`
`II :Z3
`
`FrC~J~-'IiOODC.HBURH 33
`
`+
`
`T-156 P.13/16
`
`F-131
`
`DOCKET NO.: CARP-0057
`
`PATENT
`
`APPENDIX A
`
`Claim LUnitation
`
`Suppon in Adair Application
`
`24. A humanized immunoglobulin having
`complementarity determining r~gions
`(CDRs) from a donor immunoglobulin and
`heavy aad light chain variable region
`frameworks from human acceptor
`immunoglobulin heavy and light chains
`
`which humanized immunoglobulin
`specifically binds to an antigen with an
`affmi'Y constant of at least 108 M-1
`•
`
`wherein said humanized immunoglobulin
`comprises amino acids from the donor
`immunoglobulin framework outside bOth the
`Kabat CDRs and the strUcruralloop CORs
`of lhe variable regions,
`
`wherein dle donor amino acids replace
`corresponding amino acids in the acceptor
`immunoglobulin heavy or light chain
`frameworks,
`
`and each of said donor amino acids
`contributes to antigen binding as determined
`by X-ray crystallography .
`
`49. A humanized immunoglobulin having
`compleJilentaricy determining regions
`(CDRs) from a donor immunoglobulin and
`heavy and light chain variable region
`frameworks from human acceptor
`immunoglobulin heavy and light chains
`
`See page 1. lines 5-16. and page 7. line 32,
`through pag~ 8, line 21.
`
`See page 11, lines 27-30.
`
`See page 6 , lines 14-23, page 8, lines 13-16.
`and page 19, line 16, to page 20, line 15.
`
`See page 6, line 12, to page 7, line 5 .
`
`Page 38, lines 1-12, and lines 23-38, and
`Figs. 3-4 of lhe application as filed reference
`residues that may ''contribute to antigen
`binding" as determined using X-ray
`crystallography. Residues 48, 49, 71, 73,
`76 , 78, 88, and 91 are so identified in
`Figure: 4.
`
`See page: 1, lines 5- 16, and page 7, line 32,
`through page 8, line 21.
`
`- 9 -
`
`Board Assigned Page #1 Ol:II:S
`
`PFIZER EX. 1595
`Page 1251
`
`
`
`
`
`
`
`
`
`
`
`Serial Number 07/743,329
`Art Unit 1807
`
`1 ). This Action is in reSJY)t1S<& to U1e paper filed April 2 1, 1993.
`Claims 1-66 have been cancelled, and claims 67- 11 9 have been newly
`a<.idef. AU or Applicant's arguments have been tllorougtlly revie~,~M but are
`deerr~d non-persuasive for tli.e reasons V¥1lich follo'¥!. This Action is made
`FINAL.
`The current statJJs of t11e pending claims is as follows:
`
`Claims 67-119 are- rt>ject&d under 35 U.S.C. 112, first paragraph, for
`introducing new matwr.
`Claims 6 7- 1 1 9 st.and reje<ted under 3 5 U .S.C. 11 2, first paragraph
`scope.
`Claims 67-117 stand rejected under 35 U.S.C. 103.
`
`t 6. The following is a quotation of the first paragraph of 35 U .S.C. 11 2:
`
`"The spedfication shall contain a VY'ritten description of the invention,
`and of the manner and proce-.3S of making and using it, in such full, clear,
`concise, and exact. tHms as to enable any person skilled in the art to
`which it pertains, or wit11 ~.•lhidl it is most nearly connected, to make and
`use the same and shall set fe>rtll tlle best mode contemplaOO<l by U1e
`invrentor of carrying out his invention.·
`
`The specification is objected to under 3 5 u.s .c. 1 12, first paragraph, a.s
`tile speciHcation, as originally filed, does not provide support tor the
`\nvention as is now claimed. Claims 67-119 have been amend~d to include
`the limitation that uin said COtnpOSiOO lleaV}T Chain, aminO aCid residUeS
`5,3, l 0, 12 - 17,19,2 1,22;40, 42 .:44,66,63, 70,74; 77,79,8·1,33-35.90, 92,
`105, 109, 111- 11_3 at least are acceptor residues". However, nowhere in t11e
`s~·cification is the invention described as containing· thE1se ~rtj.cu.lar
`acceptor amino acid residues. Applicant points to t11e specification as
`teaching a number of residues wnicll can be considered tor changing from
`acceptor to donor residut>s and alleges tllat this teaching is support for the
`amendment on the grounds that "it follows tllat if a residue has not been
`considered for changing, that. it must remain as in the acceptor chain u. This
`
`Board Assigned Page #1 1 03
`
`PFIZER EX. 1595
`Page 1256
`
`
`
`Serial Numb-er 07/743,329
`Art Unit 1807
`
`a1·gument is not convitKing becaus-e- it does not necessarily follo\•.r t11at the
`unmentioned residues \'\Fere originally contemplated as only being acceptor
`residues. Tl'lat is, by not specifi(:a.lly describing vvhettter particular resiclues
`are to acceptor or donor, can be interpreted to mean that tlle source of tllese
`residues •,4fc1s irrele\·ant, i.,e tl1ey could oo Vlhether acceptor or donor
`residues. Therek•re, this amendment intt·ocluces new matter into l11e
`specification 'VIJ1licll is not supported hy thE> original specification.
`
`Claims 71, 78, 85, 92, ,99, 106,118 have been further amended to
`include a limitation vlh.ic11 is not supported by the original specification.
`These claims have been amended to recite that the amino acid residues
`2,4,6,3&,~ 67 and 69 as being donor r&sidu.es is supported by the passage
`on page 2 1, lines 13-16 C>f the specification. However, these pages ~ach tllat
`amino acid residues 2.4.6.3&,.1Q. 67 and 69 can l)e additionally changed to
`donor residues but does not teach tllat amino add 48 is cllanged to a donor
`residue. Therefore, this amendment introduces new matter w'hich is not
`supported by the original specification.
`
`Claims 72. 79, 86, 93, 100)071lave also been fw·tller amended to
`include a limitation \-'11lich is not suppctti:ed b}r tl1e original specification.
`T11ese claims recite that amino acid residues 7.9.11, 15,20,25,37.37.41, 45,
`47,48,72,75,80))2,86-89,9 1,93, 103)08, 110 and 112 are additionall}T donor
`residues. However, th~ spedficati·;:·n d~s not teach the conc~pt that th&w
`particular amino acid residues are limit~d to b~ng only acceptor amino
`acids. Applicant argues that this limitation was derived by taking all the
`donor residues mentioned in claims 67 to 71 and specifying that all other
`residues are acceptor residues. This rationale is not convincing because the
`original speciiication does not describe Uw invention as encompassing
`antibodies in w1lich the amino acid residues 'Which remain acceptor residues
`are specifically identified as these particular amino acid residues recited in
`claims 72, 79, 86, 93, 100, 107. Th~refore, this amendment introduc~ new
`matter into the specification 'W'tlich is not supported by the original
`spedfication.
`
`2
`
`Board Assigned Page #11 04
`
`PFIZER EX. 1595
`Page 1257
`
`
`
`S€- rial Number 07/74.3,329
`Art Unit 1807
`
`Claims 1 0&- 113 have t:een further amencled to specifically recite
`particular light chain amino acid residues which are limited to being only
`accepoor amino acids r esiduw, i.E?. f(;>b.id uBs 5,7-9 .. 11, 13- 18)0,22,2 3,39,41-
`43,5 7,59,6 1, 72, 74-79,8 1,82l,4J>6,o8, 100, 104, 106 and 107. The
`spedfication t1oes not te3.d l that tllese p~:trticuJar positions in the ciisclosed
`antibodies are limited to being only acceptor residues. The specification does
`not discuss tlie~ amino add po:~ition B.nd U1erefore t.lle original specification
`appears to reach that the source of tllese amino acids, i.e. from acceptor or
`donor, is not important to Uie invention. Thereion~. this amendment
`introduces new matter which is not supfNrted but the original specification.
`
`Claims 113 and 119, dra~.rn to a method for producing r~ombinant
`antigen binding molecule, are not supported b}· the original spe<.iiication.
`Applicant points to now cancelled claims 66 and 67 submitted in the
`amendment filed February 9, 1993, has providing support for claims 11 a
`and 199 respectively. Hov .. ·ever, the February 9, 1993 amendment does not
`appear to point to a passage in tbe originally nled specification \·\lbich
`supports the particulars of the- claime-d method. The specification doos not
`appear to disclose a method having steps in tbe specific order 8.s claimed.
`Tlle specification also doos not descril)e the list of amino acicl positions wllich
`are at least maintained as tt1e acceptor amino adds as previously discussed.
`The specification appears to discuss amino acid positions Which may be
`important in the structural and functional integrity of the humanized
`antibodies. The specification does not describe the particular order of
`making amino ad d changes as is now claimed in the steps of claims 1 13 and
`1 19. Specifically the specification doe-s not appear to ooach that the affinity.
`of a generated humanized antibody is measured in order to determine if
`additional amino add substitutions to the acceptor sequence are to be made.
`Therefore the amendment of these claims introduces new matter Wbich is
`not supported by the original s~cification.
`
`17. Claims 67-11 g are rejected under 35 U.S.C. 11 2, first paragrapll,
`for the n~asons set forth in the objoction to tlle specification.
`
`3
`
`Board Assigned Page #11 OS
`
`PFIZER EX. 1595
`Page 1258
`
`
`
`Serial Number 07 i/43,329
`Art Uni t 1 o07
`
`1 &. The objection to the disclosure b-ecause of the use of terms suc11 as
`"hw-nanised" and "bumanisation" is withdra\A.rn in light of Applicant's
`convincing arguments.
`
`1 9. The obj~ction oi claims 5, 11-16,2 2 and 2 3 made under 3 7 CFR
`1.75(c) as being in itnproper form has been obviated by the cancellation of
`these claims.
`
`2 0. Tlle objection of claims 1-2 3 made over the recitation of "CDR(cid:173)
`grafted" llas been obviated by t11e c.ancellation of these clairns.
`
`2 l. The rejection of clairns 1- 12 made under 3 5 U .S.C. 10 l oocause
`the cla imed invention is inoperative and therefore lacks patentable utility
`has been obviated t)y t11e cancellation of these claims.
`
`22. The rejection of claims 17 made under .35 U.S.C. 10 1 because the
`claimed invention is dra'"'1n to non-statutory subject m·atter llas been
`ot>viaood by the cancellation of claim 17.
`
`23. The rejection of claims 22-2.3 made under 35 U.S.C. 101 because
`the invention \4t'aS inoperative and U1er~fore lacked patentable utility, has
`been obviated by the can~;ellation G>f these claims drawn to tllerapeutic
`com positions.
`
`2 4. The obj<Ktion to tlle sp~cification and the r~jection of claims 1- 12
`made under 35 U.S.C. 112, first paragraph, as failing to adequately teach h~w
`ro use the isolated heavy and light chains antibodies fragments for the
`disclosed utility, bas been obviated by the cancellation of claims 1- 12.
`
`25. The objection to the specification and tlle rejection of claims 22-
`2 3 n1ade under 35 u.s.c. 112, first paragraph, as failing to adequately teach
`how to use the claimed compositions as therapeutic or diagnostic agents, ha.s
`been obviated t)y the cancellation of claims 22 -2.3.
`
`2 6. The rejection of claims 1.3- 16 made under 35 U .S.C. 11 2, first
`paragraph, as the disclosure is enabling only for claims limited to sp<K;ific
`
`4
`
`Board Assigned Page #11 06
`
`PFIZER EX. 1595
`Page 1259
`
`
`
`S~ria.l Num~r 07/743,329
`Art Unit i 007
`
`CDR-graited antib<)dies disdosed in th~ specification as having effective
`binding affinities for tl1e-ir specific antigen, has been obviated by the
`cancellation of claims 1 ~l- 16. However, tlle rejection no\&.r applies t1) nEniVly
`added clairns 6 7- 117. The ·:-lahns are not commensurate in scope v.litll the
`present disclosure. Insufficient guidatKE! and working examples are
`provided in the specification to support the broad claims dra-wn to any CDR(cid:173)
`grafted antitxxties vvbich contain donor residues at the recited framework
`amino acid positions for ttu? heavy and light chains. The specifiCation does
`not sufficiently develop tbe concept that U1er~ are certain framework amino
`acids ~ .. hich v.men changed in the acceptor sequence to be tilt> same as in the
`donor sequence result in an increase in antigen binding affinity. Tile
`specification d oes des<.1-ibe several examples v..'llere particular frame'WOrk
`amino acid cha.nges result in increased antigen binding aifinity, such a.s an
`for OKT-3, OKT-4, and anti-ICAM. Ho\'.re'io·er, the specification does not dearly
`establish that every time the rt>cited amino acid positions are the same
`between the donor and the acceptor. "go<.'<!" binding to antigen is observed.
`The spedtication does not provide actual biding values for most of the
`examples, but instead qualitatively describes the binding of the llumanized
`antibody to antigen, Furthermore, tn light of the prior art (for instance,
`Reichmann et al., Queen et al., and 010thia et al.) such a universal property
`appears to be unpredictable since different antibodies willllave different
`amino acids in tlle framevv·ork which a.re important for antigen binding and
`stability. TI1e prior art does not teach t11at a standardized principle c.t Which
`amino acids must al,Nays be changed is possible, but instead appears to teach
`that three dimensional structures of the antibodies and an understanding of
`protein folding properties, is necessary to be able to reasonably predict
`'"-'l"lich amino acids \Avill al\A/ays be effective in increasing or retaining antigen
`binding ability. Therefore, tl1is analysis shows that undue experimentation
`would be required of the skilled artisan in order to practice the invention as
`claimed.
`
`Applicant traverses the rejt>etion on the following gr<)Unds. First,
`Applicant states that Queen et aL provides little guidance for making
`recombinant antibodies but acknNvledges that Queen et al. does teach to
`first stoled a human chain 'tAlilicll is as closely comJ:-13rabte to U1e murine chain
`
`5
`
`Board Assigned Page #1 1 07
`
`PFIZER EX. 1595
`Page 1260
`
`
`
`S~rial Nurnber 07/7 43,32 9
`Art Unit 1807
`
`as possible, follov.Jed b~· cornpu.ter mc·d~1Hng to det€1rm me which residues
`outside of t!te CDRs are impr.Jrtant for ~-t1hgen binding. AppHcar1t. states Umt
`Queen et. at. does not provide guidance as to v~.o11icll residues are criticai for
`improving affinity. Applicant argues that the l:i"achings in the present
`applicatic·n in contrast to tho& teachings of Queen et at. can be applied to any
`antibody. Applicant asserts that computer modelling is not necessE.l.ry in tll~
`present method. Applicant. argu.:s tlmt t11e specification refers to nine
`diiier~nt antibodi~ '"lhidr have teen successfully humanized, and
`therefore Applicant that tlle skilled artisan would readily predict that the
`concept is applicable to other antibodies. Applicant points to Figures 7- 13 as
`showing data and page 60 as teaching binding a.fiinities of the humanized
`anti-ICAM.
`
`Applicant's arguments llave been thoroughly reviewed but are
`deem~d non-persuasive for the iollo¥.ring reasons. First, as amended, the
`claims ar~ broadly dra"\-Y-n to all antibodies having the spedfied amino acid
`don<lr and acceptor amino acids. Hovv~ver, t11e specification does not teach
`an antibod}r \o~,1flicll p<)sseSf.es all of the recited amino acids as claimed. Tbe
`specification teaches antibcodies "Wttid! have been altered at some of these
`positions} but does not teach antibodies in general v.lhich retain binding
`affinity for antigen every the ao.::eptor residues are changed or t11e same as
`tlle recited donor residues in the claims. Therefore, alt11ough the
`specification does describe r•ine different CDR graited antibodies, the
`specification does not teach variants oi these antibodies Y\rhich have been
`additionally modified as recited in the claims. Since the speci.iication does
`not teach a r~present.ative number of Ule antibodies \'\Tb.icll are encompassed .
`ty,• the broadly 'ilv"ritten claims, the specification doos not appear to have
`established th~ gerl:erality of tile recited amino acid positions being
`important for antigen binding and stability. Because no standard and
`reprCiducible rules are available for predicting protein folding, t11e ability to
`predict that all the recited amino acid positions ~..vill alVv'ays produce
`fw1ctional antibodies regardl~ss of antigEfn binding specificity and source of
`anUbody acceptor and donor is not reliable. Therefore this rejecUon is
`maintained and made FINAL.
`
`6
`
`Board Assigned Page #11 08
`
`PFIZER EX. 1595
`Page 1261
`
`
`
`Serial Number 07i743 .. 329
`Art Unit 1807 .
`
`27. The rejection of claims 1-23 made under 35 U.S.C. 112, second
`paragrapll, as being indefinite has been ol)Viated by U1e c-ancellation oi
`claims 1-2 3.
`
`2o. Tlie reje>.~tion or claims 1,5,6-.J, 12-22 made un<ier 35 usc 102(b)
`as being anticipa~d by Reichmann et al. has been obviated by the
`canc~llation of th~e claims.
`
`29. Tlle rejection of claims 1-6 and 12 -22 made under 35 U.S.C.
`102(b) as being anticipat~d by Queen etal. h".s been ob•!iated b:v· the
`cancellation of these daims.
`
`30. The reje(;tion of claims 1-21 made under 35 U.S.C. 10.3 as being
`unpatentable over Reichmann et aL and Queen et al. llas been obviated by
`the cancellation of claims 1-21. However. this rejection no\1! applies to
`ne\A.o1y added claims 6 7-117.
`
`D<)t1.l Reichmann et at. 3Jhj Queen et. aL teach how to mal~e l1Umanized
`antibodies using a human antibody variable domain framevo~ork as an
`acceptor and a rat antibody (in the case of Reichmann et aU or a murine
`antibody (in the case of Queen et al.) as the complementarity dewrmining
`region <ionor. Both of these references also teac11 how to i<ientify framewot1~
`a.mino acids which are important for retaining the binding effective
`conformation of the CDRs. Specificall>•, Qu*n et al. ooach that tbe more
`homologous the lmman antibody is to tll& murine antibody r~uces tlle
`likelihood of producing distortions in the CDRs. Furthermore, Queen et al.
`teach making a database comparison of all kno\l}Il human antibodies Vlith tlle
`donor antibody to de~tmine the most similar human antibody t.o us~ as the
`fra.me\v"'rk (pa.ge 10031, col. 2, paragraph 2). Queen et al. also teach making
`a n1olecular model of the donor variable domain (in this case the anti-Tac V
`domain) based upon homology to other antibody V domains whose crystal
`structure is kno'\lm. By doing so, Queen et at. teach that amino acids outside
`<Ji the CDRs Vv11ich are close enough to the CDRs to influence the CDR
`
`7
`
`Board Assigned Page #1 1 09
`
`PFIZER EX. 1595
`Page 1262
`
`
`
`Serial Number 0? /743,329
`Art Unit 1807
`
`conformation or to diro&ctly intera<:t \•lith the antigen. ~Vlle-n the residue-s
`\•'tere dHferent between the l1Uman and U1e donor murine antibodies, the
`111.1man rram~Vv'Orlc amino acid v ... ·as changed to th~ corr~sponding murine
`a.mino acid (page 10031, cot 2 paragraph 3). Finally, vlhen the human
`acceptor Emtibody contains u1msual amino acids witll respect to consensus
`sequences in homoh.'lgous antilYxiies. Queen et al. r~ommends cllanging
`U"lese amino acids to tne consensus amino add (page 10032, col. 1)
`Reicl1mann et al. and Queen et al. fw-thH ~ach that different changes ·,·vill be
`necessary depending on the specific donor and acc-eptor antibodies which a.re
`used. Both references each the eDNA encoding the heaV)1 and light antibody
`chaJns wl"dcll are the templates tor tnalcing tlie specific cllanges in the
`sequences of CDR-grafted antibodies. The references also botll teach U1e
`insertion of t.h~ cDNAs inti;> v~tors, transi~tion of t1ost cells and co(cid:173)
`expresswn of the heav7 .. and ligl1t chains to result in the expression of a
`complete CDR-grafted antibody molecule.
`
`Therefore, it would have been prima facie obvious to one of ordinary
`skill in the art at the time the invention -v..ras made to use U1e guidelines
`taught by Reichmann et aL and Queen et at to reshape any given antibodv to
`"humanize· that antibody by making the changes in tlle frame\-li"'rk regions
`of the t1Uman acceptor sequen<~e to the donor residue v..1hen those residues
`are close to the CDR's and \'Jtlen the amino acids would be expected to affect
`the conformation of t11e CDRs. One of ordinary skill would 11ave been
`motivated to make the changes in tlle framework regions from the human
`amino acid to the donor amino acid in order to achieve the expected benefit
`of increasing the binding affinity of the humanized antibody for the specific
`antigen o~!er the binding affinity observed in tbe humanized antibodies
`which do not contain the framework changes as taught by Queen et at. (page
`10032, col. 1, para. 3 through col. 2) and Reichmann et al. (Figure 4}.
`
`Applicants traverse the reiection on the follo-v,'ing grounds. First,
`applicants argue that Reichmann et at. does not go beyond the original idea
`of Winter et al. WO-A 69/07452 '*1licl1 teaches transferring only the CDRs to
`a hwnan frame;·.-·ork.. Applicant iurther argues that Reichmann et at. only
`changed residues 27 and 30 because- the at donor sequence ·v~~as found to be
`
`Board Assigned Page #1 11 0
`
`PFIZER EX. 1595
`Page 1263
`
`
`
`Serial Number 07/743329
`Art Unit 1807
`
`unusual. Also, Applic'"ult points c·ut that R~ichmann ~tal. did tKit mak.~ any
`framework residue change~; b) t.he light cllain of tJ1e antibody outside of the
`CDRs. Applicant argues tllat Reichmann et al. <to not t~ac11 Ulat these c11anges
`are generally applicable to other antibodies. Also, Applicant states that
`Reiclunann et al. do not suggest that altering residues remote from the C:DRs
`might oo ~ifective in improving affinity nor that t11ere might b:" a hierarchy
`of residues wllidi shouw be considered.
`
`Sec(1fld i·.ppli(:ant. argu% that Queen et al. teach the amino add
`sequence of the donor antibody chain should be determined and then
`compared to that of kno'N'll acceptor chains and an acceptor chain chosen
`v"hich is as homologous as possible to Ul.e donor chain. Applicant further
`states that tlle next step in Queen et al. is to <:arry out. a computer modelling
`exercise to determine UH~ residues W11ich may t)e involved in 3.ntig~n
`binding. Applicant alleges that this step may not aho\7ays l~ad to the same
`results. Applicant also alleges that the fact that the donor sequence is
`compared to a number oi possible acceptor sequences and that a computer
`model of the donor must be made, sho\"''S that the procedure is specific t:·
`one antibody at a time. Applicant asserts that QuMn et al. does not suggest
`that tll& changes taught. for reshaping the anti-TAC antibody could be
`expected to be tile same necessary in anot11er recotnbinant antibody.
`Applicant also states that Que€'n et at doe snot teach an antibody containing
`all the donor residues redted in the claims.
`
`Applicant's argw-rtents have been thoroughly reviewed but are
`deemed non-persuasive for the follovving reasons. First, the claims have not
`b*n rejected as obvious over Reichmann et al. alone nor over Queen et al.
`alone. Instead, the claims have been rejected over tl1e combined teachings
`of both Reichmann et at. and Qu~n et al. ConsequenUy, Applicant's
`arguments do not address the rejection made. Second, Applicant's.
`arguments are directed to a procedure of making recombinant antibodies but
`claims 6 7- 117 are drawn to recombinant antibodies not to a method of
`making those antibodies. Therefore, "men Ule prior art teaches an antibody
`whicll is encompassed by the broadly 1n'l"itten claims Wllich is made by a
`different method than the procedure disclosed in the specification, the prior
`
`9
`
`Board Assigned Page #111 1
`
`PFIZER EX. 1595
`Page 1264
`
`
`
`Serial Number (fl/743.329
`Art Unit 1807
`
`art still reads on the daims. Therefore, ·•Nhile Reichmann et al. and Queen et
`al. do not specifically teach tJ1at certain non-CDR framework amino act(!S
`must alvv'ays be either acceptor or donor residues, these references do teach
`that best antigen binding affinities \'.10Uld be t>k"Pt>ded \lo!llen the ovHall
`sequ.erlc€-
`the donor is nwst. similar to tl1e acceptor and that amino acids
`'h1lich come into contact with the CDRs should be donor residues. How tl1ese
`residues are identified is irrele~·ant •··lllen tlle claims are drc\V{t1 to tllt>
`antibodies themselves. Furthermore, the claims as 'Y\7!'itten are not limited to
`antibodies in which the d()nor is non-human or that all the "donor residues
`are from tlle sarne donor. Many of t11e specific: residues recited in the clairns
`as being donor residues, are identical in t11e accept~?r and ttH~· donor.
`Consequently, Th references teach man;' of U1e specific amino acid
`Hrnitations Vvithout t~aclling tl1at t11ese amino adds nB-ed to be change·d.
`Therefore, ior all of these reasons, this rejection is maintained an<l made
`FINAL
`
`31. No claims are allow~.ble .
`
`32. THIS ACTION IS MADE FlNAL. Applicant is reminded of the
`extension of time policy as set forth in 37 CFR L 136(a). The practice of
`aut~·matically extending tlle shor~nw statutory period an additional montll
`upon tl'.1e filing of a timely first response to a final rejection has been
`discontinued by the Office. See 102 l TMOG 35.
`
`A SHORTENED STATUTORY PERIOD FOR RESPONSE TO THIS FINl·.L ACTION IS
`SET TO EXPIRE THREE MONTHS FROM THE DATE OF THIS ACTION. IN THE
`EVENT A FIRST RESPONSE IS FILED WITHIN TWO MONTHS OF THE MAILING
`DATE OF THIS FINAL ACTION AND THE ADVISORY ACTION IS NOT MAILED
`UNTIL AFTER THE END OF THE THREE-MONTH SHORTENED STATUTORY
`PERIOD, THEN THE SHORTENED STATUTORY PERIOD WILL EXPIRE ON THE
`DATE THE ADVISORY ACTION IS 1-..fAILED, AND ANY EXTENSION FEE
`
`10
`
`Board Assigned Page # 1112
`
`PFIZER EX. 1595
`Page 1265
`
`
`
`Serial Number 07/74~,329
`Art Unit 1807
`
`PURSUANT TO 37 CFR 1.136(a) WILL BE CALCULATED FROM THE MAILING
`DATE OF THE ADVISORY ACTION. IN NO EVENT VI"ILL THE STATUTORY
`PERIOD FOR RESPONSE EXPIRE U·. TER THAN SIX MONTHS FROM THE DATE OF
`THI S FINAL ACTION.
`
`33. Papers relating to this application may oo submitted to Group 180
`l)y faCSimile transmission. Papers should be iaxed to Group 1 .SO via the
`P.T.O. Fax. Center located in Cr ystal !"{all 1. Tht> CM 1 Fax Center nmnber is
`(703) 308-2 730. Papers may be submitted Mc)nclay-Fr iday betwqen .~:00
`am and 4:45 pm (EST). Please note t.nat the faxing of such pa~rs must
`cc>tliorm V.Jitll tlH~ Notice to comply in the Official Gazette, 1 og6 OG 30
`(No'i~ember 15, 1 9&9).
`
`34. Any inquiry concerning this communication or earlier
`communications from the e~mminer should be directed to Lisa Bennett
`£u.rthur (nee Lisa T. Benn€-tt) w'11ose telephone nw11ber is (703) 308-3930.
`Any inquiry oi a general nature or relating to the status of an application
`should be directed to the Group 1 ~0 roceptfonist vmose telept10ne number is
`(703) 305-0196.
`
`Lisa Bennett Arthur
`September 2, 1993
`
`/17(L
`
`MARGARET PARR
`SUPERVISORY PATENT EXAMINER
`GROUP1800
`
`;.,
`
`11
`
`Board Assigned Page #11 13
`
`PFIZER EX. 1595
`Page 1266
`
`
`
`..
`
`l
`
`ED: 0.8/2010
`ENT NO: 61
`
`DOCKET NO.: CARP-0046
`
`PATENT
`
`IN THE UNITED STATES PATENT AND TRADEMARK OFFICE
`
`In re patent application of: John R. Adair, Diljeet S. Athwal and John S. Emtage
`
`Serial No.: 08/485,686
`
`Group No.: 1642
`
`Filed: June 7, 1995
`
`Examiner: J. Burke Reeves
`
`For: Humanized Antibodies
`
`I, Doreen Yatko Trujillo, Registration No.JS,719 certify that this
`correspondence is being deposited with the U.S. Postal Service as
`First Class mail· in an envelope addressed to the Commissioner of
`Patents and Trnderoorl<s, Washington, D.C. 20231.
`
`Assistant Conunissioner for Patents
`Washington, D.C. 20231.
`
`Dear Sir,
`
`REQUEST FOR RECONSIDERATION
`
`This responds to the Office Action dated February 29, 2000. A petition for a three-month
`
`extension of time and the appropriate fee accompanies this response.
`
`Claims 56-73 were pending. All pending claims were rejected in the Office Action. In
`
`view of the arguments and amendments that follow, Applicants respectfully request withdrawal
`
`In the specification:
`
`of all rejections upon reconsideration.
`
`Please amend tlJe specification as follows: c(cid:173)
`
`Page 1, line l , after "9/07/94", replace "copending" with-- issued as
`
`Carter Exhibit 2029
`Carter v. Adair
`Interference No. 105.744
`
`Board Assigned Page #11 14
`
`PFIZER EX. 1595
`Page 1267
`
`
`
`•
`
`•
`
`DOCKET NO.: CARP-0046
`
`PATENT
`
`u.s. 5,859~ --.
`Page 23, line 20, please delete "Figure I shows" and in~ Figures l a and b
`
`show--.
`At page 23, line 21, ins~-(SEQ ID NO: 4 and 5)--between "chain" and";".
`Page 23,line 22, please de(e(e "Figure 2 shows" and i~res 2 a and b
`
`show--.
`
`At page 23, line 23, insert --(SEQ ID NO: 6 and 7)--~n "chain" and";".
`At page 23, line 26, insert --(SEQ ID NO:~d 9)--be~"REI" and ";".
`
`At page 23, line 29, insert --(SEQ ID NO: 7 and 10) - between "KOL" and";".
`
`At page 23, line 3o, please delete "Figure 5 shows" and in~Figures 5 a- c show --.
`
`At page 23, line 32, insert --(SEQ ID NO: 7 and 11-24)- between "grafts" and";".
`,....
`
`At page 23, line 35, insert --(SEQ ID NO: 5, 8, 9, and 25rnr= between "grafts" and";".
`~ 24, line 6, please delete "Figure 10 shows" an~- Figures I 0 a and b
`
`shoC.
`
`At page 24, line 8, please delete "Figure 11 sh~sert -- Figures 11 a and b
`
`show--.
`
`At page 30, line 31, iose~Q ID NO: I) -- between
`At page 30, line 33, insert --(SEQ ID ~ "CAGGGGCCAGTGGATGGATAGAC".
`
`"TCCAGATGTTAACTGCTCAC" and "for".
`
`At page 33, line 26, insert --(SEQ,¢' NO: 3) --after
`
`2
`
`Board Assigned Page #1115
`
`PFIZER EX. 1595
`Page 1268
`
`
`
`
`
`
`
`•
`
`PATENT
`
`DOCKET NO.: CARP-0046
`
`Remarks
`
`Preliminarily, Applicants note with appreciation the Examiner' s observation that the claims are
`
`free of the prior art.
`
`The specification has been objected to because, inter alia, the first line of the specification needs
`
`to be updated to reflect the status of any parent applications, and to reflect the parent international
`
`application. Applicants direct the Examiner to the transmittal letter of the present application in which
`
`the latter amendment was effected; the former amendment has been effected herein.
`
`The Brief Description of the Drawings was objected to as not conforming with the labelling of
`
`the figures. The specification has been amended herein to place the BriefDescription of the Drawings in
`
`conformity with the figures. No new matter was added thereby.
`
`The specification was objected to as not complying with the Sequence Rules and Regulations.
`
`Specifically, the Examiner suggested that the specification be checked for missing sequence identifiers.
`
`The specification has been amended herein to add sequence identifiers. No new matter is added thereby.
`
`The specification was further objected to for missing text on pages 53 and 62. A substitute
`
`specification with the complete information is enclosed. Because the missing text was simply a copying
`
`error, Applicants have not submitted a marked-up copy showing the addition. If the Examiner so
`
`requires, one will be forwarded upon request.
`
`I. Rejections under 35 USC § 112, Second Paragraph
`
`Claims 56-73 have been rejected under 35 U.S. C. § 112, second paragraph, as allegedly indefinite
`
`in the recitation of"CDRS." Claims 56 and 62 have been amended to replace "CDRS" with "CDRs."
`
`5
`
`Board Assigned Page #11 18
`
`PFIZER EX. 1595
`Page 1271
`
`
`
`DOCKET NO.: CARP-0046
`
`PATENT
`
`Claims 56-73 have been rejected as allegedly indefinite in reciting parentheses around the
`
`phrases "in the framework regions" and "the CDRs." The parentheses have been removed from claims
`
`56 and 62 and an appropriate preposition added.
`
`Claims 56-73 have been rejected as allegedly indefinite for reciting "predetermined antigen."
`
`Claim 56 has been amended to remove "predetermined." Applicants respectfully submit that the claim
`
`as amended covers predetermined antigens.
`
`Claims 56-73 have been rejected as allegedly indefinite for reciting "an antibody molecule
`
`having affinity." Claim 56 has been amended to recite "binding affinity." Support for this amendment
`
`can be found, inter alia, on page 6, lines 21-22, of the application as filed.
`
`Claims 56-73 have been rejected as allegedly indefinite for reciting "the remaining heavy chain
`
`residues corresponding to the equivalent residues in a donor antibody." In claim 56 and 62, "using the
`
`Kabat numbering system" has been inserted after "equivalent residues." Support for this amendment can
`
`be found, inter alia, on page 8, lines 24-26, of the application as filed.
`
`Claim 58 has been rejected as allegedly indefinite for the inclusion of a comma after
`
`"corresponds." In claim 58, the comma after "corresponds" as been deleted.
`
`Claim 63 has been rejected as allegedly indefinite for reciting "at least one of residues 2, 4 ... 64
`
`to 69 ... " Claim 63 has been amended to recite the residues individually.
`
`Claims 64-72 have be rejected as allegedly indefinite for reciting "which is specific for." The
`
`Examiner alleged that is unclear whether the antibody molecule binds to the specific antigen or is
`
`otherwise "specific." Applicants respectfully disagree. Nonetheless, claims 64-72 have been amended ·
`
`6
`
`Board Assigned Page #1119
`
`PFIZER EX. 1595
`Page 1272
`
`
`
`DOCKET NO.: CARP-0046
`
`PATENT