`
`W088/09344
`
`PCTJUS88/01737
`
`1~/31
`so
`60
`40
`30
`20
`10
`CATCCCGAGGTTATGCTGGTTGAATCTGGTGGAGTACTGATCCAACCTGGTGGGTCCCTG
`0 P E V M L V E S G G V L M E P G G S L
`seal
`Ecoo
`
`120
`110
`100
`90
`80
`70
`AAGCTCAGCTGTGCTGC'l'ACCCCCTTCACGTTCTCTCGTTACCCCATCTCTTCGGTCCGT
`X L S C A A S G F T F S R Y A M S W V R
`Espi
`Nhei
`Pf'lMI
`
`..
`
`180
`170
`160
`150
`140
`130
`CAGAC'l'COGGAGAACCCTCTACACTGGGTOGCGACGATATCTTCTGCTCGTTCGAACACT
`Q T P E X R L E W V A T
`I S S G G S H T
`BspMII
`Xbai
`EcoRV
`Asuli
`Nrui
`
`240
`230
`220
`210
`200
`190
`TACTATCCAGACAGTC'l'CAAGGGTOGAT'l'CACGA'l'C'l'CTCGAGACAACGCTAAGAACACG
`Y Y P 0 S V K G R F T
`I S R D N A K N T
`Xboi
`
`300
`290
`280
`270
`260
`250
`T'l'G'l'ACC'l'GCAAATGTCTTCTC'l'ACGTAG'l'GAACA'l'ACTCC'l'ATGTAC'l'AC'l'C'l'GCACGT
`L Y L Q M S S L R S E D T A M Y Y C A R
`BspMI+
`SnaBI
`.
`ApaLI
`
`"360
`350
`- 340
`330
`320
`310
`CCTCCAC'l'CATC'l'CACTAGTTGCTGAT'l'ATGCCATGGATTATTGGGGTCA'l'GCTCC'l'AGC
`P P L
`I S L V A D Y A M D Y W G H G A S
`Ncoi
`Spei
`Nhei
`
`·420
`410
`400
`390
`380
`370
`GTTAC'l'GTGAGCTCTGGTGGCGGTCGGTCGGGCGGTGGTGGC'l'CGGGTGGCCGCGGATCG
`V T V S S G G G G S G G G G S G G G G S
`saci
`
`480
`470
`460
`450
`440
`430
`· GATATCGTTA'l'GACTCAGTCTCATAAGTTCATGTCCACTTCTGTTGGTGACCCTGTTTCT
`D IV M T Q S H.X F M S T S V G DR V S
`EcoRV
`BstEII
`
`540
`530
`.
`520
`510
`.
`500
`490
`ATCACT'l'GTAAGGCCAGCCACCATGTGCGTGCTGCTATCGCATGGTATCAGCAGAACCCC
`I T C X A S Q D V G A A
`I A W Y Q Q K P
`PflMI
`Sma
`
`600
`590
`580
`570
`560
`550
`GCCCAGTCTCCTAAGCTGCTGATCTACTGGGCGTCGACTCGTCA'l'ACTGGTCTCCCGGAT
`G Q S P K L L
`I Y W A S T R H T G V P D
`I
`Sali
`
`660
`650
`640
`630
`620
`610
`CGTTTCACTGGGTCCGGATCAGCTACTGATTTCACTCTGACTATTTCGAACGTTCAGTCT
`R F T G S G S G T 0 F T L T
`I S N V 0 S
`BspMII
`Asuii
`
`720
`710
`700 •
`690
`680
`670
`GATGACCTGGCTGAT'l'ACT'l'CTGCCAGCAATATTCCGGGTACCCTCTGACTTTCGGTGCC -
`D D LA 0 Y F C 0 Q·Y S G Y P L T F G A
`Sspi
`Kpni
`Nae
`Fl Cn. '1E
`
`750
`740
`730
`GGCAC'l'AAACTCGAGCTGAAG'l'AACTGCAG
`.L K *
`G
`'l' K L E
`I
`Xboi
`
`Psti
`
`PFIZER EX. 1502
`Page 3001
`
`
`
`W088/09344
`
`20
`10
`Met Lys Ala Ile Phe Val Leu Lys Gly Ser Leu Asp Ar; Asp Leu Asp ser Arq La~ Asp
`ATG AAA GCA ATT TTC GTA CTG AAA GGT TCA CTG GAC AGA GAT CTG GAC TC'l' CGT C'l'G GAT
`Bqlii
`
`40
`30
`Leu Asp Val Arq Thr Asp His Lys Asp Leu ser Asp His Leu Val Leu Val Asp Leu Ala
`CTG GAC GTT CGT ACC GAC CAC AAA GAC CTG TCT GAT CAC CTG GTT CTG GTC GAC CTG GCT
`Bell
`Sali
`so
`60
`Arq Asn Asp Leu Ala Arq Ile Val Tbr Pro Gly Ser Arq Tyr Val Ala Asp Leu Glu Phe
`CGT AAC GAC CTG GC'l' CGT ATC GTT ACT CCC GGG TCT CGT TAC GTT GCG GAT CTG GAA TTC
`EcaRI
`Smai
`
`Asp
`GAT
`
`I= I C,.. 10 A
`
`EcoRI
`Ssp!'
`
`pD312
`4801'bp
`
`Affl[
`
`F"IC,.. JO 5
`
`PFIZER EX. 1502
`Page 3002
`
`
`
`W088/09344
`
`PCI'fUS88/01737
`
`94- -
`...
`...
`67-
`~
`29- -
`~ 43-
`-
`t4.4- -
`
`~ 20.1-
`
`~
`
`~b ]31
`
`-
`
`a
`!r -
`-
`-
`
`-
`
`0
`
`2
`
`3
`
`4
`
`5
`
`FlC:n.ll
`
`0 V 0 L 0 E S G P G L V K P S 0 S L S L T C S V T G Y S I T
`S G Y F W N W 1 R 0 F P G N K L E W L G F I K Y D G S N Y G
`N P S L K N R V S I T R D T S E N Q F F L K L D S V T T A T
`YYCAGDNDHLYFDYWGQGTTLTVS
`
`C C C G S G G G G S G G G G S
`
`·O A V V T 0 E SALT T S P G G TV I LTC R SST G A V.T
`~ S N Y A N W I 0 E K P D H L F T G L I G G T S N R A P G V
`PVRFSGSL I GDKAALTITGAOTEDDAMYFC
`ALWFRNHFVFGGGTXVTVLG
`
`FIG. 9C
`
`PFIZER EX. 1502
`Page 3003
`
`
`
`
`
`
`
`WOSS/09344
`
`PCffUSSS/01737
`
`•
`
`60
`50
`40
`30
`20
`10
`GAA'l'TCATGGCTGACAACAAA'l"l'CAACAAGGAACAGCAGAACGCGTTCTACGAGATC'l"l'G
`E F M A D N X F N X E Q Q N A F Y E
`I L
`EcoRI
`Mlui
`Bglii
`XlDni
`
`120
`110
`100
`90
`80
`. 70
`CACCTGCCGAACCTGAACGAAGAGCAGCG'l'AACGGC'l"l'CA'l'CCAAAGCTTGAAGGATGAG
`H L P N L N E E Q R N G F
`I Q S L K 0 E
`.
`BspMI +
`Hinciiii
`
`180
`170
`160
`150
`140
`130
`CCCTCTCAGTCTGCGAATCTGCTAGCGGATGCCAAGAAACTGAACGATGCGCAGGCACCG
`P S Q S A N L L A D A K K L N D A Q A P
`Nhei
`Fspi
`
`240
`.
`230
`220
`210
`200
`190
`AAATCGGATCAGGGGCAA'l'TCATGGCTGACAACAAA'l'TCAACAAGGAACAGCAGAACGCG
`X S D Q G Q F M A D N K F N X E Q· Q N A
`Mlui
`Xmni
`
`300
`290
`280
`270
`260
`250
`TTCTACGAGATCTTGCACCTGCCGAACCTGAACGAAGAGCAGCGTAACGGC'l"l'CATCCAA
`F Y E
`I L H L P.N L N E E Q R N G F
`I Q
`Bglii
`BspMI+
`H
`
`360
`350
`340
`330
`320
`310
`AGCTTGAAGGATGAGCCCTCTCAGTCTGCGAATCTGCTAGCGGATGCCAAGAAACTGAAC
`S L K D E P S Q S A N L
`L A
`0 A K K
`L
`·N
`indiii
`Nhei
`
`380
`370
`GATGCGCAGGCACCGAAATCGGATCC
`D A Q A P K S D P
`Fspi
`BamBI
`
`F \ ~. ~~
`
`PFIZER EX. 1502
`Page 3006
`
`
`
`W088J09344
`
`PCrjUS88/01737
`
`(BABS)-
`
`~'-1(31
`
`70
`60
`50
`40
`30
`20
`10
`GGATCCGGTAACTCTGACTCTGAATGCCCGCTGAGCCACGACGCGTACTGCCTGCACGACGGTGTTTGCATGTAC
`G S G H S D S E C P L S B D G Y C L B D G V C M Y
`BaJilHI
`Bsmi+
`· Espi
`
`•
`
`~
`
`145
`135
`125
`115
`105
`95
`85
`ATCGAAGCTCTGGACAAATACGCATGCAACTGCGTTGTAGGCTACATCGGTGAGCGCTGCCAGTATCGCGATCTG
`I G E R C Q Y R D L
`I E A L D K Y A C H C V V G Y
`Sphi
`Hrui
`
`170
`160
`AAATGGTGGGAGCTGCGTTAACTGCAG
`K W W E L R *
`HpaX Psti
`
`F'l6a. ISA
`
`I)
`
`PFIZER EX. 1502
`Page 3007
`
`
`
`W088/09344
`
`PCf{US88J01737
`
`(BABS)-
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTGGCGACCCGTCCAAGGACTCCAAAGCTCAGGTTTCTGCTGCCGAAGCTaGT
`G S G G D P S K D S K A Q V S A A E A G
`BamHI
`
`120
`110
`100
`90 .,.,
`80
`70
`ATCACTGGCACCTGGTATAACCAACTGGaGTCGAC'l"l"l'CATTGTGACCGCTGGTGCGGAC
`I T G T W Y N Q L ~ S T F
`I V T A G A D
`Sal I
`
`180
`170
`160
`150
`140
`130
`GGAGCTCTGACTGGCACCTACGAATCTGCGGTTGGTAACGCAGAATCCCGCTACGTACTG
`G A L T G T Y E S A V G N A E S R Y V L
`Saci
`·
`SnaBI
`
`240
`230
`220
`210
`200
`190
`ACTGGCCGTTATGACTCTGCACCTGCCACCGATCGCTCTGGTACCGCTCTGGGCTGGACT
`T G R Y D S A P A T D G S G T A L G W T
`BspMI+
`Kpni
`
`300
`290
`280
`270
`260
`250
`GTGGCTTGGAAAAACAACTATCGTAATGCGCACAGCGCCACTACGTGGTCTGGCCAATAC
`V A W K N N Y R N A H S A T T W S G Q Y
`Fspi
`Draiii
`Bali
`BstXI.
`PflMI
`
`360
`350
`340
`330
`320
`310
`GTTGGCGGTGCTGAGGCTCGTATCAACACTCAGTGGCTGTTAACATCCGGCACTACCGAA
`I N T Q W L L T S G T T E
`V G G A E A R
`Draiii
`Hpai
`
`420
`410
`400
`390
`380
`370
`. GCGAATGCATGGAAATCGACACTAGTAGGTCATGACACCTTTACCAAAGTTAAGCCTTCT
`A N A W K S T L V G H D T F T K V K P S
`Bsmi+
`Spei
`Nsii
`
`480
`470
`460
`450
`440
`430
`GCTGCTAGCATTGATGCTGCCAAGAAAGCAGGCGTAAACAACGGTAACCCTCTAGACGCT
`A AS I D A A K K A G V N.N G N P L D A
`Nhei
`BstEII Xbai
`
`500
`490
`GTTCAGCAATAACTGCAG
`v Q Q *
`
`Psti
`
`FlC:n. \SB.
`
`PFIZER EX. 1502
`Page 3008
`
`
`
`WOSS/09344
`
`(BABS)-
`
`PCf/USSS/01737
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTGTACGTAGCTCCTCTCGCACTCCGTCCGATAAGCCGGTTGCTCATGTAGTT
`G S G V R S S S R T P S D K P V A H V V
`BamHI
`snaBX
`
`120
`110
`100
`90
`80
`70
`GCTAACCCTCAGGCAGAAGGTCAGCTTCAGTGGCTGAACCGTCGCGCTAACGCCCTGCTG
`A N P Q A E G Q L Q W L N R R A N A L L
`Mstii
`Bqli
`
`180
`170
`160
`150
`140
`130
`GCAAACGGCGTTGAGCTCCGTGATAACCAGCTCGTGGTACCTTCTGAAGGTCTGTACCTG
`A N G V E L R D N Q L V ·V P S E G L Y L
`Saci
`Pf1MI
`Kpni
`
`240
`220
`210
`200
`190
`2~0
`ATCTATTCTCAAGTACTGTTCAAGGGTCAGGGCTGCCCGTCGACTCATGTTCTGCTGACT
`I Y S Q V L F K G Q G C P S T H V L L T
`Seal
`Sali
`
`300
`290
`280
`270
`260
`250
`CACACCATCAGCCGTATTGCTGTATCTTACCAGACCAAAGTTAACCTGCTGAGCGCTATC
`H T
`I S R
`I A V S Y Q T K V N L L S A
`I
`HpaiBspMI+ Eco47III
`Espi
`
`360
`350
`340
`330
`320
`310
`AAGTCTCCGTGCCAGCGTGAAACTCCCGAGGGTGCAGAAGCGAAACCATGGTATGAACCG
`K S P C Q R E T P E G A. E A K P W Y E P
`Nco I
`
`420
`410
`400
`390
`380
`370
`ATCTACCTGGGTGGCGTATTTcAACTGGAGAAAGGTGACCGTCTGTCCGCAGAAATCAAC
`I Y L G G V F Q L E K G D R L S A E
`I N
`BstEII
`
`480
`470
`460
`450
`440
`430
`CGTCCTGACTATCTAGATTTCGCTGAATCTGGCCAGGTGTACTTCGGTATTATCGCACTG
`R P 0 Y L D F A E S G Q V Y F G
`I
`I A L
`Xbai
`Bali
`
`490
`TAACTGCAG
`* Psti
`
`Fl6t. rsc.
`
`PFIZER EX. 1502
`Page 3009
`
`
`
`W088/09344
`
`(BABS) -
`
`PCffUSSS/01737
`
`so
`60
`40
`30
`20
`10
`GGATCCGGTGCTGATCAGCTGACTGACGAGCAGATCGCTGAATTTAAAGAGGCTTTCTCT
`G S G A D Q L T D E Q
`I A E P K E A F S
`BamHI
`BcliPvUII
`oral
`
`120
`110
`100
`90
`80
`70
`CTGTTTGACAAAGACGGTGACGGTACCATCACTACCAAAGAGCTCGGCACCGTTATGCGC
`L F D K D G D G T
`I T T K E L G T V M R
`Fspi
`Kpni
`Saci
`
`180
`170
`160
`150
`140
`130
`AGCCTTGGCCAGAACCCGACTGAAGCTGAATTGCAGGACATGATCAACGAAGTCGACGCT
`S L G Q N P T E A E L Q D M I N E V D A
`Bali
`Bcli
`Sali
`
`240
`230
`220
`210
`200
`190
`GACGGTAACGGCACCATCGATTTTCCGGAATTTCTGAACCTGATGGCGCGCAAGATGAAA
`0 G N G T
`I
`0 F P E F L N L M A R K M K
`Clai
`BspMII
`BssHII
`
`300
`290
`280
`270
`260
`250
`GACACTGACTCTGAAGAGGAACTGAAAGAGGCCTTCCGTGTTTTCGACAAAGACGGTAAC
`0 T D S E E E L K E A F R V F 0 K D G N
`stui
`
`360
`350
`340
`330
`320
`310
`GGTTTCATCTCGGCCGCTGAACTGCGTCACGTTATGACTAACCTGGGTGAAAAGCTTACT
`G F
`I S A A E L R H V M T N L G E K L T
`Eaqi
`Hindiii
`
`420
`410
`400
`390
`380
`370
`GACGAAGAAGTTGACGAAATGATTCGCGAAGCTGACGTCGATGGTGACGGCCAGGTTAAC
`0 E E V 0 E M I R E A 0 V D G D G Q V N
`Xmni
`Nrui
`Aatii
`~pai
`
`450
`440
`430
`TACGAAGAGTTCGTTCAGGTTATGATGGCTAAGTAACTGCAG
`Y E E F V Q V M M A K *
`
`Psti
`
`FICn. lSD
`
`•
`
`PFIZER EX. 1502
`Page 3010
`
`
`
`W088/09344
`
`(BABS)-
`
`...........
`PCffUS88f01737
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTGGAGGCTCTCTGGGCTCTCTGACTATTGCCGAACCGGCAATGATTGCTGAA
`G S G G G S L G S L T
`I A E P A M
`I A E
`BamBI
`Bqll
`Bsm
`
`6
`
`120
`110
`100
`90
`80
`70
`TGCAAGACTCGTACCGAAGTCTTCGAGATCTCTCGTCGTCTGATCGATCGCACTAATGCC
`CKTRTE VF E IS RRL I DRTNA
`Bqlii
`Clai
`I+
`Bs
`PvUI
`
`180
`170
`160
`150
`140
`130
`AACTTCCTGGTATGGCCGCCGTGCGTCGAGGTACAACGCTGCTCCGGGTGTTGCAACAAT
`N F L V W P P c V E V Q R c S G C C N N
`tXI
`
`240
`230
`220
`210
`200
`190
`CGTAACGTTCAATGTCGACCGACTCAAGTCCAGCTGCGTCCGGTCCAAGTCCGCAAAATC
`R N V Q c R P T Q V Q L R P V Q V R K
`I
`Sali
`Pvuii
`
`300
`290
`280
`270
`260
`250
`GAGATTGTACGTAAGAAACCGATCTTTAAGAAGGCCACTGTTACTCTGGAAGACCATCTG
`E
`I V R K K P
`I F K K A T V T L E D H L
`SnaBI
`
`350
`340
`330
`320
`310
`GCATGCAAATGTGAGACTGTAGCGGCCGCACGTCCAGTTACTTAACTGCAG
`A C K c E T V A A A R P V T *
`Sphi
`Eaqi
`Noti
`
`Psti
`Fl"'· ISE-
`
`•
`
`~ .
`
`PFIZER EX. 1502
`Page 3011
`
`
`
`W088/09344
`
`· PCI'/US88/0~737
`
`(BASS)-
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTATATTCCCCAAACAATACCCAATTATAAACTTTACCACAGCGGGTGCCACT
`G S G
`I F P K Q Y P
`I
`I N F T T A G A T
`BamBI
`
`120
`110
`100
`90
`80
`70
`GTGCAAAGCTACACAAACTTTATCAGAGCTGTTCGCGGTCGTTTAACAACTGGAGCTGAT
`V Q S Y TN F IR A V.R G R L T T GAD
`
`180
`170
`160
`150
`140
`130
`GTGAGACATGAAATACCAGTGTTGCCAAACAGAGTTGGTTTGCCTATAAACCAACGGTTT
`V R H E
`P V L P N R V G L P
`I N Q R F
`I
`
`240
`230
`220
`210
`200
`190
`ATTTTAGTTGAACTCTCAAATCATGCAGAGCTTTCTGTTACATTAGCGCTGGATGTCACC
`I L V E L S N H A E L S V T L A L D V T
`Eco47III
`
`300
`290
`280
`270
`260
`250
`AATGCATATGTGGTCGGCTACCGTGCTGGAAATAGCGCATATTTCTTTCATCCTGACAAT
`N A Y V V G Y R A G N S A Y F F H P D N
`Ndei
`Nsii
`
`360
`350
`340
`330
`320
`310
`CAGGAAGATGCAGAAGCAATCACTCATCTTTTCACTGATGTTCAAAATCGATATACATTC
`Q E D A E A
`I T H L F T D V Q N R Y T F
`Clai
`
`420
`410
`400
`390
`380
`370
`GCCTTTGGTGGTAATTATGATAGACTTGAACAACTTGCTGGTAATCTGAGAGAAAATATC
`A F G G N Y D R L E Q L A G N L R E N
`I
`
`480
`470
`.460
`450
`·440
`430
`GAGTTGGGAAATGGTCCACTAGAGGAGGCTATCTCAGCGCTTTATTATTACAGTACTGGT
`E L G N G P L E E A
`I S A L Y Y Y S T G
`Eco47III
`Scai
`
`540
`530
`520
`510
`500
`490
`GGCACTCAGCTTCCAACTCTGGCTCGTTCCTTTATAATTTGCATCCAAATGATTTCAGAA
`G T Q L P T L A R S F
`I
`I C
`I Q M I S E
`
`6.00
`590
`580
`570
`560
`550
`GCAGCAAGATTCCAATATATTGAGGGAGAAATGCGCACGAGAATTAGGTACAACCGGAGA
`A A R F Q Y I E G E M R T R
`I R Y N R R
`Fspi
`Bql
`
`•
`
`~
`
`PFIZER EX. 1502
`Page 3012
`
`
`
`W088/09344
`
`(BABS)-
`
`PCf/US88/01737
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTGCTCCGACTTCTAGCTCTACTAAGAAAACTCAGCTTCAGCTGGAACACCTG
`G S G A P T S S S T K K T Q L Q L E H L
`BamHI
`PvUII
`
`120
`110
`100
`90
`80
`70
`CTGCTGGACCTTCAGATGATCCTGAACGGTATCAACAACTACAAGAACCCGAAACTGACT
`L L D L Q M
`I L N G
`I N N Y K N P K L T
`
`180
`170
`160
`150
`140
`130
`CGTATGCTGACTTTCAAATTCTACATGCCGAAGAAAGCTACCGAACTGAAACACCTTCAG
`R M L T F K F Y M P K K A T E L K H L Q
`
`Z40
`230
`220
`210
`.
`200
`190
`·TGCCTGGAAGAAGAACTGAAGCCGCTGGAGGAAGTACTGAACCTGGCTCAGTCTAAAAAC
`C L E E E L K P L E E V L N L A Q S K N
`scai
`
`ioo
`290
`2so
`270
`260
`250
`TTCCACCTGCGTCCGCGTGACCTGATCAGCAACATCAACGTAATCGTTCTAGAACTTAAA.
`F H L R P R 0 L
`I S N
`I N V
`I V L E L K
`Bcli
`Xbai
`
`360
`350
`340
`330
`320
`310
`GGCTCTGAAACTACCTTCATGTGCGAATACGCTGACGAAACTGCTACCATCGTAGAATTT
`G SET T FMC E·Y A 0 ETA T IV E F
`
`420
`410
`400
`390
`380
`370
`CTGAACCGTTGGATCACCTTCTGCCAGTCTATCATCTCTACTCTGACTTAACTGCAG
`I S T L T *
`L N R W I T F ·c Q S
`I
`
`Psti
`
`PICn. ISU.
`
`PFIZER EX. 1502
`Page 3013
`
`
`
`W088/09344
`
`(BABS) ~.
`
`PCf{US88/01737
`
`60
`50
`40
`30
`20
`10
`GGATCCGGTGCTGACAACAAATTCAACAAGGAACAGCAGAACGCGTTCTACGAGATCTTG
`G S G A 0 N K F N K E Q Q N A F Y E
`I L
`BamBI
`Mlui
`Bqlii
`Xmni
`
`120
`110
`100
`90
`80
`70
`CACCTGCCGAACCTGAACGAAGAGCAGCGTAACGGCTTCATCCAAAGCTTGAAGGATGAG
`H L P N L N E E Q R N G F
`I Q S L K 0 E.
`BspMI+
`Hindiii
`
`180
`170
`160
`150
`140
`130
`CCCTCTCAGTCTGCGAATCTGCTAGCGGATGCCAAGAAACTGAACGATGCGCAGGCACCG
`P S Q S A N L L A D A K K L N D A Q A ~
`Nhei
`Fspi
`
`240
`230
`220
`210
`200
`190
`AAATCGGATCAGGGGCAATTCATGGCTGACAACAAATTCAACAAGGAACAGCAGAACGCG
`K S D Q ~ Q F M A D N K F N K E Q Q N ~
`Mlui
`Xmni
`
`300
`290
`280
`270
`260
`250
`TTCTACGAGATCTTGCACCTGCCGAACCTGAACGAAGAGCAGCGTAACGGCTTCATCCAA
`F Y E
`I L H L P N L N E E Q R N G F
`I Q
`Bqlii
`BspMI+
`H
`
`360
`350
`340
`330
`320
`310
`AGCTTGAAGGATGAGCCCTCTCAGTCTGCGAATCTGCTAGCGGATGCCAAGAAACTGAAC
`S L K D E P S Q S A N L L A D A K K L N
`lnaiii
`Nhei
`Fl61.
`
`t5H
`
`380
`370
`GATGCGCAGGCACCGAAATAACTGCAG
`0 A Q A P K *
`Fspi
`
`Psti
`
`l ...
`
`PFIZER EX. 1502
`Page 3014
`
`
`
`
`
`PCT/OSI:SS/01737
`
`E
`
`r
`
`Attachment to PCT/ISA/210
`II. Field Searched·
`
`Keywords continued
`
`immunoglobulin, specificity, variable, region, domain,
`chimeric, heavy, light, Fv, ant~body, antibodies,
`cancer, tumor, treatment.
`
`PFIZER EX. 1502
`Page 3016
`
`
`
`
`
`
`
`
`
`FOR THE PURPOSES OF INFORMATION ONLY
`
`Codes used to identity States party to the PCI' on the front pages of pamphlets publishing international
`applications under the PCT.
`
`AT
`Allltria
`AU
`A~~~tralia
`88
`Barbados
`BE
`Belgium
`BP
`Burkina Faso
`BC
`Bulpria
`8.1
`Bonia
`BR
`Brazil
`Canada
`CA
`Cenlral African Repubru:
`CF
`cc
`Congo
`CH
`Switrcrland
`C6le d'lvoirc
`Cl
`CM ea~
`DE
`Germany
`DK
`Denmark
`£S
`Spain
`
`Fl
`FR
`CA
`CB
`CN
`CR
`HU
`rr
`JP
`KP
`
`KR
`Ll
`LK
`LU
`MC
`MC
`
`Finland
`France
`Gabon
`United Kin(ldom
`Guinea
`Greece
`Hungary
`Italy
`Japan
`Ocmoc:ratic Peoplo.:'s Rupublic
`or Kore:a
`Republic or Korea
`Ucc:hb:nStl:in
`Sri Lanka
`IAJxcmbourg
`Monao:o
`MadagaKar
`
`ML
`MN
`MR
`MW
`NL
`NO
`PL
`RO
`SD
`S8
`SN
`su
`TO
`TG
`us
`
`Mall
`Mongolia
`Mauritania
`Malawi
`Nctlu:rlands
`Norway
`Poland
`Romania
`Sudan
`Swc:den
`Senegal
`Soviet Union
`Cbad
`Togo
`United States of America
`
`PFIZER EX. 1502
`Page 3020
`
`
`
`wo 91/07500.
`
`. PCf /GB90/017SS
`
`5
`
`10
`
`15
`
`20
`
`-
`
`1 -
`
`SPECIFIC BINDING AGENTS
`
`This invention relates to specific.binding agents,
`and in particular to polyPeptides containing·amino acid
`sequences that bind specifically to other proteinaceous or
`non-proteinaceous materials. The invention most
`particularly concerns the production of suchspecific
`binding agents by genetic engineering.
`
`Antibody structure
`
`Natural antibody molecules consist of two identical
`heavy-chain and two identical light-~hain polypeptides,
`25 which are covalently linked by disuiphide bonds. Figure
`13 of the accompanying drawings diagramaticallyrepresents
`the typical structure of an antibody of the IgG class.
`Each o~ the chains is folded into severai discrete
`domains. The N-terminal domains of all.the chains are
`variable in sequence and therefore called the variable
`. . .
`.
`. .
`. .
`regions (V-regions) • The v-regions ·of one heavy (VH) and .
`one light chain (VL) associate to form the antigen-binding
`site. The module formed by the combined VH and VL domains
`is referred to as the Fv (variable fragment) of the'
`
`30
`
`35
`
`..
`
`SUBSTITUTE SHEET
`
`PFIZER EX. 1502
`Page 3021
`
`
`
`W091107500
`
`PCf/GB90/01755
`
`- 2 -
`
`antibody. The c-terminal ends of both heavy and light
`chains are more conserved in sequence and chains are more
`conserved in sequence and therefore referred to as the
`constant regions. Heavy chain constant regions are
`composed of several domains, eg. the heavy chain of the
`gamma-isotype (IgG) consists of three domains (CH1, CH2,
`CHJ) and a hinge region which connects the CH1 and CH2
`domains. The hinges of the two heavy chains are
`covalently linked together by disulphide bridges. Light
`chains have one constant domain which packs against the
`~~1 domain. The constant regions of the antibody molecule
`are involved in effector functions such as complement
`lysis and clearing by Antibody Dependant Cell Cytotoxicity
`(ADCC). Classical digestion of an antibody with the
`protease papain yields three fragments. One fragment
`contains the CH2 and CHJ domains and, as it crystallises
`easily, was called the Fe fragment. The other two
`fragments were designated the Fab (antigen-binding)
`fragments, they are.identical and contain the entire light
`chain combined with the VH and CH1 domain. When using
`pepsin, the proteolytic cleavage is such that the two Fabs
`remain connected via the hinge and form the (Fab) 2
`fragment. Each of the domains is represented by a
`separate exon at the genetic level.
`
`The variable regions themselves each contain 3
`clusters of hypervariable residues, in a framework·of more
`conserved sequences. These hypervariable regions interact
`with the antigen, and are called the Complementarity
`Determining Regions (CDRs). The more conserved sequences
`are called the Framework Regions (FRs). See Kabat et al
`(1987). x-ray studies of antibodies have shown that the
`CDRs form loops which protrude from the top of the
`molecule, whilst the FRs provide a structural beta-sheet
`framework.
`
`SUBSTITUTE SHEET
`
`5
`
`10
`
`15
`
`20
`
`25
`
`.
`
`30
`
`35
`
`PFIZER EX. 1502
`Page 3022
`
`
`
`W09l/07500
`
`PCf/GB90/01755
`
`-
`
`3 -
`
`Modified antibodies
`
`In one embodiment, the invention relates to so-called
`"reshaped" or "altered" human antipodies,. ie.
`immunoglobulins having essentially human constant and
`framework regions but in which the complementarity
`determining regions (CDRs) correspond to those found in a
`non-human immunoglobulin, and also to corresponding
`reshaped antibody fragments.
`
`The general principles by which such reshaped·human
`antibodies and fragments may be produced are now
`well-known, and referen~e can be made to Jories et al
`(1986), Riechmann et al (1988}, Verhoeyen et al· (1988),
`and EP-A-239400 (Winter). A comprehensive list of
`relevant l·iterature references is provided later· in this
`specification.
`
`Reshaped human antibodies and fragm¢n~s·bave·
`particular utility in the in-vivo diagnosis and treatment
`of human ailments because the essentially human. proteins
`are less likely to induce undesirable adversereactions
`when they are administered to a hriman patient, and
`the desired specificity conferred by the CDRs can be
`raised in a host animal, such as a: 'mouse, frbm which
`antibodies of selected specificity can be obtained more
`readily. The variable region genes can be cloned from the
`non-human antibody, and the CDRs grafted into a human
`variable-region framework by genetic engineering
`techniques to provide the reshaped human antibody or
`fragment. To achieve this desirable result, it is
`necessary to identify and sequence at least. the CDRs.in
`the selected non-human antibody, and preferably the whole
`non-human variable region sequence, to allow
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUBSmUTE SHEET
`
`PFIZER EX. 1502
`Page 3023
`
`
`
`W091/07500
`
`PCf/GB90/0175S
`
`- 4 -
`
`identification of potentially important CDR-framework
`interactions.
`
`Summary of the invention
`
`The invention provides, as one embodiment, a
`synthetic specific binding polypeptide having specificity
`for human placental alkaline phosphatase (PLAP). By
`synthetic, we particularly mean that the polypeptide is
`produced by recombinant DNA technology, and to that extent
`at least is different from a naturally-occurring or
`naturally-induced specific binding agent having identical
`specificity. Alternatively, the synthetic polypeptide has
`been produced by artificially assembling a sequence of
`amino acids to produce a novel or nature-identical
`molecule. The synthetic polypeptide can be equivalent to
`an intact conventional antibody, or equivalent to a
`multiple or single-chain fragment of such an antibody, or
`can be simply a material that includes one or more
`sequences that confer the desired specific binding
`capability.
`
`The invention provides as an important embodiment, a
`reshaped human antibody, or a reshaped human antibody
`fragment, having anti-human placental alkaline phosphatase
`(PLAP) specificity.
`
`More particularly, the invention provides a reshaped
`human antibody or reshaped human antibody fragment, having
`anti-human placental alkaline phosphatase specificity,
`containing one or more of the CDRs depicted in Figures 1
`and 2 of the accompanying drawings. Preferably, the
`reshaped antibody or fragment of the invention contains
`all 3 of the CDRs depicted in Figure 1 of the accompanying
`drawings, in a human heavy chain variable region
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUBSTITUTE SHEET
`
`PFIZER EX. 1502
`Page 3024
`
`
`
`W091/07SOO
`
`PCf/GB90/017SS
`
`- 5 -
`
`framework. Alternatively, or in addition, the reshaped
`antibody or fragment of the invention contains all 3 of
`the CDRs depicted in Figure 2 of the accompanying
`drawings, in a human light chain variable region
`framework.
`
`.
`
`.
`Another embodiment of the invention is a reshaped
`.
`antibody or reshaped antibody fragment . contidning a
`.
`protein sequence as depicted in Fic]ure 10 and/or Figure 11
`of the accompanying drawings.
`
`.
`
`Other important embodiments of the iiwention are an
`expression vector incorporating a DNA sequence~s depicted
`in Figure 10 and/ or Figure 1i of the_. accompanying
`drawings, and an expression vector_incorpora:ting·a DNA
`sequence encoding one or more of the. protein sequences
`designated as being a CDR in Figure· 1 and/ or. ·F'igure. 2 of·
`the accompanying drawings.
`
`"'
`An important aspect of the invention is a stable host
`cell line containing a foreign gene that causes thehost
`cell line to produce a specific binding agent according to(cid:173)
`the invention. This can be a stable hostcell<line
`containing a foreign gene that encodes at least one of the
`amino acid sequences designated ·as being a CDR ·in Figure· 1
`an~jor Figure 2 of the accompanyingdrawings, .together
`with a protein framework that enables the encoded amino
`acid sequence when expressed to function as a·coR having
`specificity for PLAP.
`
`The invention particularly provides an. immortalised
`mammalian cell line, or a yeast, or other e\J.karyotic cell,· .
`or a prokaryotic-cell such as a bacterium, producing a
`reshaped antibody or fragmentaccording to the invention.
`
`SUBSTITUTE SHEET
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`PFIZER EX. 1502
`Page 3025
`
`
`
`W091107SOO
`
`PCf/GB90/017SS
`
`- 6 -
`
`Another important aspect of the invention is a
`synthetic specific binding agent, reshaped human antibody
`or reshaped human antibody fragment, having specificity
`equivalent to that of the gamma-1, kappa anti-PLAP
`monoclonal antibody secreted by murine hybridoma cell line
`H17E2.
`
`The invention also provides two novel plasmids,
`pSVgptHu2VHPLAP-HuigG1 and pSVneoHuVkPLAP-HuCk, and these
`plasmids can be used in the production of a synthetic
`specific binding agent, reshaped human antibody or
`reshaped human antibody fragment.
`
`These plasmids are contained in novel E.coli strains
`NCTC 12389 and NCTC 12390, respectively.
`
`Other aspects of the invention are:
`
`a)
`
`b)
`
`c)
`
`A DNA sequence encoding a reshaped human antibody
`heavy-chain variable region having specificity for
`human placental alkaline phosphatase, as contained in
`E.coli NCTC 12389 •.
`
`A DNA sequence encoding a reshaped human antibody
`light-chain variable region having specificity for
`human placental alkaline phosphatase, as contained in
`E.coli NCTC 12390.
`
`A reshaped human antibody heavy-chain variable region
`having specificity for human placental alkaline
`phosphatase, producible by means of the expression
`vector contained in E.coli NCTC 12389.
`
`d)
`
`A reshaped human antibody light-chain variable region
`having specificity for human placental alkaline
`
`5
`
`io
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUBSTITUTE SHEET
`
`PFIZER EX. 1502
`Page 3026
`
`
`
`W091107500
`
`PCf/GB90/01755
`
`- 7 -
`
`phosphatase, producible by means of the expression
`vector contained in E.coli NCTC 12390.
`
`e)
`
`5
`
`A reshaped human antibody or reshaped human antibody
`fragment, comprising at least one variable region
`according to c) or d) above.
`
`A particular embodiment of the invention is therefore
`a reshaped human antibody or fragment possessing anti-PLAP
`specificity and incorporating a combination :of.CDRs (which
`may, for example, be cloned from a murine .ariti~PLAP
`immunoglobulin) having the amino acid sequences identified
`as CDR1, CDR2 and CDR3 respectively in Figures 1. and 2 of
`the accompanying drawings, which respectively represent
`the heavy chain variable region (VH) and light chain
`variable region (Vk) of a m~ine ~nti-PLAP monoclonal
`antibody that we have cloned and sequenced.
`In the case
`of an intact antibody, or a fragment comprising at least
`one heavy chain variable region .and at least one light
`chain variable region, the reshaped antibodyor fragment
`.
`.
`preferably contains all six CDRs from the non-human
`source. To be most effective in binding, the CDRs should
`preferably be sited relative to one another in the same
`arrangement as occurs in the o+iginal non-human antibody,
`e.g. the VH CDRs should be in a human VH f.ramework, .and in
`the order in which they occur naturally iri the ~~n~human
`antibody.
`
`As will be apparent to those skilled .in the art, the
`CDR sequences and the surrounding framework sequences can
`be subject to minor modifications and variations without
`the essential specific binding capability being
`significantly reduced.
`such minor modifications and
`variations can be present either at the genetic level· or
`in the amino acid sequence, or both. Accordingly, the·
`
`10
`
`~5
`
`20
`
`25
`
`30
`
`35
`
`SUBSTITUTE ::iHEET .
`
`PFIZER EX. 1502
`Page 3027
`
`
`
`W091107500
`
`PCT/GB90/01755
`
`- 8 -
`
`invention encompasses synthetic (reshaped) antibodies and
`fragments that are functionally equivalent to those
`described herein having precisely defined genetic or amino
`acid sequences.
`
`The invention can also be applied in the production
`of hi-specific antibodies, having two Fab portions of
`different specificity, wherein one of the specificities is
`conferred by a reshaped human variable chain region
`incorporating one or more of the CDRs depicted in Figures
`1 and 2 of the accompanying drawings.
`
`The invention can also be applied in the production
`of so-called single-chain antibodies (for example, as
`disclosed in Genex EP-A-281604), and also to
`polysaccharide-linked antibodies (see Hybritech
`EP-A-315456) and other modified antibodies.
`
`Any human constant regions (for example, gamma 1, 2,
`3 or 4-type) can be used.
`
`Antibody fragments retaining useful specific binding
`properties can be (Fab) 2 , Fab, Fv, VH or Vk fragments.
`These can be derived from an intact reshaped antibody, for
`example by protease digestion, ~r produced as such by
`genetic engineering.
`
`Practical applications of the invention
`
`An important aspect of the invention is a reshaped
`human anti-PLAP antibody or fragment, as defined above
`linked to or incorporating an agent capable of retarding
`or terminating the growth of cancerous cells, or to an
`imaging agent capable of being detected while inside the
`human body. The invention also includes injectable
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUBSTITUTE SHEET
`
`PFIZER EX. 1502
`Page 3028
`
`
`
`W091/07500
`
`Pcf/GB90/01755
`
`- 9 -
`
`compositions comprising either of such combinations in a
`pharmaceutically acceptable carrier, such as saline
`solution, plasma extender or liposomes. The invention
`also includes the use, in a method of human_ cancer therapy
`or imaging, of a reshaped human anti-PLAP antibody or
`fragment as defined above. The invention further includes
`the use of such an antibody or fragment for the ·
`manufacture of a medicament for therapeutic application in
`the relief of cancer in humans, or the .use .of such an
`antibody or fragment in the manufacture of a diagnostic
`composition for in-vivo diagnostic application in humans.
`
`The Fe region of the antibody, itself using pathways
`and mechanisms available in the body, such as complement
`lysis and antibody-dependent cellular cytotoxicity, can be
`used to affect adversely the qrowth of cancerous cells.
`In this embodiment, no additional reagent needbe linked
`to the reshaped antibody.
`
`Examples of agents capable of affecting adversely the
`qrowth of cancerous cells include radioisotopes, such as_
`Yttrium 90 and Iodine 131; drugs such as methotrexate;
`toxins such as ricin or parts thereof; and enzymes which
`may for example turn an inactive drug into an· active drug_
`at the site of antibody binding.
`
`Examples of imaging agents include radioisotopes
`generating gamma rays, such·· as Indium 111 and Technetium
`99; radioisotopes generating positrons, such as Copper 64;
`and passive agents such as Barium which act as contrast
`agents for X-rays, and Gadolinium in nmrfesr scanning.
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`In order to link a metallic agent, such· as a
`radioisotope, to a specific binding agent of the
`invention, it may be necessary to employ a coupling or
`
`35
`
`SUBSTITUTE SHEET ·
`
`PFIZER EX. 1502
`Page 3029
`
`
`
`W091/07SOO
`
`PCf/GB90/017SS
`
`- 10 -
`
`chelating agent. Many suitable che1ating agents have been
`developed, and reference can be made for example to US
`4824986, us 4831175, us 4923985 and us 4622420.
`Techniques involving the use of chelating agents are
`described, for example, in US 4454106, us 4722892, Moi et
`al (1988), McCall et al (1990), Deshpande et al (1990) and
`·Meares et al (i990).
`
`The use of radiolabelled antibodies and fragments in
`cancer imaging and therapy in humans is described for
`example in EP 35265. It may be advantageous to use the
`radiolabelled cancer-specific antibody or fragment in
`conjunction with a non-specific.agent radiolabelled with a
`different isotope, to provide a contrasting background for
`so-called subtraction imaging.
`
`The antibody reagents of the invention can be used to
`identify, e.g. by serum testing or imaging, and/or to
`treat, PLAP-producing cancers. Such cancers can occur as,
`for example, breast cancer, ovarian cancer and colon
`cancer, or can manifest themselves as liquids such as
`pleural effusions.
`
`Modified antibody production
`
`The portions of the VH and VL regions that by
`convention (Kabat, 1987) are designated as being the CDRs
`may not be the sole features that need to be transferred
`from the non-human monoclonal antibody. Sometimes,
`enhanced antibody performance, in terms of specificity
`and/or affinity, can be obtained in the reshaped human
`antibody if certain non-human framework sequences are
`conserved in the reshaped human antibody. The objective
`is to conserve the important three-dimensional protein
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`SUBSTITUTE SHEET
`
`PFIZER EX. 1502
`Page 3030
`
`
`
`W091107500
`
`PcT/GB90/017SS .
`
`- 11 -
`
`structure associated with the CDRs, which is supported by
`contacts with framework residues~
`
`The normal starting point from which a reshaped
`antibody in accordance with the invention can be p~Ppared,
`is a cell (preferably an immortalised cell line), derived
`from a non-human host animal (for example, a mouse), which
`expresses an antibody having specificity against-human
`PLAP.
`such a cell line can, for example, be:a hybridoma
`cell line prepared by conventional monoclonal· antibody .
`technology. Preferably, the expressed antibody has a high
`affinity and high specificity for PLAP,_ because it should
`be anticipated that some loss of affinity andjor
`specificity may occur during the trans.fer_of these·
`. . '
`.
`properties to a human antibody or fragment by the
`procedures of the invention. By selectinga high affinity
`and high specificity antibody as the parent antibody, the
`likelihood that the final reshaped antibody _or fragment
`will also exhibit effective binding propertiesis.
`enhanced.
`
`..
`
`The next stage is the cloning of the eDNA from the
`cell expressing the selected non-humanantibody, and
`.
`. .
`sequencing and identification of thevariable region genes
`including the sequences encoding the CDRs~. The_procedures
`involved can now be regarded as routine in the art,
`although they are still laborious~
`
`If the object is to produce a reshaped c