum for basic researchers in molecular and
`cell biology, chemical synthesis, and applied therapeutics to discuss the development of new con(cid:173)
`cepts and experimental approaches to understand and modulate gene activity.
`Oligonucleotides (ISSN: 1545-4576) is published 4 times a year (quarterly) by Mary Ann
`Liebert, Inc., 140 Huguenot Street, New Rochelle, N.Y. 10801-5215. Periodicals postage paid at
`New Rochelle, NY, and at additional mailing offices. Postmaster: Send address changes to
`Oligonucleotides, c/o Subscription Department, Mary Ann Liebert, Inc., 140 Huguenot Street,
`New Rochelle, N.Y. 10801-5215. Mailed in Canada under CPC CPM #40026674.
`Subscriptions should be addressed to the Publisher and are payable in advance. Rates for
`subscriptions are for a volume of 4 issues: USA print $563, International print $700, USA print and
`online $669, International print and online $805, and online only (worldwide) $526. Subscriptions
`begin with the first issue of the current volume. Bulk subscriptions available upon request from
`the Publisher. Telephone: (914) 740-2100; fax: (914) 740-2101; e-mail: info@liebertpub.com
`Online: www.liebertpub.com No cancellations/refunds can be honored after publication of a vol-
`· -
`ume's first issue. No refunds/returns can be honored on single issue purchases.
`Oligonucleotides is owned and published by Mary Ann Liebert, Inc. Copyright © 2005 by Mary
`Ann Liebert, Inc. Printed in the United States of America.
`Reprints, except special orders of 100 or more, are available from the authors. For permission to
`photocopy fewer than 25 copies for internal purposes, please request permission and pay the ap(cid:173)
`propriate fee by contacting the Customer Relations Department of the Copyright Clearance Center,
`Inc., 22 Rosewood Drive, Danvers, MA 01923, 978-750-8400, fax: 978-750-4470. If the number
`of copies of an article is 25 or more, contact Reprint Sales Manager, Karen Ballen, directly at 9 l 4-
`740-2100, for options.
`Information for Manuscript Submission is given elsewhere in the publication and on our web
`site: www.liebertpub.com
`Business Communications should be addressed to the Publisher.
`Advertising inquiries from within the United States or Canada should be addressed to Mary Ann
`Liebert, Inc., 140 Huguenot Street, New Rochelle, N.Y. 10801-5215; telephone: (914) 740-2100.
`For Europe/Outside the U.S., contact: Hilary Turnbull, irnPRESS International Media Ltd.,
`Carrington Kirk, Carrington, Midlothian EH23 4LR, UK. Telephone: 44 (0) 1875 825700; fax:
`44 (0) 1875 825701; e-mail: impress@impressmedia.com All advertisements are subject to ap(cid:173)
`proval by the Publisher. The acceptance of advertisements does not constitute an endorsement of
`the product or service advertised.
`Manuscripts to be considered for publication should be submitted online using the following url:
`
`http://www.mc.manuscriptcentral.com/oligonucleotides
`All papers, news, comments, opinions, findings, conclusions, or recommendations in Oligonucleotides
`are those of the author(s), and do not constitute opinions, findings, conclusions, or recommenda-
`'
`tions of the Journal, its Publisher, and its editorial staff.
`is indexed in MEDLINE, Current Contents/Life Sciences, EMBASEI
`Oligonucleotides
`Excerpta Medica, Cambridge Scientific Abstracts, Biotechnology Citation Index, Science
`Citation Index, SciSearch, and BIOSIS.
`Oligonucleotides is a Journal Club selection.
`
`HM<J A~ L~, IN-.,~
`www.liebertpub.com
`
`

`

`Oligonucleotides
`
`The Official Journal of the Oligonucleotide Therapeutics Society, Inc.
`
`Editors
`Arthur M. Krieg, M.D.
`Coley_ _Pharmaceutical Group
`93 Worcester Street
`Suite 101
`Wellesley, MA 02481
`Tel.: (781) 431-9000, ext. 1284
`Fax: (781) 431-0951
`E-mail: Akrieg@coleypharma.com
`
`C.A. Stein, M.D., Ph.D.
`Department of Oncology
`Albert Einstein-Montefiore Cancer
`Center
`Montefiore Medical Center
`111 East 210 Street
`Bronx, N. Y. 10467
`Tel.: (718) 920-8990
`Fax.: (718) 652-4027
`E-mail: Cstein@montefiore.org
`
`Reviews Editor
`C. Frank Bennett, Ph.D.
`Department of Molecular and
`Cell Biology
`ISIS Pharmaceuticals
`1896 Rutheiford A venue
`Carlsbad, CA 92008
`Tel.: (760) 603-2336
`Fax: (760) 603-4652
`E-mail: Fbennett@isisph.com
`
`Editorial Board
`
`Sudhir Agrawal
`Cambridge, MA
`
`Sidney Altman
`New Haven
`
`Serge L. Beaucage
`Bethesda
`
`Robert D. Brown
`Berkeley Heights, NJ
`
`Marvin H. Caruthers
`Boulder
`
`Yoon S. Cho-Chung
`Bethesda
`Stanley Crooke
`Carlsbad, CA
`Nicholas M. Dean
`Carlsbad, CA
`Fritz Eckstein
`Gottingen, Germany
`Joachim Engels
`Frankfurt am Main
`Robert P. Erickson
`Tucson
`Sergio Ferrari
`Modena, Italy
`Michael Gait
`Cambridge, UK
`Wayne L. Gerlach
`Canberra, Australia
`Alan Gewirtz
`Philadelphia
`Peter M. Glazer
`New Haven, CT
`Martin Gleave
`Vancouver, British
`Columbia
`Gunther Hartmann
`Munich
`Richard I. Hogrefe
`San Diego
`Jeffrey T. Holt
`Denver
`Mick Hope
`Burnaby, British
`Columbia
`Jean-Louis Imbach
`Montpellier, France
`Burkhard Jansen
`Pasadena, CA
`Kuan-Teh Jeang
`Bethesda
`Rudolph L. Juliano
`.Chapel Hill
`
`Ryszard Kole
`Chapel Hill
`
`Maria Koziolkiewicz
`Lodz, Poland
`
`Bernard Lebleu
`Montpellier, France
`Robert L. Letsinger
`Evanston, IL
`L. James Maher III
`Rochester, MN
`
`Claude Malvy
`Villejuij. France
`
`Dan Mercola
`Irvine, CA
`
`Paul S. Miller
`Baltimore
`
`Brett P. Monia
`Carlsbad, CA
`Ramaswamy Narayanan
`Boca Raton, FL
`
`L.M. Neckers
`Rockville, MD
`
`Paul L. Nicklin
`West Sussex, UK
`
`Eiko Ohtsuka
`Sapporo, Japan
`
`John C. Reed
`La Jolla
`
`John J. Rossi
`Duarte, CA
`
`Esther Saison-Behmoaras
`Paris
`
`Kevin Scanlon
`Claremont, CA
`
`Georg Sczakiel
`Liibeck, Germany
`
`Michael Seidman
`Baltimore
`
`Hartmut Seliger
`Ulm, Germany
`
`Barbara Ramsay Shaw
`Durham
`
`Hermona Soreq
`Jerusalem
`
`Wojciech Stec
`Lodz, Poland
`
`Martin Tabler*
`Heraklion, Crete
`
`Kazunari Taira
`Tokyo
`
`David M. Tidd
`Liverpool, UK
`
`J.-J. Toulme
`Bordeaux
`
`Thomas Tuschl
`New York, NY
`
`Eugen Ohlmann
`Langenfeld, Gennany
`
`Valentin V. Vlassov
`Novosibirsk, Russia
`
`Hermann Wagner
`Munich
`
`Daniel L. Weeks
`Iowa City
`
`Jesper Wengel
`Copenhagen, Denmark
`
`Eric Wickstrom
`Philadelphia
`
`Paul Zamecnik
`Charlestown, MA
`
`Uwe Zangemeister-Wittke
`Zurich
`
`Editor-at-Large
`Florence Paillard, Ph.D.
`Durango, CO
`
`*Now deceased
`
`

`

`Oligonucleotides
`
`VOLUME 15
`
`NUMBER 4
`
`DECEMBER 2005
`
`EDITORIAL
`
`A New Editor at Oligonucleotides
`A.M. Krieg
`
`ORIGINAL PAPERS
`
`Evaluation of LNA-Modified DNAzymes Targeting a Single Nucleotide
`Polymorphism in the Large Subunit of RNA Polymerase II
`K. Fluiter, M. Frieden, J. Vrei.j ling; T. Koch, and F. Baas
`
`Potent Inhibitory Activity of Chimeric Oligonucleotides Targeting Two
`Different Sites of Human Telomerase
`E. Matthes, C. uhmann, M. Stulich, Y. Wu, L. Dimitrova, E. Uhlmann,
`and M. Von Janta-Lipinski
`
`Strand Displacement of Double-Stranded DNA by Triplex-Forming Antiparallel
`Purine-Hairpins
`S. Coma, V. Noe, R. Eritja, and C.J. Ciudad
`Functional Analysis of 114 Exon-Internal AONs for Targeted DMD Exon
`Skipping: Indication for Steric Hindrance of SR Protein Binding Sites
`A. Aartsma-Rus, C.L. de Winter, A.A.M. Janson, W.E. Kaman, G.-J.B. van Ommen,
`J. T. den Dunnen, and J.C. T. van Deutekom
`
`BRIEF COMMUNICATIONS
`
`New RNAi Strategy for Selective Suppression of a Mutant Allele in
`Polyglutamine Disease
`T. Kubodera, T. Yokota, K. Ishikawa, and H. Mizusawa
`
`Hairpin Ribozyme-Catalyzed Ligation in Water-Alcohol Solutions
`A. V. Vlassov, B.H. Johnston, and S.A. Kazakov
`
`DISSERTATION SUMMARIES
`
`Instructions for Authors can be found at the back of the issue and on our website at
`www .liebertpub.com
`
`245
`
`246
`
`255
`
`269
`
`284
`
`298
`
`303
`
`310
`
`

`

`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`OLIGONUCLEOTIDES 15:284-297 (2005)
`© Mary Ann Liebert, Inc.
`
`Functional Analysis of 114 Exon-Internal AONs for Targeted
`DMD Exon Skipping: Indication for Steric Hindrance of SR
`Protein Binding Sites
`
`ANNEMIEKE AARTSMA-RUS, CHRISTAL. DE WINTER, ANNEKE A.M. JANSON,
`WENDYE. KAMAN, GERT-JAN B. VAN OMMEN, JOHAN T. DEN DUNNEN,
`and JUDITH C.T. VAN DEUTEKOM
`
`ABSTRACT
`
`As small molecule drugs for Duchenne muscular dystrophy (DMD), antisense oligonucleotides
`(AONs) have been shown to restore the disrupted reading frame of DMD transcripts by inducing
`specific exon skipping. This allows the synthesis of largely functional dystrophin proteins and poten(cid:173)
`tial conversion of severe DMD into milder Becker muscular dystrophy (BMD) phenotypes. We have
`previously described 37 exon-internal AONs that induce skipping of 14 DMD exons in human con(cid:173)
`trol myotube cultures. Here, we report 77 new AONs, effectively targeting an additional 21 exons. Of
`the 114 AONs thus far tested, 72 (67%) were effective. AON design initially was based on a partial
`overlap with predicted open secondary structures in the target RNA. We have analyzed various
`AON and target exon parameters in retrospect. Interestingly, we observed significantly higher
`SF2/ASF, SC35, and SRp40 values (as predicted by ESEfinder) for effective AONs when compared
`with ineffective AONs. In addition, the distance to the 3' splice site was significantly smaller for ef(cid:173)
`fective AONs. No other significant correlations were observed. Our results suggest that effective
`exon-internal AONs primarily act by blocking SR binding sites (which often correspond to open
`structures) and that ESEfinder may be used to refine AON design for DMD and other genes.
`
`INTRODUCTION
`
`DUCf-TENNE MUSCUtAl{ DYSTROPHY (DMD) is a evere
`
`disease that is generally caused by frame-disrupting
`mutations (over 60% deletions) in the DMD gene, which
`result in nonfunctional dystrophin proteins (Hoffman et
`al., 1987). Mutations that keep the reading frame intact
`give rise to internally deleted, semifunctional dystrophins
`and are associated with the milder Becker muscular dys(cid:173)
`trophy (BMD) (Hoffman et al., 1988; Monaco et al.,
`1988). This phenomenon underlies a new therapeutic ap(cid:173)
`proach for DMD, which is based on enlarging an out-of(cid:173)
`frame DMD mutation into its nearest in-frame BMD
`counterpart. This can be achieved with antisense oligori(cid:173)
`bonucleotides (AONs) that induce specific exon skipping
`
`during pre-mRNA splicing (Takeshima et al., 2001; van
`Deutekom et al., 2001; Wilton et al., 1999).
`As splicing requires the correct identification of the
`branch point, the 3' and the 5' splice sites of exons by the
`spliceosome, these sites initially seem obvious targets for
`AONs to induce exon skipping. Indeed, skipping of the
`in-frame exon 23 that is mutated-in the mdx mouse model
`was successfully induced by AONs targeting these sites
`(Goyenvalle et al., 2004; Lu et al., 2003, 2005; Mann
`et al., 2002). In addition to the consensus splice site
`sequences, many exons contain splicing regulatory se(cid:173)
`quences, such as exonic splicing enhancer (ESE)
`sequences, to facilitate the inclusion of genuine exons by
`the spliceosome (Cartegni et al., 2002). A subgroup of
`splicing factors, called the SR proteins, can bind to these
`
`Leiden University Medical Center, Center for Human and Clinical Genetics, 2333 AL Leiden, The Netherlands.
`
`284
`
`

`

`COMPARISON OF AONS FOR DMD EXON SKIPPING
`
`285
`
`exon inclusion signals or ESEs and recruit other splicing
`factors, such as Ul and U2AF to (weakly defined) splice
`sites. The target sequence motives of the most abundant
`, SR proteins (SF2/ASF, SC35, SRp40, and SRp55) have
`been characterized, and the results have been imple(cid:173)
`mented in ESEfinder, a web source that predicts potential
`binding sites for these SR proteins (Cartegni et al., 2003).
`The importance of functional ESEs for the proper in(cid:173)
`clusion of certain exons is demonstrated by comparison
`of 1 DMD and 2 BMD patients (with or without car(cid:173)
`diomyopathy) carrying different nonsense mutations in
`the in-frame exon 29 (Ginjaar et al., 2000). For both
`BMD patients, the mutation causes an SRp55 site pre(cid:173)
`dicted by ESEfinder to drop below the threshold value.
`Variable levels of exon 29 skipping (and thus reading
`frame restoration) were observed in muscle tissue from
`these patients, allowing the synthesis of an internally
`deleted BMD dystrophin. For the DMD patient, the mu(cid:173)
`tation is not located in a predicted ESE site, and no exon
`29 skipping was observed. In this patient, the dystrophin
`is thus truncated prematurely (Ginjaar et al., 2000;
`Aartsma-Rus, 2005).
`Given the importance of ESEs for correct splicing,
`these exon-internal sites may be additional targets for
`AONs to induce exon skipping. Indeed, we have previ(cid:173)
`ously shown the skipping of 14 different DMD exons
`(i.e., exon 2, 19, 29, 40-46, 49- 51, and 53) in human
`myotube cultures using exon-internal AONs (Aartsma(cid:173)
`Rus et al., 2002, 2004; van Deutekom et al., 2001). The
`potential of this therapy has been demonstrated in my(cid:173)
`otube cultures from 12 patients carrying different muta(cid:173)
`tions (Aartsma-Rus et al., 2003, 2004; Surono et al.,
`2004; Takeshimia et al., 2001; van Deutekom et al.,
`2001). For each patient, we observed specific and effi(cid:173)
`cient skipping of the targeted exon(s) and dystrophin ex(cid:173)
`pression in over 70% of treated myotubes.
`For most of our AONs, the design was based only on
`an at least partially open formation in the secondary
`target RNA structure (as predicted by m-fold) (Math(cid:173)
`ews et al., 1999; Aartsma-Rus et al., 2002). These open
`formations may represent putative ESE sites. By ini(cid:173)
`tially designing only two AONs per exon, we identified
`a series of AONs with which the skipping of 9 of 12
`targeted exons could be induced; 60% of AONs were
`effective (Aartsma-Rus et al., 2002). Because reading
`frame-disrupting mutations are found throughout the
`DMD gene, a series of AONs is required to induce ther(cid:173)
`apeutic exon skipping for the majority of patients.
`Therefore, we have designed an additional 77 exon-in(cid:173)
`ternal AONs targeting exons 8, 17, 29, 43, 45-48; 51,
`52, 54-63, and 71-78 (Table 1). Here, we describe the
`efficiency of these AONs in human control myotube
`cultures. Furthermore, we have retrospectively ana(cid:173)
`lyzed our entire set of 114 AONs, anticipating a poten(cid:173)
`tial correlation between design and efficacy, especially
`
`with regard to the presence of SR binding sites. We
`have also evaluated AON location (relative to the
`splice sites), length and GC content, flanking intron
`lengths, predicted splice site strengths, and the reading
`frame condition.
`
`MATERIALS AND METHODS
`
`AONs, transfection, and RT-PCR analysis
`
`AON design was primarily based on (partly) overlapping
`predicted open secondary structures of the target RNA as
`predicted by them-fold program (Mathews et al., 1999).
`All AONs (Table 1) were synthesized by Eurogentec
`(Seraing, Belgium) and contain 2' -O-methyl RNA and
`full-length phosphorothioate (PS) backbones. Myotube
`cultures derived from a human control were transfected
`using polyethylenimine (PEI) (Exgen 500, MBI [St.
`Leon-Rot, Germany] Fermentas) according to the manu(cid:173)
`facturer's instructions. Each AON was transfected at
`least twice at different concentrations (varying from 200
`nM to 1 ,uM, with 2-3.5 ,ul PEI per ,ug AON). A control
`AON with a 5' fluorescein label was used to ascertain op(cid:173)
`timal transfection efficiencies by counting the number of
`fluorescent nuclei (in general, over 90% of all nuclei).
`RNA was isolated 24-48 hours posttransfection using
`RNA-Bee (Campro Scientific, Veenendaal, The Nether(cid:173)
`lands) according to the manufacturer's instructions. RT(cid:173)
`PCR analyses were performed on -400 ng total RNA
`with DMD exon-specific primers (sequence available
`upon request) using Transcriptor reverse transcriptase
`(RT) (Roche Diagnostics, Mannheim, Germany) accord(cid:173)
`ing to the manufacturer's instructions. Primary and
`nested PCRs were carried using primer pairs flanking the
`targeted exons (sequences available on request) for 20
`and 22 cycles, respectively.
`
`Analysis of AONs and statistical analysis
`
`The ESEfinder version 2.0 software was used to pre(cid:173)
`dict the putative SR binding sites (rulai.cshl.edu/tools/
`ESE/) (Cartegni et al., 2003)). Splice site values for the
`different exons were calculated with
`the Berkely
`Drosophila Genome Project software for human splice
`site prediction. Statistical analyses were performed using
`the R software (R Development Core Team, 2005) and
`the exactRank Tests package (Hothorn and Hornik,
`2004). The Wilcoxon signed rank sum test (one-tailed)
`was used to identify whether AON parameters differed
`for the effective and ineffective group of AONs. The
`Kruskal-Wallis signed rank sum test was performed to
`determine whether one of three groups was significantly
`different from the other groups.
`
`

`

`59
`65
`65
`39
`42
`42
`35
`58
`53
`30
`35
`26
`50
`50
`47
`35
`47
`53
`37
`53
`56
`33
`45
`53
`50
`45
`56
`40
`40
`37
`47
`29
`36
`29
`
`0.65
`0.29
`0.47
`0.39
`0.74
`0.37
`0.40
`0.26
`0.37
`0.45
`0.55
`0.63
`.0.39
`0.00
`0.47
`0.50
`0.74
`0.47
`0.58
`0.67
`0.44
`0.28
`0.55
`0.58
`0.40
`0.30
`0.56
`0.60
`0.40
`0.53
`0.53
`0.29
`0.32
`0.29
`
`17
`17
`17
`18
`19
`19
`20
`19
`19
`20
`20
`19
`18
`18
`17
`20
`19
`19
`19
`15
`16
`18
`20
`19
`20
`20
`16
`20
`20
`19
`19
`24
`22
`24
`
`%CC
`
`opend
`
`Fraction
`
`Length
`
`24
`155
`39
`85
`5
`101
`43
`116
`66
`18
`23
`22
`105
`4
`90
`20
`148
`9
`123
`6
`9
`29
`87
`74
`114
`117
`35
`26
`122
`81
`139
`5
`10
`21
`3' ss
`5' ss
`Distance fromc
`
`137
`6
`122
`75
`154
`58
`87
`15
`90
`137
`132
`134
`52
`175
`90
`145
`18
`127
`13
`131
`127
`105
`45
`59
`18
`15
`39
`132
`36
`84
`26
`35
`32
`19
`
`2.56
`0.35
`3.39
`L85
`0.93
`2.41
`2.41
`2.51
`2.57
`0.06
`0.10
`0.10
`2.83
`1.19
`3.14
`0.86
`0.93
`1.21
`0.77
`3.16
`-0.11
`1.39
`4.33
`2.91
`2.04
`3.53
`2.46
`1.54
`2.91
`3.22
`2.57
`2.71
`2.71
`1.12
`
`0.86
`1.19
`1.81
`1.97
`2.07
`3.07
`2.01
`0.86
`1.43
`1.11
`4.15
`-0.24
`3.61
`1.98
`5.76
`1.32
`1.53
`3.93
`1.44
`3.63
`1.68
`1.09
`2.33
`2.40
`4.60
`4.60
`2.26
`3.83
`3.04
`1.82
`2.57
`1.40
`1.40
`3.37
`
`3.20
`2.30
`1.45
`1.82
`0.82
`1.01
`1.47
`0.64
`2.97
`1.06
`1.06
`1.06
`1.47
`3.37
`3.20
`2.62
`-0.39
`2.76
`-0.39
`1.95
`0.79
`1.41
`3.28
`3.24
`1.07
`1.07
`1.92
`-0.68
`2.92
`0.70
`0.12
`1.44
`1.44
`1.54
`
`3.96
`0.50
`3.27
`0.37
`3.03
`1.79
`-0.64
`0.25
`1.37
`-0.78
`0.50
`-0.78
`1.83
`3.23
`2.89
`2.39
`3.82
`2.81
`1.31
`0.13
`1.61
`1.83
`1.26
`3.09
`5.74
`5.74
`2.83
`1.76
`3.77
`-1.19
`1.31
`1.59
`1.49
`1.49
`
`+
`
`-
`
`-
`-
`
`++
`++
`++
`
`-
`-
`
`-
`
`+
`
`-
`
`+
`+
`+
`++
`++
`++
`+
`
`-
`
`+
`++
`++
`++
`++
`+
`+
`++
`++
`++
`
`-
`
`-
`
`++
`
`-
`
`45
`45
`45
`45
`45
`45
`44
`44
`43
`43
`43
`43
`43
`42
`42
`41
`41
`40
`40
`29
`29
`29
`29
`29
`29
`29
`19
`17
`17
`8
`8
`2
`2
`2
`
`uuugcagaccuccugcc
`gcccaaugccauccugg
`ccaccgcagauucaggc
`ucuguuuuugaggauugc
`uuuuucugucugacagcug
`gcugaauuauuucuucccc
`uuuguauuuagcauguuccc
`cgccgccauuucucaacag
`cuguagcuucaccc~uucc
`cauuuuguuaacuuuuuccc
`uguuaacuuuuucccauugg
`uuguuaacuuuuuccauu
`ugcugcugucuucuugcu
`cagagacuccucuugcuu
`cuugugagacaugagug
`cuucgaaacugagcaaauuu
`cuccucuuucuucuucugc
`uccuuucaucucugggcuc
`gagccuuuuuucuucuuug
`cauguaguucccucc
`guaguucccuccaacg
`uuaaaugucucaaguucc
`ucugugccaauaugcgaauc
`ccaucuguuagggucugug
`gguuauccucugaaugucgc
`uauccucugaaugucgcauc
`ucugcuggcaucuugc
`uaaucugccucuucuuuugg
`ccauuacaguugucuguguu
`guacauuaagauggacuuc
`cuuccuggauggcuucaau
`gaaaauugugcauuuacccauuuu
`uugugcauuuacccauuuugug
`cccauuuugugaauguuuucuuuu
`
`SRp55
`
`SRp40
`
`SC35
`
`SF2/ASF
`
`Skip"
`
`ESEfinder values over thresholtfo
`
`TABLE 1. CHARACTERISTICS OF AONs USED
`
`exon
`
`Targeted
`
`Sequence
`
`h45AON9r
`h45AON5f
`h45AON4
`h45AON3
`h45AON2°
`h45AON1c
`h44AON2e
`h44AON1°
`h43AON5f
`h43AON4
`h43AON3
`h43AON2°
`h43AON1°
`h42AON2e
`h42AON1°
`h41AON2e
`h41AONle
`h40AON2°
`h40AON1°
`h29AON11
`h29AON10
`h29AON9
`h29AON6
`h29AON4
`h29AON2°
`h29AON1e
`h19AONe.h
`h17AON2
`hl7AON1
`h8AON3
`h8AON1
`h2AON3e
`h2AON2°
`h2AON1°
`
`AON
`
`

`

`(continued)
`
`50
`30
`67
`50
`40
`67
`47
`47
`47
`43
`38
`53
`21
`37
`33
`37
`24
`38
`33
`53
`35
`27
`29
`50
`42
`31
`29
`47
`50
`13
`29
`40
`40
`50
`60
`
`0.25
`0.22
`0.00
`0.80
`0.70
`0.47
`0.24
`0.32
`0.42
`0.48
`0.62
`0.53
`0.68
`0.63
`0.62
`0.74
`0.48
`0.81
`0.33
`0.53
`0.39
`0.45
`0.48
`0.22
`0.79
`0.88
`0.35
`0.53
`0.60
`0.40
`0.48
`1.00
`0.60
`0.15
`0.07
`
`20
`23
`15
`20
`20
`15
`17
`19
`19
`21
`21
`17
`19
`19
`21
`19
`21
`16
`21
`19
`23
`22
`21
`18
`19
`16
`17
`15
`20
`15
`21
`15
`20
`20
`15
`
`24
`52
`39
`83
`147
`36
`83
`25
`60
`88
`96
`123
`137
`146
`105
`132
`34
`153
`37
`70
`26
`91
`30
`47
`43
`120
`11
`39
`40
`88
`114
`24
`15
`67
`72
`
`191
`160
`181
`132
`68
`60
`11
`60
`25
`79
`71
`48
`32
`23
`62
`37
`133
`19
`94
`63
`103
`39
`101
`87
`88
`14
`122
`96
`90
`47
`15
`111
`115
`63
`63
`
`2.82
`2.91
`1.31
`2.04
`0.41
`2.83
`-0.03
`1.38
`3.41
`2.21
`2.21
`1.90
`2.57
`2.57
`0.42
`1.58
`1.31
`1.38
`-0.40
`2.07
`0.53
`1.02
`0.53
`1.21
`2.09
`1.48
`0.18
`0.78
`0.78
`0.83
`1.48
`2.83
`1.04
`2.46
`0.01
`
`2.88
`3.94
`0.38
`4.90
`1.35
`1.41
`2.71
`0.70
`1.96
`2.32
`2.32
`0.25
`1.62
`1.62
`2.32
`2.83
`2.33
`2.44
`0.74
`1.25
`2.20
`2.76
`2.20
`3.68
`3.70
`0.74
`3.52
`1.47
`3.70
`-0.72
`2.07
`0.51
`3.52
`1.68
`1.68
`
`1.91
`2.27
`1.74
`1.14
`1.48
`1.37
`3.02
`0.05
`0.52
`1.96
`1.96
`1.96
`1.72
`0.34
`1.32
`1.72
`1.50
`0.08
`0.96
`2.05
`2.17
`0.22
`2.17
`1.55
`3.47
`1.08
`-1.09
`1.03
`3.47
`-0.40
`1.08
`1.30
`1.08
`2.82
`2.82
`
`1.67
`2.68
`0.39
`1.77
`-0.31
`1.10
`1.69
`0.56
`3.02
`0.91
`0.91
`0.91
`0.01
`0.83
`-1.34
`0.01
`0.64
`0.83
`1.11
`-1.37
`0.74
`1.70
`-0.89
`3.82
`2.39
`-0.80
`-1.19
`1.61
`2.39
`-2.28
`1.35
`0.66
`-1.14
`2.34
`2.34
`
`++
`+
`++
`++
`++
`+
`+
`
`+
`+
`
`-
`
`++
`++
`
`-
`-
`
`-
`-
`
`-
`-
`-
`-
`
`-
`
`-
`
`-
`
`++
`+
`+
`++
`++
`
`-
`
`++
`+
`+
`
`-
`
`+
`
`-
`
`51
`51
`51
`51
`51
`50
`50
`49
`49
`48
`48
`48
`·43
`48
`48
`48
`48
`48
`47
`47
`47
`47
`47
`47
`46
`46
`46
`46
`46
`46
`46
`46
`46
`46
`46
`
`ugauauccucaaggucaccc
`ccucugugauuuuauaacuugau
`cacccaccaucaccc
`gaaagccagucgguaaguuc
`ucaaggaagauggcauuucu
`ggcugcuuugcccuc
`cucagagcucagaucuu
`guggcugguuuuuccuugu
`cuuccacauccgguuguuu
`uaacugcucuucaaggucuuc
`cuucaaggucuucaagcuuuu
`gcugcccaaggucuuuu
`uuuauuugagcuucaauuu
`gcuucaauuucuccuuguu
`cuucaagcuuuuuuucaagcu
`ggucuuuuauuugagcuuc
`uuauaaauuuccaacugauuc
`uuucuccuuguuucuc
`uucaaguuuaucuugcucuuc
`agcacuuacaagcacgggu
`cugcuugagcuuauuuucaaguu
`uccaguuucauuuaauuguuug
`cuugagcuuauuuucaaguuu
`ucuugcucuucugggcuu
`agguucaagugggauacua
`cugacaagauauucuu
`ucaagcuuuucuuuuag
`uuccagguucaagug
`uccagguucaagugggauac
`uaaaacaaauucauu
`gaaauucugacaagauauucu
`uuaguugcugcucuu
`gcuuuucuuuuaguugcugc
`guuaucugcuuccuccaacc
`cugcuuccuccaacc
`
`h51AON29
`h51AON2°
`h51AON27
`h51AON24
`h51AONle
`h50AON2°
`h50AON1e
`h49AON2e
`h49AONle
`h48AON10
`h48AON9
`h48AON8
`h48AON7
`h48AON6
`h48AON4
`h48AON3
`h48AON2°
`h48AON1e
`h47AON6
`h47AON5
`h47AON4
`h47AON3
`h47AON2e.
`h47AON1e
`h46AON26
`h46AON25
`h46AON24
`h46AON23
`h46AON22
`h46AON21
`h46AON20
`h46AON9g
`h46AON8g
`h46AON6g
`h46AON4g
`
`

`

`61
`58
`53
`56
`42
`33
`47
`32
`56
`57
`65
`61
`45
`35
`50
`50
`35
`39
`40
`58
`50
`61
`61
`38
`39
`
`0.56
`0.37
`0.84
`0.56
`0.47
`0.57
`0.37
`0.64
`0.28
`0.57
`0.41
`0.56
`'0.35
`0.55
`0.28
`0.35
`0.60
`0.52
`0.65
`0.58
`0.56
`0.50
`0.78
`0.25
`0.50
`
`18
`19
`19
`18
`19
`21
`19
`22
`18
`21
`17
`18
`20
`20
`18
`20
`20
`23
`20
`19
`18
`18
`18
`16
`18
`
`%CC
`
`opend
`
`Fraction
`
`Length
`
`51
`12
`31
`31
`92
`38
`19
`112
`134
`118
`66
`184
`86
`18
`92
`9
`64
`77
`118
`20
`97
`45
`69
`88
`129
`26
`48
`107
`139
`35
`104
`68
`29
`143
`167
`2
`33
`139
`58
`80
`21
`118
`128
`68
`45
`151
`97
`7
`69
`33
`3' ss
`5' ss
`Distance frame
`
`3.64
`2.57
`2.78
`3.00
`1.34
`2.23
`0.68
`1.60
`4.10
`2.41
`2.03
`0.27
`1.52
`2.22
`0.33
`2.34
`2.41
`1.27
`2.92
`1.34
`1.88
`0.21
`0.77
`-0.80
`0.52
`
`I
`
`4.43
`5.97
`4.08
`2.29
`3.26
`3.53
`2.18
`2.52
`4.81
`2.77
`2.54
`3.68
`4.04
`2.52
`3.36
`5.66
`4.92
`3.46
`4.92
`3.54
`4.00
`3.40
`1.63
`2.28
`2.44
`
`3.32
`2.92
`2.56
`3.66
`4.84
`0.34
`3.45
`1.70
`4.73
`1.95
`3.30
`5.52
`1.88
`1.56
`5.77
`2.67
`4.82
`2.29
`4.82
`1.80
`1.64
`4.04
`2.26
`1.11
`3.61
`
`2.28
`5.26
`2.87
`0.66
`1.31
`1.77
`1.65
`0.63
`2.83
`2.47
`2.11
`1.81
`0.78
`2.77
`0.87
`3.03
`0.74
`2.70
`0.74
`3.14
`3.77
`2.20
`3.08
`-0.07
`1.56
`
`SRp55
`
`SRp40
`
`SC35
`
`SF2/ASF
`
`ESEfinder values over thresho[db
`
`+
`
`-
`
`+
`++
`
`-
`
`+
`
`-
`
`-
`
`-
`
`-
`
`+
`
`+
`++
`++
`+
`+
`+
`++
`++
`
`+
`
`-
`
`+
`Skip0
`
`-
`
`61
`61
`60
`60
`59
`59
`58
`58
`57
`57
`57
`56
`56
`56
`55
`55
`55
`55
`55
`54
`54
`53
`53
`52
`52
`
`exon
`
`Targeted
`
`gugcugagaugcuggacc
`gucccugugggcuucaug
`_gugcugagguuauacggug
`guucucuuucagaggcgc
`uugaaguuccuggagucuu
`caauuuuucccacucaguauu
`gaguuucucuaguccuucc
`uucuuuaguuuucaauucccuc
`uucagcuguagccacacc
`cugaacugcuggaaagucgcc
`uaggugccugccggcuu
`ccuuccagggaucucagg
`guucacuccacuugaaguuc
`uuuuuuggcuguuuucaucc
`gagucuucuaggagccuu
`uccuguaggacauuggcagu
`ugcaguaaucuaugaguuuc
`ugccauuguuucaucagcucuuu
`cuguugcaguaaucuaugag
`cccggagaaguuucaggg
`uacauuugucugccacugg
`uuggcucuggccuguccu
`cuguugccuccgguucug
`ccguaaugauuguucu
`uugcuggucuuguuuuuc
`
`Sequence
`
`h61AON2
`h61AON1
`h60AON2
`h60AON1
`h59AON2
`h59AON1
`h58AON2
`h58AON1
`h57AON3
`h57AON2
`h57AON1
`h56AON3
`h56AON2
`h56AON1
`h55AON6
`h55AON5
`h55AON3
`h55AON2
`h55AON1
`h54AON2
`h54AON1
`h53AON2°
`h53AON1°
`h52AON2
`h52AON1
`
`AON
`
`TABLE 1. CHARACTERISTICS OF AONs USED (CONTINUED)
`
`

`

`hThis AON targets part of the ESE deleted in the deletion Kobe (Matsuo et al., 1990, 1991).
`SPreviously published (van Deutekom et al., 2001).
`fPreviously published (van Deutekom et al., 2001; Aartsma-Rus et al., 2003, 2004).
`"Previously published (Aartsma-Rus et al., 2002).
`<lThe fraction of available nucleotides targeted by the AON in the predicted secondary RNA structure over the total length of the AON.
`cNumber of nucleotides between the AONs and the 5' and 3' splice sites (SS) in nucleotides. The distance to the 3' and 5' splice sites is determined from the first (3'
`bfor each AON, the highest value is given for each of the SR proteins.
`•+ + Exon skipping observed in over 25% of transcripts in normal control myotube cultures; + exon skipping observed in up to 25% of transcripts; -no exon skipping
`59
`50
`56
`59
`58
`53
`61
`47
`53
`71
`29
`44
`42
`40
`50
`47
`48
`53
`59
`69
`
`cauuggcuuuccagggg
`gcuuuccagggguauuuc
`ugcuccaucaccuccucu
`uuguguccuggggagga
`auaggcugacugcugucgg
`gagagguagaaggagagga
`ggcggccuuuguguugac
`ccuuuauguucgugcugcu
`uccccucuuuccucacucu
`cuggcucaggggggagu
`gagaugcuaucauuuagauaa
`gauccauugcuguuuucc
`gcauaauguucaaugcgug
`ugaguaucaucgugugaaag
`ucuacuggccagaaguug
`gccagaaguugaucagagu
`guagagcucugucauuuuggg
`ggucccagcaaguuguuug
`gggcacuuuguuuggcg
`uggcucucucccaggg
`
`0.71
`0.78
`0.39
`0.47
`0.32
`0.32
`0.39
`0.21
`0.16
`0.59
`0.29
`0.39
`0.47
`0.60
`0.50
`0.79
`0.38
`0.79
`0.47
`0.50
`
`17
`18
`18
`17
`19
`19
`18
`19
`19
`17
`21
`18
`19
`20
`18
`19
`21
`19
`17
`16
`
`7
`12
`30
`58
`42
`70
`84
`194
`70
`93
`16
`37
`7
`28
`7
`14
`10
`34
`9
`32
`
`10
`4
`47
`20
`65
`37
`144
`33
`72
`51
`31
`13
`42
`20
`16
`8
`33
`11
`37
`15
`
`0.27
`0.62
`1.65
`-0.18
`1.58
`3.22
`1.12
`2.83
`2.82
`1.39
`3.64
`2.47
`2.14
`0.25
`1.47
`1.47
`0.93
`1.25
`0.09
`-0.50
`
`3.32
`3.32
`-0.21
`3.57
`4.30
`3.53
`3.71
`3.39
`1.68
`2.35
`2.28
`2.16
`1.26
`6.02
`4.36
`4.36
`3.12
`3.16
`1.71
`1.89
`
`2.95
`4.04
`0.32
`3.50
`1.47
`1.28
`1.11
`1.41
`0.33
`2.39
`0.68
`0.89
`2.43
`0.60
`4.61
`3.35
`2.57
`0.97
`0.56
`0.33
`
`1.81
`1.81
`2.43
`4.26
`3.23
`0.08
`1.51
`3.64
`3.04
`1.35
`-0.48
`1.22
`0.77
`6.59
`1.37
`0.12
`2.81
`1.70
`1.70
`1.08
`
`++
`++
`++
`++
`+
`
`-
`
`splice site) or last (5' splice site) nucleotide in the target sequence.
`
`++
`
`-
`
`++
`++
`+
`++
`+
`++
`+
`++
`++
`++
`+
`+
`
`78
`78
`77
`77
`76
`76
`75
`75
`74
`74
`73
`73
`72
`72
`71
`71
`63
`63
`62
`62
`
`detected.
`
`h78AON2
`h78AON1
`h77AON2
`h77AON1
`h76AON2
`h76AON1
`h75AON2
`h75AON1
`h74AON2
`h74AON1
`h73AON2
`h73AON1
`h72AON2
`h72AON1
`h71AON2
`h71AON1
`h63AON2
`h63AON1
`h62AON2
`h62AON1
`
`

`

`290
`
`l 44 ! <5 ! 46 [ 47 l(cid:173)
`l « l 45 I 41 1-
`
`M NT 4 6 8 9 20 21 22 23 24 25 26 -RT
`
`-
`- --
`-----------------
`-
`
`+
`
`♦ ♦♦ -
`
`♦ -
`
`........ ♦ + + ♦
`
`FIG. 1. A representative comparison of effective vs. ineffec(cid:173)
`tive AONs. RT-PCR analysis of dystrophin mRNA fragments
`of control myotube cultures treated with a series of exon 46
`AONs. Clear exon skipping levels of >25% of the total tran(cid:173)
`script can be observed for AONs 8, 22, 23, and 26 (indicated by
`+ + ). AONs 4, 6, 20, 24, and 25 induce skipping levels of
`< 25% (indicated by + ), with AONs 6 and 24 inducing only
`very faint skips. No skipping was observed after treatment with
`AONs 9 and 21 (indicated by a minus).
`
`RESULTS
`
`Biologic analysis of AONs
`We here describe a novel set of 77 AONs targeting ex(cid:173)
`ons 8, 17, 29, 43, 45-48, 51, 52, 54-63, and 71-78.
`These AONs were tested at least twice at 200-1000 nM
`
`AARTSMA-RUS ET AL.
`
`concentrations, and their efficacies were determined by
`RT-PCR analysis. The characteristics of all AONs and
`their performances are shown in Table 1. Specific exon
`skipping, as confirmed by sequence analysis ( data not
`shown), was demonstrated for 51 AONs (66%). For each
`targeted exon, at least one AON was effective, with the
`exception of exons 4 7 and 57.
`We have thus far tested 114 AONs, of which 76 (67%)
`were effective and 38 (33%) were ineffective (Table 1). We
`distinguish AONs for which we observed levels of exon
`skipping of >25% of the total transcripts (indicated by++
`in Table 1) and AONs with < 25% of exon skipping (indi(cid:173)
`cated by + ). An example of the different efficiency levels
`that can be observed is included (Fig. 1). In total, 41 (36%)
`AONs were++ effective, and 35 (31 %) were+ effective,
`The majority of effective AONs induced the skipping of
`the targeted exon specifically, although we sometimes ob(cid:173)
`served additional splicing effects. AONs targeting exon 8
`always induced the double exon skipping of both exon
`8 and the in-frame exon 9 and never induced single exon 8
`skipping (data not shown). AONs targeting exons 40, 58,
`
`~ SF2/ASF (1 .956) ■ SC35 (2.383) □ SRp40 (2.670) ~ SRp55 (2.676)
`4 Exon 46
`
`3
`
`GCTAG.AAGM.CMMOMTATCTTGTCA~TITCAA.AtlACATTTAAA"JGMTlTGTTTIATGGTTOGAGGMGCA.GI\TMCA.TfGCTAOTATCCCA.CTTGMl;CTGGAAAA,GAGCAGCAACT~GCTTGAGCMGTCMC
`#26- - - - - - #9············----············ ..
`#21···--···················
`-
`-
`-
`-
`-
`-
`#25- -
`# 8 - - --
`#22--- -- -
`#24- - - - - - - - ·
`
`#4-------(cid:173)
`#6---------
`
`#23 - - - -
`
`3' splice site
`
`#20- -
`
`-
`
`-
`
`-
`
`-
`
`-
`
`-
`
`-
`
`-
`
`-
`
`5' splice site
`
`- - AONs that induce observed exon skipping levels of 25% of control transcripts(++)
`AONs that induce observed exon skipping levies of less than 25% of control transcripts(+)
`-
`-
`-
`........... AONs that do not induce exon skipping in control transcrips (-)
`
`FIG. 2. Graphic overview of exon 46-specific AONs. The sequence of exon 46 is depicted, with the location of the AONs indi(cid:173)
`cated by lines. The location and values above the thresholds as predicted by ESEfinder for SF2/ASF, SC35, and SRp40 and 'SRp55
`are shown as bars. The threshold values for each of the SR proteins as given in ESEfinder are shown as open bars for the putative
`SR protein binding sites and are given between brackets. For our analyses, only potential SR binding sites that are completely cov(cid:173)
`ered by an AON were taken into account (excluding, for instance, AONs 20 and 25 and the second putative SRp40 site). The most
`efficient AONs (8, 22, 23, and 26) indeed cover putative ESEsites, whereas the ineffective AON 25 does not completely overlap a
`putative ESEsite. Conversely, the ineffective AON 9 does target potential SRp40 and SRp55 binding sites.
`
`

`

`COMPARISON OF AONS FOR DMD EXON SKIPPING
`
`291
`
`At(open structure
`
`)
`
`.u..
`•
`
`Jtclosed structure
`
`#26
`
`6
`
`3' splice site
`
`FIG. 3. Example of the secondary pre-mRNA structure of exon 46 and flanking sequences as predicted by m-fold. The locations
`of the 3' and 5' splice sites are indicated. The secondary structure consists of closed structures in which the nucleotides are associ(cid:173)
`ated with other nucleotides within the target RNA and open structures that consist of unassociated or free nucleotides. The loca(cid:173)
`tions of two exon 46-specific AONs are shown (i.e., #6 and #26); the 20-mer #6 targets 3 free nucleotides. Thus, the fraction of
`available base pairs is 3/20 (0.15). AON #26 is a 19-mer, and 15 of its nucleotides target free nucleotid