VOLUME 18, NUMBER 9, SEPTEMBER 2007
`
`ISSN: 1043-0342
`
`.
`The Official Jeumal of the
`European Society of Gene and Cell Therapy
`
`
`
`Sarepta Exhibit 1031, Page 1 of 17
`
`

`

`General Information
`
`the need for a central
`
`in
`
`forum dealing witb all aspects of gene transfer
`
`Human Gene Therapy answers
`mammals.
`Human Gene Therapy (ISSN: 1043-0342) is publisbed 12 times a year (monthly) by Mary Ann Liebert,
`Inc.,
`140 Huguenot Street, 3rd Floor, New Rochelle, NY 10801-5215. Periodicals postage paid at New Rochelle,
`to Human Gene Therapy, clo
`NY, and at additional mailing offices. Postmaster:
`Send address changes
`Subscription Department, Mary Ann Liebert,
`Inc., 140 Huguenot Street, 3rd Floor, New Rochelle, NY
`10801-5215. Mailed in Canada under CPC !PM #40026674.
`are
`Subscriptions
`should be addressed to the Publisher and are payable in advance. Rates for subscriptious
`for a volume of 12 issues: USA print $3,480,
`International
`print $3,930, USA print and ouline $4,165,
`International print and online $4,623, and online only (worldwide) $3,323. The student postdoctorate/fellow
`rate is $100. Subscriptions begin with the first issue of the current volume. Bulk subscriptions available upon
`request from the Publisher. No cancellations/refunds
`can be honored after publication of a volume's
`first is-
`sue. There are no refunds/returns on single issue purchases.
`Human Gene Therapy is owned and published by Mary Ann Liebert,
`Liebert, Inc. Printed in the United States of America.
`Telepboue:
`(914) 740-2100;
`fax: (914) 740-2109; e-mail:
`com
`except special orders of 100 or more, are available from the authors. For permission to photocopy
`Reprints,
`fewer than 25 copies of an article for internal purposes, please request permission and pay the appropriate fee
`by contacting the Customer Relations Dept. of the Copyright Clearance Center,
`Inc., 22 Rosewood Drive,
`If the number of copies of an article is 25 or more,
`Danvers, MA 01923; 978-750-8400,
`fax; 978-750-4470.
`contact Reprint Sales Manager, Karen Ballen, at 914-740-2194, directly for options.
`Information
`for Manuscript
`Submission
`is given elsewhere
`in the publication
`www.liebertpub.com
`should be addressed to the Publisher; e-mail: hturnbull@impressmedia.com
`Business Communications
`Advertising Inquiries
`should be addressed to David Brownstein, Mary Ann Liebert, Inc., 140 Huguenot Street,
`3rd Floor, New Rochelle, NY 10801-5215,
`(914) 740-2175. For Europe/Outside
`the U.S., contact: Hilary
`Turnbull,
`imPRESS International Media Ltd., Carrington Kirk, Carrington, Midlothian, EH23 4LR, UK.
`Telephone: +44-1875-825700;
`fax: +44-1875-825701;
`e-mail: hturnbull@impressmedia.com
`AIl adver-
`tisements are subject to approval by the Publisher.
`Manuscripts
`should be submitted
`online using the following URL: http://mc.manuscriptcentral.
`comlhum
`in Human Gene Therapy are
`All papers, news, comments, opinions, findings, conclusions, or recommendations
`those of the author(s), and do not constitute opinions, findings, conclusions, or recommendations
`of the Journal,
`its Publisher, and its editorial staff.
`in Index Medicus, MEDUNE, Current Contents/Life Science,
`Human Gene Therapy is indexed
`EMBASE/Excerpta Medica, Cambridge Scientific Abstracts, Reference Update, and BIOSIS Previews.
`Human Gene Therapy is a Journal Club selection.
`
`Inc. Copyright © 2007 by Mary Ann
`
`info@liebertpub.com
`
`Ouline: www.liebertpub.
`
`and on our web site:
`
`Please visit us on the web: www.liebertpub.com
`
`

`

`*~**
`*
`***
`
`*
`*
`
`Editor-in-Chief
`James M.Wilson, M.D., Ph.D.
`Unil'. of Penm}'!vollia
`School a/Medicine
`Celie Therapy Program
`Department of Pathology and Laboratory
`Medicine
`Suire 2000, Translational Research
`Luborarories
`125 S. 3/ Sf Street
`Philadelphia, PA 19104-3403
`Ph (215) 898-0819 Fax (215) 898-6588
`Esmail: wilsonjm@mail.med.upenn.edu
`
`Associate Editors
`Kenneth
`I. Berns, M.D., Ph.D.
`ur Generics Institute
`Dept. of Molecular Genetics and.
`Microbiology
`College aIMedicine
`Cancer/Genetics
`Research Complex
`1376 Mowry Road, Room 115
`Gainesville, FL3261O-36JO
`Ph (352) 273-8100
`Fax (352) 273-8284
`E-mail: kbems@ufl.edu
`
`Gnd
`
`Fatima Bosch, Ph.D.
`Center of Animal Biotechnology
`Gene Therapy
`Universitas Aulanomo de Barcelona
`£diflci H
`Spain
`08193-Bellarerra,
`Ph 34-93-58/4179
`Fax 34-93-5814180
`fatima.bosch@uab.es
`E-mail:
`
`Shuichi Kaneko, M.D.
`Cancer Ge/le Regulation
`Kanuzawa Ulliversity
`Graduate
`School of Medical Science
`Takara-Machi
`13-1
`Japan
`Kanazawa
`920-8641,
`FaxBI-76-234-4250
`P!l81-76-265-2231
`E-mail: hgt@lTl-kanazawa.jp
`
`l\·lark A. Kay, M.D., Ph.D.
`Deparrmems
`of Pediatrics and Genetics
`Slanford Unil'enity
`School of Medicine
`300 Pasteur Drive, Room G305
`Sranford, CA 94305
`Fax(650)498-6540
`Ph (650)498-6531
`E-Jnuil.· markay@stanford.edu
`
`Luigi Naldini, M.D., Ph.D.
`HSR-TIGET
`San Raffaele Teletholl
`fllStitllre for Gene Therapy
`I'ia Olgettina 58
`20132 Milano,Italy
`Ph 39-02-2643-4703/4875
`Fax 39-02-2643-4688
`E-mail: naldini.!uigi@hsr.it
`
`Scientific Editorial Board
`Patrick Aebischer, M.D.
`Ecole Polyteclmique Fiderale de Lausanne
`Alessandro Aiuti, M.D., Ph.D.
`ScienTific InstimTe Sari Raffaele
`Alberto Auricchio, M.D.
`Telelhon ln~il/lte of Genetics and
`Medicine
`Christopher Baum, M.D., Ph.D.
`Haml01'er Medical School, FRG
`Arthur L. Beaudet, M.D.
`Baylor College of Medicine
`
`Human Gene Therapy
`
`The Official Journal of the
`European Society of Gene and Cell Therapy
`
`R. Michael Blaese, M.D.
`Preaentis.
`Inc.
`Thomas Blankenstein, M.D.
`Max De!bn"ick Centrum fiir
`Molekulare Mediein; Germany
`Richard C. Boucher, M.D.
`University of Nonh Carolina at Chapel Hill
`Xandra Breakefield, Ph.D.
`Massachusetts General Hospital
`Frederic Bushman, Ph.D.
`University of Pennsylvania
`Barrte L Carter, Ph.D.
`Targeted Genetics Corporation
`Marina Cavazzana-Calvo, M.D., Ph.D.
`Hopital Necker-Enjants Malades
`Jeffrey S. Chamberlain, Ph_D.
`University ofWashillgtoll
`School of
`Medicine
`Saswati Chatterjee, Ph.D.
`City of Hope NaTI. Medical Center
`Kenneth Cornetta, M.D.
`Indiana University School of Medicine
`Francois Loic Cosset, Ph.D_
`Ecole Normale Superiore de Lyon
`Ronald G. Crystal, M.D.
`Wei!! Medical College of Cornell University
`David T. Curiel, M.D., Ph.D.
`University of Alabama at Birmingham.
`Beverly L. Davidson, Ph.D.
`University
`of 101\"0
`Alan Davis, Ph.D.
`Baylor College of Medicine
`Mark E. Davis, Ph.D.
`California Insnnue of Technology
`Pamela B. Davis, M.D., Ph.D.
`CWRU School of Medicine
`Albert B. Deisseroth, M.D., Ph.D.
`Sidney Kimmel Cancer CeTlter
`David Dichek, M.D.
`University of Washington School of
`Medicine
`Boro Dropulic, Ph.D.
`LelJ/igen COIpomtion
`John Engelhardt, Ph.D.
`University of lowa
`Erik Falck-Pedersen, Ph.D.
`Weill Medical College of Com ell University
`Terence R. FloUe, Ph.D.
`University of Florida
`Theodore Friedmann, M.D.
`UniversityafCalijomia,
`San Diego
`Guang·ping Gao, Ph.D.
`University ofPellll~)'lvania
`Maureen Goodenow, Ph.D.
`UniversiTy of Florida
`Philip D. Greenberg, M.D.
`University afWashington
`Hirofumi Hamada, M.D., Ph.D.
`Sapporo Medical University
`Jean Michel Heard, M.D.
`InsTituTePasteur
`Katherine High, M.D.
`University of Pen/lsylvania
`Rob Hoeben, Ph.D.
`Leiden University Medical Centre
`Keith Humphries, M.D., Ph.D.
`Terry Fox Laboratories
`Douglas J. Jolly, Ph.D.
`Advf./.Iltagene, bu:.
`Carl June, M.D.
`Universil)' of Pellnsylvania
`Yasufumi Kaneda, M.D.
`Osakn University Medical Sc1tool
`Yutaka Kawakami, M.D., Ph.D.
`Keio Unll'ersity School of Medicille
`William Kelley, M.D.
`University oj Pennsylvania Medical Center
`
`Hans Peter Kiem, M.D.
`University of Washington
`Donald B. Kohn, M.D.
`University of Southern Califomia
`Robert Kotin, Ph.D.
`NIH,NHLBI
`Satoru Kyo, M.D., Ph.D.
`Kanazawa University
`Jeffrey M. Leiden, M.D., Ph.D.
`Abbott Laboratories
`Andre Lieber, M.D., Ph.D.
`University of WashingTon
`Michael Linden, Ph.D.
`Mount Sinai Medical Center
`Ronald Lurtig, Ph.D.
`Louisiana State University
`Fulvio Mavilio, Ph.D.
`Isntuto Scientifico H. San Raffaele
`Nicholas D. Mazarakis, Ph.D.
`Imperial College London
`R. Scott McIvor, Ph.D.
`University of Minnesota
`A. Dusty Miller, Ph.D.
`Fred Hutchinson Cancer Research Center
`Junichi Miyazaki, M.D., Ph.D.
`Osaka University Medical School
`Richard Morgan, Ph.D.
`NIH,NCI
`Philippe MouIlier, M.D., Ph.D.
`INSERM
`James Mute, Ph.D.
`University of Michigan Medical Center
`Elizabeth G. Nabel, M.D.
`NIH,NHLBl
`Jan A. Nolta, Ph.D.
`WashingTon University
`William Osborne, Ph.D.
`University of Washington
`Keiya Ozawa, M.D., Ph.D.
`Jichi Medical School
`Amy Patterson, M.D.
`NIH
`Richard Peluso, Ph.D.
`Targeled Genetics CorporaTion
`Michel Perricaudet, M.D.
`In~if!ll Gustave ROllssy
`David Pintel, Ph.D.
`University oj'Missouri-Columbia
`Katherine Ponder, M.D.
`Washington University
`Kathleen Joy Propert, Sc.D.
`Universily of Pellnsy!l'allia
`Paul D. Robbins, Ph.D.
`UniversilY of PiTtsburgh
`David W. Russell, M.D., Ph.D.
`Universily of Washington
`Ste\'en J. RiIssell, M.D., Ph.D.
`Mayo Clinic
`Michel Sadelain, M.D., Ph.D.
`Memorial Sloan-KeTtering Cancer Center
`humu Saito, M.D.
`University of Tokyo
`Prem Seth, Ph.D.
`NorlfnvesTem UniversiTY
`Takashi Shimada, M.D., Ph.D.
`Nippon Medical School
`Brian Sorrentino, M.D.
`SI. Jude Children's Research Hospital
`Arun Srivastava, Ph.D.
`University of Florida College of Medicine
`George Stamatoyannopoulos, M.D.
`University (if Washington
`Theresa Strong, Ph.D.
`University of Alabama
`Sean M. Sullivan, Ph.D.
`Ulliversity of Florida
`Hideaki Tahara, M.D., Ph.D.
`University of Tokyo
`
`HM-<JA~ L~,
`,~.,~
`www.Iiebertpub.com
`
`Lausanne
`
`Kenzaburo Tani, M.D., Ph.D.
`Kyushu University
`Naomi Taylor, M.D., Ph.D.
`tnsntvt de GeneTique Moleculaire
`Adrian Thrasher, M.D., Ph.D.
`Institute of Child Health, U'K.
`Didier Trono, M.D.
`Swiss Institute u/Technology
`Dinko Valerio, Ph.D.
`University of Leiden
`Thierry Van Den Driessche, Ph.D.
`University of Leuven
`Inder Verma, Ph.D.
`Salk Institute
`Jeffrey Weber, M.D.
`University of Soiahem California
`Yuquan Wei, M.D., Ph.D.
`Sichuan University
`Matthew Weitzman, Ph.D.
`Salk Institute
`Richard Whitley, M.D.
`University of Alabama
`Jeffrey A. Whitsett, M.D.
`Children's Hospital Medical Center
`John Wolfe, V.M.D., Ph.D.
`University of Pennsylvania
`Jon A. Wolff, M.D.
`University ofWiscol1sin
`Savio L.C. Woo, Ph.D.
`Mount Sinai Medical Center
`Yiping Yang, M.D., Ph.D.
`Duke University Medical Center
`Seppo Yla-Herttuala, M.D., Ph.D.
`University of Kuopio
`Jun Yoshida, M.D.
`Nagoya University School of Medicine
`Xiao Xiao, Ph.D.
`UniversilY of N0/11l Carolina at Chapel Hill
`
`Ethicsllega I/Regu Iatory
`Editorial Board
`Arthur Caplan, Ph.D.
`University of Pennsylvania
`Alexander M. Capron, LL.B.
`UniversiTy of Soulhem Calijomia
`.TamesF. Childress, Ph.D.
`University of Virginia
`Robert Cook-Deegan, M.D.
`Duke University
`Eric Juengst, Ph.D.
`Cenler for HI/man Genome Research
`Henry I.Miller, M.D.
`Hoover IfistilU/ion
`Thomas H. Murray, Ph.D.
`The Hastings Center
`LeRoy Walters, Ph.D.
`Kennedy InsTiTuTeof EThics
`Nelson Wivel, M.D.
`University of Penllsylvania Medical Center
`
`Editorial Office-Edilor-in-Chiel
`Monique R. Molloy
`Editorial Cwrdinator
`Human Gene Therapy
`S",·'e 2000. Transfmional Rf!search Laborarorias
`1255_ 31sT Slreel
`Philadelphia, PA ]9104-3403
`Ph (215) 898·08]9 Fax(2/5) 898-6588
`E_mail.- HGT@mai1.med.upenn.cdu
`
`Founding Editor
`w. French Anderson, M.D.
`
`

`

`Human Gene Therapy
`
`VOLUME 18
`
`NUMBER 9
`
`SEPTEMBER 2007
`
`SCIENTIFIC PAPERS
`
`E1A- and E1B-Double Mutant Replicating Adenovirus Elicits Enhanced
`Oncolytic and Antitumor Effects
`J. Kim, J.-H. Kim, K.-J. Choi, P.-H. Kim, and CoO. Yun
`
`Characterization of a Bipartite Recombinant Adeno-Associated
`Viral Vector for Site-Specific
`Integration
`C Zhang, N.G. Cortez, and K.l. Berns
`
`Comparative Analysis of Antisense Oligonucleotide Sequences for Targeted
`Skipping of Exon 51 During Dystrophin Pre-mRNA Splicing in Human Muscle
`V. Arechavala-Gomeza,
`I.R. Graham, L.J. Popplewell, A.M. Adams, A. Aartsma-Rus,
`M. Kinali, J.E. Morgan, J.C van Deutekom, S.D. Wilton, G. Dickson, and F. Muntoni
`
`Transduction of Human Hematopoietic Stem Cells by Lentiviral Vectors
`Pseudotyped with the RD114- TR Chimeric Envelope Glycoprotein
`F. Di Nunzio, B. Piovani, F.-L. Cosset, F. Mavilio, and A. Stornaiuolo
`
`Safety of Arylsulfatase A Overexpression for Gene Therapy of Metachromatic
`Leukodystrophy
`A. Capotondo, M. Cesani, S. Pepe, S. Fasano, S. Gregori, L. Tononi, M.A. Venneri.
`R. Brambilla, A. Quattrini, A. Ballabio, M.P. Cosma, L. Naldini, and A. Biffi
`
`Polyethylene Glycol Modification of Adenovirus Reduces Platelet Activation,
`Endothelial Cell Activation, and Thrombocytopenia
`S.E. Hofherr, H. Mok, F.C Gushiken, J.A. Lopez, and M.A. Barry
`
`Promoter Choice for Retroviral Vectors: Transcriptional Strength Versus
`Trans-Activation Potential
`EL Weber and P.M. Cannon
`
`Prolonged In Vivo Gene Silencing by Electroporation-Mediated
`Delivery of Small Interfering RNA
`D. Eefting, J.M. Grimbergen, M.R. de Vries, V. van Wee!, EL Kaijzel, I. Que,
`R. T. Moon. C W Lowik, J.H. van Bockel, and P.H.A. Quax
`
`Plasmid
`
`773
`
`787
`
`798
`
`811
`
`821
`
`837
`
`849
`
`861
`
`NEWS AND COMMENTS
`
`OBA Documents
`Future Meeting Dates and Protocol Submission Deadlines
`
`for the RAC
`
`870
`
`for Authors
`Instructions
`www.liebertpub.com
`
`can be found
`
`at
`
`the back of
`
`the issue on our website
`
`at
`
`Cover: Fluorescent
`in situ hybridization demonstrating site-specific integration by an AAV
`vector. For further details, see the paper by Zhang et al. on page 787.
`
`

`

`This material may be protected by Copyright law (Title 17 U.S. Code)
`
`HUMAN GENE THERAPY 18:79s-810
`© Mary Ann Liebert, Inc.
`DOl: 10.1089/hum.2006.061
`
`(September
`
`2007)
`
`Comparative Analysis of Antisense Oligonucleotide Sequences
`for Targeted Skipping of Exon 51 During Dystrophin
`Pre-mRNA Splicing in Human Muscle
`
`L.J. POPPLEWELL,2 A.M. ADAMS,3
`I.R. GRAHAM,'"
`V. ARECHAVALA-GOMEZA,I.*
`A. AARTSMA-RUS,4 M. KINALI,1 J.E. MORGAN,1 J.e. VAN DEUTEKOM,4,5
`and F. MUNTONII
`S.D. WILTON,' G. DICKSON,'
`
`ABSTRACT
`
`in the ab-
`result
`gene that
`in the dystrophin
`Duchenne muscular dystrophy (DMD) is caused by mutations
`the reading
`sence of functional protein,
`In the majority of cases these are out-of-frame deletions that disrupt
`frame, Several attempts have been made to restore the dystrophin mRNA readiug frame by modulation of
`pre-mRNA splicing with antisense oligonucleotides
`(AOs), demonstrating
`success in cultnred cells, muscle ex-
`plants, and animal models. We are preparing for a phase l/IIa c1inicaJ trial aimed at assessing the safety and
`effect of locally administered AOs designed to inhibit
`inclusion of exon 51 into the mature mRNA by the splic-
`ing machinery, a process known as exon skipping. Here, we describe a series of systematic experiments to val-
`idate the sequence and chemistry of the exon 51 AO reagent
`selected to go forward into the clinical
`trial
`planned in the United Kingdom. Eight specific AO sequences targeting exon 51 were tested in two different
`chemical forms and in three different preclinical models: cultured human muscle cells and explants (wild type
`and DMD), and local in vivo administration
`in transgenic mice harboring the entire human DMD locus. Data
`have been validated independently
`in the different model systems used, and the studies describe a rational
`collaborative path for the preclinical selection of AOs for evaluation in future clinical
`trials.
`
`INTRODUCTION
`
`DUCHENNE MUSCULAR DYSTOPHY (D.MD)
`
`is caused by non-
`sense or frame-shifting mutations in the DMD gene, which
`results in nonfunctional
`dystrophin proteins
`(Hoffman et al.,
`1987). At the same time, interstitial mutations at the DMD lo-
`cus that maintain the dystrophin mRNA open reading frame
`give rise to internally deleted but semifunctional
`dystrophins
`and the milder Becker muscular dystrophy (BMD) (Hoffman et
`al., 1987; Monaco et al., 1988). Internally truncated but at least
`partially functional dystrophins are also expressed in so-called
`revertant
`fibers,
`individual dystrophin-positive
`fibers found in
`50% of DMD patients and in mdx mice (Nicholson et al., 1989;
`Hoffman et aI., 1990; Burrow et al .• 1991; Fanin et al., 1992;
`Sherratt et al., 1993; Yokota et al., 2006). Revertant
`fibers arise
`
`via some alternative splicing mechanism occurring within dys-
`trophin pre-mRNAs,
`skipping of frame-shifting
`exons
`to re-
`move protein-truncating mutations, and restoration of the dys-
`trophin open reading frame (Lu et al., 2000). These revertant
`dystrophias
`lack exon domains flanking the gene lesion in DMD
`patients
`(Fanin et al., 1995; Thanh et al., 1995) and the mu-
`tated exon 23 in the mdx mouse (Lu et al., 2000). Despite be-
`ing internally truncated, dystrophin molecules
`found in BMD
`patients can be functional, as demonstrated by several families
`with in-frame deletions in the DMD gene, associated with ele-
`vated serum creatine kinase but displaying no clinical myopa-
`thy (e.g., deletions of exons 32--44, 48-51, or 48-53 [Melis et
`al., 1998]. excn 48 [Morrone
`et al., 1997], exons 48-51 or
`50-53 [Beggs et aI., 1991]. exons 45-55 [Beroud et ai., 2007J.
`or exons 50-51 [Lesca et al., 2007]). The efficacy of internally
`
`Imperial College, London W120NN, United Kingdom.
`IDepartment of Paediatrics,
`2School of Biological Sciences, Royal Holloway-University
`of London, Egham TW20 OEX, United Kingdom.
`3Centre for Neurological
`and Neuromuscular Disorders, Australian Neuromuscular Research Institute, University of Western Australia, Perth
`WA6009, Australia.
`"Center
`for Human and Clinical Genetics, Leiden University Medical Center, 2300RC Leiden, The Netherlands.
`'Prosensa,
`2333AL Leiden, The Netherlands.
`*V.A.~G. and lR.G. contributed equally to this paper.
`
`798
`
`

`

`DYSTROPHIN
`
`EXON 51 AO COMPARISON
`
`lacking an appreciable portion of the rod
`truncated dystrophins
`domain has also been demonstrated
`in transgenic mdx mice, and
`exploited to design so-called rnicrodystrophins
`compatible with
`delivery by AAV vectors. These engineered recombinant mi-
`crodystrophins
`have been shown to restore normal expression
`improve
`protein complex (Df'C),
`of the dyslrophin-associated
`sarcolemmal
`stability, and prevent myofiber degeneration in the
`mdx mouse model (Wang et al., 2000; Fabb et al., 2002; Harper
`et al., 2002; Gregorevic
`et al., 2006).
`truncated dystrophin
`The first suggestion that a functional,
`molecule could be created in DMD patients originally came
`from Takeshima et al. after skipping exon 19 in vitro in con-
`trol cells (Takeshima et al., 1995; Pramono et aZ., 1996). Shortly
`after,
`restoration of the reading frame in dystrophic
`cells was
`shown by Dunckley et al. (1998). These authors, and others im-
`mediately
`afterward,
`proposed
`the use of antisense
`oligonu-
`cleotides to modulate dystrophia mRNA splicing to enlarge out-
`of-frame DMD mutations
`into the nearest
`in-frame BMD-like
`mutation
`and produce
`an internally
`deleted functional
`dys-
`trophin protein (Dunckley
`et al., 1998; Wilton et aZ., 1999;
`Takeshima
`et 01.,2001; van Deutekom et ai., 2001).
`The mechanism of antisense oligonucleotide
`(AO) modula-
`tion of dystrophin pre-rnRNA splicing involves hybridization
`to specific motifs involved in splicing and exon recognition
`in
`the pre-mRNA. This prevents normal
`spliceosome
`assembly
`and results in the failure of the splicing machinery to recognize
`and include the target exon(s)
`in the mature gene transcript
`(Mann el al., 2001; Aartsma-Rus
`et al., 2003).
`In this way one or more exons and their flanking introns are
`removed during splicing of the pre-mRNA In the case of the
`dystrophin gene deletions,
`selective removal of specific flank-
`ing exons should result
`in in-frame mRNA transcripts
`that may
`be translated into an internally deleted, BMD-like
`and func-
`tionally active dystrophin protein with predictable
`therapeutic
`activity (Wilton et al., 1999; van Deutekom et aI., 2001).
`In DMD research,
`the potential clinical use of AOs has evolved
`from studies in vitro on cultured mdx mouse muscle cells (Dunck-
`ley et al., 1998; Mann et al., 2001, 2002) and human D:rvIDmus-
`cle cells (van Deutckom et al., 2001; Aartsma-Rus et aI., 2002,
`2003, 2004a) to in vivo studies in mdx and GRMD (golden re-
`trievermuscular
`dystrophy) animal models (Lu et al., 2003, 2005;
`Fletcher et al., 2006; McClorey et ai., 2006b)
`(Table 1). Direct
`in vivo AD-induced exon skipping in humans, however, has yet
`to be demonstrated and this proof of principle, along with clini-
`cal safety,
`is the crucial aspect of initial clinical studies. Prepa-
`ration has been reported for two parallel clinical
`trials of AD
`therapeutics
`in DMD patients that will
`target dystrophin exon
`51. Exclusion of exon 51 is predicted to allow the restoration of
`. the dystrophin open reading frame (ORF)
`in ~ 17% of DMD
`deletion patients (deletions of exons 45-50, 47-50, 48-50, 49
`and 50, 50, 52, and 52-63; van Deutekom and van Ommen,
`2003). Although these two clinical
`trials will both target exon 51,
`each will evaluate different AO chemistries: 2'-O-methyl-modi-
`fied ribose moieties on a phosphorothioate
`backbone
`(2-0Me
`AOs) (completed by Leiden University Medical Center [LUMC]
`and Prosensa [Leiden, The Netherlands]
`[van Deutekom et al.,
`2007]) and phosphorodiamidate morpholino oligomers (PMOs)
`(http://ciinicaltrials.govlctishowINCTOOI59250;
`in progress
`in
`the United Kingdom [Muntoni et ai., 2005]).
`The majority of the AO work undertaken on cultured cells
`
`799
`
`has been performed with 2-0Me AOs, as this chemistry is read-
`ily available and, more importantly,
`allows efficient cell trans-
`fection
`as a cationic
`lipoplex
`preparation
`(Summerton
`and
`Weller, 1997; Fletcher et al., 2006). Although PMOs appear to
`be more efficient
`after direct administration
`to tissues
`in the
`mdx mouse than the equivalent
`2-0Me AO (Fletcher
`et aI.,
`2006),
`their poor uptake in vitro limits the approaches
`that can
`be used to refine AO design.
`in a blinded fashion, eight
`In this study, we have compared,
`different sequences
`targeting dystrophin exon 51. The two most
`efficient sequences were finally compared in their PMO version.
`Dose-response
`experiments were used to evaluate
`the lowest
`concentration capable of inducing skipping and time course ex-
`periments were performed to study the persistence of the exon
`skipping after
`transfection. All preliminary
`experiments were
`undertaken in normal human skeletal muscle cells (hSkMCs) be-
`cause these ceUs are more readily available than patient-derived
`cell lines. All the key experiments were repeated on the cells of
`DMD patients with different but relevant deletions. As a proof
`of principle,
`the AOs were also tested on muscle explants from
`DMD patients
`to study their effect
`in an ex vivo structure, as
`such explants have been described as a putative model
`in which
`to test gene therapy models (Fletcher et al., 2006; McClorey et
`al., 2006a). These experiments were complemented
`by the in-
`tramuscular
`administration
`of PMO versions of the two most
`promising sequences
`into the gastrocnemius muscle of a mouse
`model
`transgenic for the entire human dystrophin locus (Brem-
`mer-Bout et al., 2004). All these approaches
`suggested that one
`of the AOs (AO B30, +66+95) more robustly induced exon
`skipping, and this sequence has now been chosen for the phase
`l/Ila trial which is underway in the United Kingdom.
`
`MATERIALS AND METHODS
`
`AO design
`Eight different 2'-O-rnethyl AOs to human dystrophin exon
`51 (A20, B30, and C20--H20) were designed on the basis ofES-
`Efinder analysis (Smith et al., 2006), and relative to previously
`published sequences
`(Fig. 1A). Splice site ADs (C20 to H20)
`were designed on the basis of work performed in our laboratory
`on the mdx mouse, published previously (Graham et al., 2004).
`To avoid differences
`in synthesis conditions and concentrations
`all AOs were purchased from Eurogentec (Seraing, Belgium), di-
`luted to the same concentration in water by the same operator,
`aliquoted, and stored at -80°C. Three fnrther ADs (A25, B30,
`and 125; Fig.
`lA) were synthesized as phosphorodiamidate mor-
`pholino oligomers (PMOs) by Gene Tools (Philomath, OR). To
`facilitate introduction into cultured cells,
`the uncharged PMOs
`were hybridized to phosphorothioate-capped DNA leashes, based
`on a previous design (Gebski et al., 2003), and stored at 4°C.
`
`Cell culture and AO tronsfection
`Transfections of AOs were performed at two separate institu-
`tions, Imperial College (IC, London, UK) and Royal Holloway
`(RH, London, UK), using normal primary human skeletal mus-
`cle cells from different
`sources: human fetal muscle cells were
`obtained from the Medical Research Council (MRC) Tissue Bank.
`(London, UK) and human primary skeletal muscle cultures were
`
`

`

`"29:6Emgem. 4.8.305?E”33538—5553$035833£5503282:E5:855
`
`
`
`
`
`
`
`€833Ecan20:0828:8E5:90me
`0231302@5303
`
`
`
`5:90:98.8£92Ecodusfl
`
`=anmeno292R5323
`
`982.86%232.:E:Emohmmo
`
`28-9%3%25
`
`
`
`
`
`un_3.%on”95835883
`
`
`
`AwEESmocscHEO£835:555:39;?”28.5:mgSE
`
`
`
`5.5595;“.”28.5:3%SE
`
`BE58835£35328-5:3%SE
`
`BE5833
`
`28-5:9;;SE
`
`28%:9%sea
`
`
`
`
`waswEESmocsfific20:032858Earias?”96.5%my“aim
`
`
`
`
`
`flmEESmoanEc28:03282:55,32%”QUAIL”:Emsea
`
`
`
`AmEEfimoczfiEo$283282:a533%”28-5:him:oxm
`
`3035233E53985?
`
`
`
`$53035833
`
`95835883ESwaifimofiéfic
`228328:5E5&0me
`
`
`
`$055233E5:35szRwfififimocsfigv
`
`228%209::E530555
`
`
`
`
`
`“28963%sea”AwEESmoEflEEc2.530%202::aEmotes.
`
`9035353E:Emobmzv
`
`mean—9.
`
`Sink
`
`:tdcénfisaww
`
`O<
`
`cocooficfik
`
`cocoflmcafil
`
`
`
`:28an:EH
`
`5.58%52%
`
`5:83:39
`
`“Esomsegfi
`
`deDOmSEabGH
`
`SEoSEEEH
`
`EEBWNAm.
`
`.525UmSENHufiH
`
`monmmBmamOSE
`
`EEomsfiabE
`
`«EmEEBmzm
`
`033ESuEO.N
`
`ofifiuumzm
`
`BEBmzm
`
`omEBmzm
`
`omEBmmm
`
`uEO‘N
`
`
`
`
`
`
`
`Dm—Imimimmwfin—DbmQm—m<mum0_FOm—JUDZOOEOm—mZm—mrr2<PTEOMHmVQM<ADUMDZm—ZZm—IUDQ.Hmqmlfifi
`
`
`
`
`
`
`
`
`
`8:22min035
`
`oEO-N
`
`oEO.N
`
`vEO.N
`
`uEO-N
`
`ogolm
`
`uEO-N
`
`o—ZO.N
`
`oEO-N
`
`uEO-N
`
`oEO-N
`
`«EEmoMgH9805332
`
`Secs,3NM3G88
`
`03E
`
`689.3B52
`
`98$,3m€22
`
`@505<3SE300
`
`
`
`@003.3»“N5280
`
`88$.3S26>?
`
`£89.3aa?
`
`
`
`AmooNv.ES2300
`
`.3Smam-aEmfla<
`
`38$
`
`”Noam.Ecséaas:
`
`88:.3a555
`
`388.Ea£300
`
`
`
`2330333922
`
`83:5“359:2
`
`23:5“£5932
`
`$8:.3s322:6
`
`
`
`2330“350%;
`
`$89.3s52me
`
`BBEQ“£3932
`
`
`
`33.3.
`
`Nthhwfi
`
`
`
`3.5E
`
`3.5E
`
`3.3E
`
`3.3E
`
`9::5
`
`9:;5
`
`Sr:5
`
`a};5
`
`a};E
`
`3.:E
`
`3:0634S
`
`35%
`
`Sarepta Exhibit 1031, Page 7 of 17
`
`

`

`
`
`
`
`5:265Eufléoam.5“Eco380:0
`
`
`
`8:258canKiowa“:332:8b5
`
`
`
`
`
`£8on:Emobmbvofifioflou85E
`
`
`
`
`
`“@96528¢QOo::23:23298
`
`5:35?we£333:525was
`
`
`
`Amfififiwoasgfiv£835:553.385%.29563%cam
`
`
`
`53E85355.325%”96%kaEmcam
`
`
`
`”33:58:25va$8@2330a5.385%Among”:3mmenu
`
`85E883E:qubme
`
`
`Awififiwocsfifia
`
`£60@2330E:EmobawAMEFMVAimcoxm
`
`ES8333EEiobfiu
`
`260noacute
`
`
`
`O<mo53388”959.5:3%noxm
`
`mosmofisw
`
`
`
`
`
`$330%.:32:55momézm
`
`
`
`Samoa?E5“29:”:8:8?
`
`>305EbgzomoEgEEm
`
`”Evans:an:gem. Eat5%av?:86.2533van.EAmfififiwccsfifis$8@83305Sagan
`
`
`
`
`
`
`
`
`
`”28-5:3%coxmm5:zhmmEonuoEO-~.8352$?55:92;?
`
`
`
`
`
`
`
`:cuoflmnfirfl
`
`nouoflmcfirw
`
`:onoummcfirr
`
`caveats“;
`
`EEB§m
`
`cocoommfiwi.
`
`aouoommnfik
`
`souuflmcm;
`
`nonoouacfih
`
`
`
`HQEHm:OoMaui/0.50M
`
`
`
`
`
`
`
`.OSE”Boa820::@862{7:$390593b25358BEESsou—om,QEMO”Bum220::uomEBbEEfiuJimUEuoflozaomso3:325“..O<”359:-OJN.320.N”EchsfimSfix
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`48:38Egoomfiofifiom.:2§8m§b8.38.mumémHOSE@5532andoméSE”550930532908mangcfiweonmmoam
`
`
`
`
`
`
`
`
`
`<21—.OSE.oEO-N
`
`.3Ew=MéEwta<
`
`
`
`95:3”@3032
`
`
`
`<ZmmafiaoEO.N
`
`
`
`Avoomv.3mm955m
`
`
`
`83:8“mafia—2
`
`3308
`
`oEO-N
`
`Good.3EwEEmBfiH
`
`3.35
`
`oEO-N
`
`oEokm
`
`:89
`
`£25.3s2%?on
`
`85:6H8332
`
`£83
`
`.3Kwm=M-sztm<
`
`
`
`8.316“£3932
`
`@309
`
`.3Ewaywfiumtm‘q.
`
`
`
`2.330“$3032
`
`220-N
`
`.ES838:3.a?
`
`83:5“33on
`
`BEBE
`
`39035
`
`
`
`380$.3s@0602
`
`u—ZO-N
`
`308$.3.838502
`
`jc
`
`83:53530»:
`
`92ESE2:56
`
`52me
`
`Sarepta Exhibit 1031, Page 8 of 17
`
`

`

`ARECHAVALA-GOMEZA ET AL.
`
`1 2 3 4 5
`
`6 7
`
`8
`
`100 M
`bp
`
`0ck
`
`802
`
`A) A20
`
`A25
`830
`
`(+68+87) B)
`
`(+63+87)
`(+66+95)
`
`3'-UCUUUACGGUAGAAGGAACtl-S'
`3'_TTTGATCTTTACGGTAGMGGAACT_S'
`3'-GAUClJUUACGGUAGAAGGMCUACAACCUCoS'
`
`CMACTAGAAATGCCATCTTCCTTGATGTTGGAGGTACCTGCT~-/
`
`~~~
`
`AGA TGATCA TCAAGCAGAAGglalgagaaaaaalgalaaaagllggcaga
`(-12+8)
`3'_AUGUUCGUCUUCCAUACUCtl-S'
`(-9+11)
`3'-UUCGUCUUCCAUACUCUUUU-S'
`{-6+14j
`3'-GUCUUCCAUACUCUUUUUUA-S'
`(.3+17)
`3'_UUCCAUACUCUUUUUUACUA·$'
`(+1+20)
`3'-CAUACUCUUUUUUACUAUUU·$'
`
`C20
`020
`E20
`F20
`G2D
`
`~i~ (<-~:~~3·.CGTCTT<l;,,'f.~~<fgWpg~~~~~¥~!JUCA-5·
`
`FIG. 1.
`(ADs) compared in this project. ADs A25 and
`(A) Sequences and localization of the various antisense oligonucleotides
`125 were phosphorodiamidate morpholino oligomers
`(PMOs), whereas B30 corresponds
`to the sequences of both the 2' -O-methyl
`(2-0Me) version and the PMO. All remaining sequences were compared as 2-0Me AOs. (B) Eight different 2-0Me AOs were
`compared in a blinded fashion to evaluate their capacity to produce correct exon skipping in nonnal human skeletal muscle cells
`(hSkMCs). Once the code was revealed,
`the two most successful AOs (lanes 1 and 8) were studied in tenus of dose and time
`course. Lane 1, AO A20;
`lane 8, AO 830.
`
`obtained from muscle biopsies obtained at the Dubowitz Neuro-
`muscular Unit, Hammersmith Hospital (London, UK), both with
`the approval of the institutional
`ethics committee,
`and using
`slightly different protocols. The comparable
`results obtained in
`this way reinforce the findings presented here. Myoblasrs were
`seeded on Matrigel (0.1 mg/ml)-precoated
`6-well plates, cultured
`in differentiation medium (Dulbecco's modified Eagle's medium
`[DMEM] plus 5% horse serum) (IC), or in supplemented mus-
`cle cell differentiation medium (Promocell, Heidelberg, Ger-
`many) (RH), and transfected when myoblasts fused to form vis-
`ible myotubes
`(elongated cells containing multiple nuclei and
`myofibrils), usually after 2 days. Transfection reagent Lipofectin
`(Invitrogen, Paisley, UK) was added to the AOs at a ratio of 2
`}JJ of Lipofectin to 1 fLg of 2' -OMe AO, or 4 fLl of Lipofectin
`to 1fLg ofPMO, optimized previously (data not shown), and my-
`otube cultures were incubated with the mixture for 4-5 hr, ac-
`cording to the manufacturer's
`instructions. AO concentrations
`ranging from 50 to 500 nM were used for experiments exploring
`dose-response
`correlations, whereas
`time course experiments
`were undertaken at concentrations of 100 and 300 nM.
`
`Explants
`2-3 mm'
`in
`approximately
`into fragments
`Muscle was cut
`size and transferred to a 24-well plate containing a 400 nM con-
`centration of the AOs diluted in a final volume of 500 }JJ of
`OptiMEM (Invitrogen) plus penicillin (100 units/ml) and strep-
`tomycin (0.1 mg/ml). Forty-eight hours after the infusion, 500
`fLl of DMEM plus 10% horse serum was added to each welL
`RNA was isolated 7 days after the infusion.
`
`RNA isolation and reverse transcription-polymerase
`chain reaction analysis
`Again, slightly different methods were employed in the dif-
`ferent
`institutions
`for RNA isolation and reverse transcription-
`polymerase
`chain reaction
`(RT-PCR)
`analysis,
`thereby con-
`fmning the validity of the results obtained. Twenty-four hours
`after transfection (or later in time course experiments), RNA was
`extracted with TRIzol (Invitrogen)
`(IC), or with the RNeasy sys-
`
`tern (Qiagen, Crawley, UK) (RH). Aliquots of 400 ng of total
`in a
`RNA were used for RT-PCR analysis
`(55°C for 35 min)
`20-fLl reaction using Transcriptor
`reverse transcriptase
`(Roche)
`(IC) and a specific primer
`(primer
`sequences
`available on re-
`quest). Three microliters of this reaction was used as a template
`for a primary PCR consisting of 20 cycles of 94°C (40 sec),
`60°C (40 sec), and 72°C (80 sec), using specific primers de-
`pending on the deletions present
`in the cells. From this reaction
`1.5 fLI was later used as a template for a nested PCR, consist-
`ing of 30 cycles of 94°C (40 sec), 60°C (40 sec), and 72°C (80
`sec). Alternatively (RH), RNA was subjected to single-tube RT-
`peR using a GeneScript
`system (Genesys, Camberley, UK).
`PCR products were analyzed on 1.5% agarose gels in Tris-ac-
`etatelEDTA buffer. Skipping efficiencies were determined
`by
`quantification of the PCR products at the Center for Human and
`Clinical Genetics
`(Leiden University Clinical Center, Leiden,
`The Netherlands),
`using a DNA 100 LabChip kit and an Agi-
`lent 2100 bioanalyzer
`(Agilent Technologies,
`Palo Alto; CA).
`
`Sequence analysis
`RT -Pt'R products were excised from agarose gels and ex-
`tracted with a QIAquick
`gel extraction
`kit
`(Qiagen). Direct
`DNA sequencing was carried out by the MRC Genomics Core
`Facility.
`
`Western blot analysis of dystrophin protein
`Cells were cultured and transfected as described above. One
`week after
`transfection,
`cells were harvested
`(four wells per
`sample) and washed with phosphate-buffered
`saline (PBS) and
`protein extracts were isolated directly in 50 ILlof loading buffer
`(75 mM Tris-HCI
`[pH 6.8], 15% sodium dodecyl sulfate [SDSJ,
`5% 2-mercaptoethanol,
`2% glycerol, bromophenol
`blue, and
`protease inhibitors). Samples were denatured at 95°C for 5 min
`and centrifuged at 18,000 X g for 5 min before being loaded in
`a 6% polyacrylamide
`gel with a 4% stacking gel. Gels were
`for 4 hr at 100 V and blotted to a nitrocellu-
`electrophoresed
`lose membrane overnight at 200 mAo Blots were blocked for 1
`hr with 10% nonfat milk in PBS-Tween
`(PEST) buffer and
`
`

`

`DYSTROPIllN EXON 51AO COMPARISON
`
`dystrophin protein was detected by probing the membrane with
`NCL-DYS 1 primary antibody (Vision BioSystems, Newcastle
`upon Tyne, UK) diluted 1:40 i