`
`FIG. 7 ( contd.)
`T F P . A V L. Q S S G L Y S L S S V V . T V
`170
`600 ACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTG
`
`en c:
`
`I
`I
`
`P S S S L _G T Q T Y I C N V N H K P S· N
`190
`660 - CCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAAC
`
`T K V D K K V E P K S . C D K T H T C P P
`210
`720 ACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCG
`
`230
`C P A P E L L G G P S V F . -1 F P P K. P K
`780 TGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAG
`
`250
`S R T P E V T C V V V D V S H
`I
`D T L M
`840 GACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCAC
`
`269
`. 899
`
`189
`659
`
`209
`719
`
`229
`779
`
`249
`839
`
`N ...... -UJ
`
`UJ
`
`I I
`
`~
`0
`\0
`N .....
`:1: N ......
`
`A
`
`"'= 8 C'l = \0 -..... = -lll
`
`......
`QO
`
`PFIZER EX. 1502
`Page 1501
`
`
`
`•
`
`FIG . 7 ( contd.)
`E D P E V K F N W Y V D G V E V H N A K
`GAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAG
`
`270
`900
`
`lD I 290
`
`rJ) c::
`
`C'D
`
`m
`
`T K P R E E Q Y N s· T Y R ·V V S V L T V
`ACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTC
`
`L H Q D W L N G K E Y K C K V S N K A L
`CTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTC
`
`960
`
`310
`1020
`
`:.$!
`0
`\C
`
`N ....... = tJI
`N ......
`A
`
`289
`959
`
`309
`1019
`
`N
`
`329 ~
`1079
`
`l.JJ
`l.JJ
`
`330
`1080
`
`I E K T I S K A K G Q P R .E P Q V
`P A P
`CCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTG
`
`350
`1140
`
`Y T L P P S R D E L T K N Q V S L T C L
`TACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTG
`
`349
`1139
`
`369
`1199
`
`"'0·
`
`g
`C') = ~
`....... = -VI
`
`......
`co
`
`PFIZER EX. 1502
`Page 1502
`
`
`
`
`
`(/J
`c
`m
`~
`c
`"'
`en
`m
`
`1
`
`14
`
`34
`
`54
`
`74
`
`94
`
`FIG.8
`Q v Q L v E s G G G v v Q
`CDR 1
`y A
`s 1 s
`CDR 2
`A I I
`I w D
`
`p G R s L R L s c s s s G F
`
`I F
`
`D]w
`
`v R Q A p G K G L E w v
`
`D G s D Q H y A D s V· K
`
`Gl
`N s K N T L F L Q M D s L R p E D T G v
`CDR 3
`y F c A Rl D G G H G F c s s A s c F G p
`
`R F T
`
`I
`
`s R D
`
`114 ~w G Q G T p v T v s s
`
`-
`
`N
`+"
`UJ
`UJ
`
`13
`
`33
`
`53
`
`73
`
`93
`
`113
`
`126
`
`< 0
`\C w
`....... = Ul
`
`N ......
`.&:..
`
`"'0 g
`
`c:') = \C -....... = -Ul
`
`.....
`
`QC
`
`PFIZER EX. 1502
`Page 1504
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`INTERNATIONAL SEARCH REPORT
`lntemallcmal Application No PCT /GB 91/01578
`I. CLASSIFICATION OF SUBJECT MATTER (if aevenl classlflcaliOll aymbols apply, Indicate all)~
`According to lntamallonal Patent Claaalficatlon (I PC) or to both National Clanllication and IPC
`IPC5: c 12 p 21/08, c 12 N 15/13, A 61 K 39/395
`
`II. FIELDS SEARCHED
`
`Claaairicallan Syalem
`
`Minimum Documentation Sean:hed7
`Classification Symbols
`
`IPC5
`
`c 12 P; c 12 N; A 61 K
`
`Documentation Searched ather than Minimum Documentation
`to the Extent that such Documents are Included in Fields Saarchedl
`
`Ill. DOCUMENTS CONSIDERED TO BE RELEVANT I
`Calllgory •
`Citation of Dacument,11 with Indication, where appropriate, or Jhe re1-nt paaaages 12
`X
`
`wo, Al, 9007861 (PROTEIN DESIGN LABS, INC.)
`26 July 1990, see page 5; page 10,
`line 25 - page 14; page 28 - page 30
`
`y
`
`X
`
`y
`
`y
`
`--
`Proc. Natl. Acad. Sci., vol. 86, December 1989,
`Cary Queen et al.: 11A humanized antibody that
`binds to the interleukin 2 receptor u
`'
`see pages 10029-10033, page 10031 right
`column-page 10033
`
`--
`Nature, vol. 341, October 1989, E. Sally Ward et
`al.: "Binding activities of a repertoire of
`single immunoglobulin variable domains secreted
`from Escherichia coli II see page 544 -
`'
`page 546
`--
`
`Relevant to Claim No.13
`1-5
`
`1-9
`
`1-5
`
`1-9
`
`1-9
`
`• Special categories of ciled documents: 1o
`•A• =~r:::~ddf!lcl,"8,'l:..ft~f~1,!f:~:~~heart which Is nat
`•E• ~artier document but published an or aner the International
`ltlang date
`·L· ~~gl:'r:~r:~JC::. ':.':la~n~tg~u:J:,r~B~:~:Xac~1~J:b.~~
`citation or other special reason (as specified)
`•o• document referring to an oral disclosure, use, exhibition or
`other means
`•p• fa~~~rr::~ r::~~~~tf~~ret~.~~:;,:::stemational filing dale bul
`IV. CERTIFICATION
`Date of the Actual Complellon of the lnternallonal Search
`16th December 1991
`
`lnlernational Searching Authority
`EUROPEAN PATENT OFFICE
`
`arm""' m>a/210 tsecond sneelJ (~anuary 1SB5)
`
`.,.. ~'l-'fri:~r.Y'll:r: ~~~'ii'a~~ ~~~r.t~e~n~~·~c:,~,IJ!l!gx t~\e
`
`~llli!d lp understand the principle or theory undertying lhe
`anventaon
`·x· ~~gm•Ct: :;~rsrJ~~~~~~~,v:r~:nm,r ~~~:~U~:~:n
`involve an anventive slap
`'"f• doctJment ol particular rt~levance. the claimed Invention
`cannot be FDnsidered to tnvolve an Inventive step when the
`~oi:t':,":~~g =:t!~:~i;:1Ce?~: :'.:l'a~'i ~~·~·~e~~~ :~~~d
`in the art.
`•a• document member of the same patent family
`
`Date.of Mailing of this lnlemational Search Report
`
`Slgnalure of Authorized~.(,/~.-~ '
`
`-
`
`.:::::;...--
`
`0!:JH 199Z'
`---~
`
`PFIZER EX. 1502
`Page 1514
`
`
`
`(CONTINUED FROM THE SECOND SHEET)
`Ill. DOCUMENTS CONSIDERED TO BE RELEVANT
`Citation of Docvmenl, with Indication. where appropriate, of the relevant passages
`Category•
`
`Relevant to Claim No
`
`International Application No. PCT /GB 91/01578
`
`y
`
`X
`
`X
`
`A
`
`A
`
`A
`
`A
`
`Nature, vol. 332, March 1988, L Riechmann et
`al.: 11Reshaping human antibodies for therapy
`, see page 323 - page 327
`11
`.page 526 right column
`
`EP, A1, 0328404 (MEDICAL RESEARCH COUNCIL)
`16 August 1989, see page 4; page 9,
`line 30; page 11, line 5
`
`EP, A2, 0365209 (BECTON DICKINSON AND COMP~)
`25 April 1990,
`see in particular col. 3, lines 27-49 and
`columns 5-8
`
`Proc.Natl.Acad.Sci., val. 87, June 1990, J
`Sharon: 0 Structural correlates of high antibody
`affinity:Three engineered amino acid
`substitutions can increase the affinity of an
`anti -p-azopheny 1 arsonate antibody 200-fo ld 11
`,
`see page 4814 - page 4817
`
`Science, vol. 239, March 1988, M Verhoeyen et
`al.: 11Reshaping Human Antibodies: Grafting an
`Antilysozyme Activity 0
`, see page 1534 -
`page 1536
`
`Nature, vol. 321, May 1986, P T Jones et
`al.: 11Replating the complementarity-determining
`regions in a humanantibody with those from a
`mouse 11
`, see page 522 - page 525
`page 525, left column
`
`Nature, vol. 328, August 1987, S. Roberts et
`al.: 11Generation of an antibody with enhanced
`affinity and specificity for its antigen by
`protein engineering 11
`, see page 731 -
`page 734
`
`1-9
`
`1-5
`
`1-5
`
`1
`
`1-9
`
`1
`
`1
`
`For• PCTIISAIZlD (axtra shaat) (January 198Sl
`
`PFIZER EX. 1502
`Page 1515
`
`
`
`fCONTINUED FROM THE SECOND SHEEn
`Ill. DOCUMENTS CONSIDERED TO BE RELEVANT
`Cllallon ol Document. with indication, Where appropriate, ollhe relevant pas .. ges
`c;alegory •
`
`Rel~t to Claim No
`
`International Application No. PCT /GB 91/01578
`
`P,X
`
`P,X
`
`P,X
`
`P,X
`
`wo, A1, 9109966 (ORTHO PHARMACEUTICAL CORPORATION)
`11 July 1991,
`see the whole document
`
`--
`wo, Al, 9107492 (CENTRAL BLOOD LABORATIORIES
`AUTHORITY) 30 May 1991,
`see page 3
`
`--
`EP, Al, 0403156.(GENZYME CORPORATION)
`19 December 1990,
`see example 12
`
`--
`wo, Al, 9109967 (CELLTECH LIMITED)
`11 July 1991,
`see the whole document
`
`1-5
`
`1
`
`1-5
`
`1-9
`
`-
`--------
`
`farm PCT.flSA/ZlO (extra sh .... U (January 1985)
`
`PFIZER EX. 1502
`Page 1516
`
`
`
`ANNEX TO THE INTERNATIONAL SEARCH REPORT
`ON INTERNATIONAL PATENT APPLICATION NO.PCT/GB 91/01578
`
`51310
`SA
`Tbls annex lists lbe patent f.lmlly mambvs relating to tile pstanl documents cll&d In tile above-mentioned international surd! report.
`31/10/91
`Tile members are as contained In the Eurapaan Pa.tant Oftica I!DP file on
`Tile Europun Patent office Is In no way liable for lheseputlculars which are men~ly given ~or lhe purpose of Information.
`
`Patent document
`dtacl In seardl report
`
`WO-A1- 9007861
`
`l Publication
`
`dale
`
`26/07/90
`
`I
`
`EP-Al- 0328404
`
`16/08/89
`
`EP-A2- 0365209
`
`WO-Al- 9109966
`
`25/04/90
`
`11/07/91
`
`.
`
`WO-Al- 9107492
`
`30/05/91
`
`----------------------------------------------------
`
`Patent f.lmlly
`member( a)
`
`I Publication
`
`data
`
`AU-0-
`CA-A-
`EP-A-
`
`AU-o(cid:173)
`GB-A(cid:173)
`WO-A-
`
`JP-A-
`
`5153290
`2006865
`0451216
`
`3062689
`2216126
`89/07452
`
`2238883
`
`13/08/90
`28/06/90
`16/10/91
`
`06/09/89
`04/10/89
`24/08/89
`
`21/09/90
`
`WO-A(cid:173)
`WO-A-
`
`AU-o-
`
`91/09967
`91/09968
`
`6721490
`
`11/07/91
`11/07/91
`.
`13/06/91
`
`EP-A1- 0403156
`
`WD-A1- 9109967
`
`19/12/90
`
`11/07/91
`
`CA-A-
`
`WO-A(cid:173)
`WO-A-·
`
`2018248
`
`91/09966
`91/09968
`
`07/12/90
`
`11/07/91
`11/07/91
`
`· For more details about Ibis annex: sea Ofllcial Journal or the European patent Olllce, No. 12182
`
`EPO FORM P04711
`
`PFIZER EX. 1502
`Page 1517
`
`
`
`
`
`
`
`W092/15683
`
`PCf/EP92100480
`
`1
`
`·Humanized and Chimeric Monoclonal Antibodies
`
`'.
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`TECHNICAL FIELD OF THE INVENTION
`
`The invention relates to new humanized monoclonal antibodies
`comprising·an artificial modified consensus sequence at least
`of the FRs in the variable region of the heavy chain of human
`immunoglobulins.
`
`The invention relates, furthermore, to humanized and chimeric
`monoclonal antibodies which are binding to epitopes of the
`Epidermal Growth Factor. The invention discloses the amino
`acid sequences of the responding antigen-binding site for
`this receptor.
`
`The invention relates to pharmaceutical compositions·compris(cid:173)
`ing the said antibodies for the purposes of treating tumors
`like melanoma, glioma or carcinoma. The said.antibodies can
`be used also for diagnostic applications regarding locating
`and assessing the said tumors in vitro· or in vivo.
`
`The specification relates to several technical terms which
`are here defined as follows.:
`
`PFIZER EX. 1502
`Page 1520
`
`
`
`W092/15683
`
`PCT/EP92/00480
`
`"Humanized" antibodies mean antibodies comprising FRs of the
`variable regions and constant regions of amino acids located
`in the light and heavy chain which derive from human sources
`.whereas the hypervariable regions derive from non-human
`sources.
`
`..
`..
`
`"Chimeric" antibodies mean antibodies comprising variable and
`hype+Variable regions which derive from non-human sources
`whereas the constant regions derive from human origin.
`
`"FRs" ·mean the framework regions of an antibody and are found
`within the variable regions. In these regions a certain
`alteration of amino acids occurs.
`
`"CDRs" mean the complementarity determining or "hypervari(cid:173)
`able" regions of an antibody and are found within the vari(cid:173)
`able regions. These.regions represent the specific antigen(cid:173)
`binding site and show an immense exchange of amino acids.
`CDRs are primarily responsible for the binding affinity of
`the antigen.
`
`"Consensus sequence .. means a non-naturally occurring amino
`acid sequence as light or heavy chain variable regions and is
`used as substitute for the originally present non-human heavy
`or light chain variable regions. The consensus sequences is
`synthetic and therefore an artificial sequence of the most
`common amino acids of a distinct class or subclass or sub(cid:173)
`group of heavy or light chains of human immunoglobluins.
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`"EGF" and "EGFR" mean the Epidermal Growth Factor and its
`receptor.
`
`PFIZER EX. 1502
`Page 1521
`
`
`
`W092/JS683
`
`PCf/EP92/00480.
`
`- 3 -
`
`"VL" regions mean light chain variable regions.
`
`"VH" regions mean heavy chain variable regions.
`
`5
`
`BACKGROUND OF THE INVENTION
`
`(MAb 425) was raised
`The murine monoclonal antibody 425
`against the human A431 carcinoma cell line and found to bind
`· to a polypeptide epitope on the external domain of the human
`epidermal growth factor receptor (EGFR) . It was found to
`inhibit the binding of epidermal growth factor (EGF) at both
`low and.high affinity EGFR sites (Murthy et al., 1987),
`Enhanced expression of EGFR is found to occur on malignant
`tissue from a variety of sources thus making MAb 425 a possi(cid:173)
`ble agent for the diagnosis and therapeutic treatment of
`human tumors. Indeed, MAb 425 was found to mediate tumor
`cytotoxicity in vitro and to suppress tumor cell growth of
`epidermoid and colorectal carcinoma-derived cell lines in
`vitro (Rodeck et al., 1987). Radiolabelled MAb 425 has also
`been shown to bind to xenografts of human malignant gliomas
`in mice (Takahashi et al., 1987).
`
`EGF is a polypeptide hormone which is mitogenic for epidermal
`and epithelial cells. When EGF interacts with sensitive
`cells, it binds to membrane receptors; the receptor EGF
`complexes cluster and then are internalized in endocytotic
`vesicles. This is responsible for the phenomenon.of "down(cid:173)
`regulation". EGF binding induces a tyrosine kinase activity
`of the receptor molecule and induces synthesis of DNA.
`
`10
`
`15
`
`. 20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1522
`
`
`
`W092/15683
`
`PCf/EP92/00480
`
`-4-
`
`The EGF~receptor is a transmembrane glycoprotein of about
`170,000 Daltons (Cohen, 1982). It is the gene product of the
`c-erb=B proto-oncogene (Downward et al., Nature. Vol. 307,
`pp. 521-527, 1984). The receptor exists in two kinetic forms:
`so-called low affinity and high-affinity receptors.
`
`-·
`
`The A431 carcinoma cell line expresses abundant EGF-receptors
`on its cell surfaces, and thus has been used in many studies
`to generate anti-EGF-receptor antibodies. However, the recep-
`tors on A431 differ from those of other cell types in the
`carbohydrate moieties attached to the polypeptide. Thus many·
`antibodies raised against A431 membranes are direCted against
`carb~hydrates which are not common to all forms of the recep(cid:173)
`tor molecule (e.g. Schreiber, 1983).
`
`I
`
`Other monoclonal antibodies are reactive with the protein
`moiety of EGF-receptors. These antibodies display a variety
`of properties upon binding to EGF-receptors, presumably
`dependent on the particular portion of the receptor molecule
`bound, and the isotype of the antibody. Some antibodies mimic
`some of the effects of EGF {agonists} and some inhibit the
`effects (antagonists).
`
`Expression of EGF-receptors has been implicated in the pro-
`gression of tumor growth. The gene for the receptors has been
`found to be the cellular analogue of the avian viral oncogene
`v-erb-B (Ulrich, 1984) . In addition an association has been
`detected between late stages of melanoma deve1opment and
`extra copies of the chromosome carrying the receptor gene
`(Koprowski et al., Somatic Cell and Molecular Genetics, Vol.
`11, pp. 297-302, 1985) .
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30 -·
`
`PFIZER EX. 1502
`Page 1523
`
`
`
`..
`
`W092115683
`
`PCT/EP92100480.
`
`-5-
`
`Because of EGF-receptors are expressed on a wide variety of
`solid tumors they provide a suitable target for anti-tumor
`therapy. However, there is a need in the art for a suitable
`anti-receptor antibody. Many of the known antibodies have
`properties which would be deleterious if used as anti-tumor
`agents. For example, antibodies which mimic the effects of
`EGF could stimulate the progression of the tumor rather than
`arresting it. Other antibodies which only bind to high or low
`affinity receptors could be less than optimally effective
`because EGF could still exert its effect through the unbound
`receptors. Still other antibodies convert low affinity recep-(cid:173)
`tors to high affinity receptors, which could exacerbate tumor
`gro~h rather than inhibiting it. Thus there is a need in the
`art for an anti-EGF-receptor antibody which would be suitable
`for anti-tumor therapy.
`
`Although murine MAbs have been used for therapeutic treatme~t
`in humans, ·they have elicited an immune response (Giorgi et
`al., 1983; Jaffers et al., 1986) . To overcome this problem,
`several groups. have tried to "humanize" murine antibodies.
`This can involve one of two approaches. Firstly, the murine
`constant region domains for both the light and heavy chain
`can be replaced with human constant regions; Such "chimeric"
`murine-human antibodies have been successfully constructed .
`from several murine antibodies directed against human tumor-.
`associated antigens (Sun et al., 1987; Whittle et al., 1987;
`Liu et al., 1987; Gillies and Wesoiowski, 1990>. This
`approach totally conserves the antigen-binding site of the
`murine antibody,. and hence the antigen affinity, while .. con-
`ferring the human isotype and effector functions. In the
`second approach only the complementarity determining regions
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1524
`
`
`
`W092/15683
`
`PCf/EP92100480
`
`-6-
`
`(CDRs) from the mouse variable regions are grafted together
`with
`human framework regions (FRs) of both the light and
`heavy chain variable domains (VL and VH). It is reasoned that
`
`this technique will transfer the critical and major portion
`of the antigen-binding site to the human antibody (Jones et
`al., 1986).
`
`•
`
`CDR grafting has been carried out for several rodent mono(cid:173)
`clonals (Jones et al., 1986; Reichmann et al., 1988; Verhoe-
`yen et al.; 1988; Queen et al.; 1989; Co et al., 1991; Gorman
`et al., 1991; Maeda et al., 1991; Temptest et al., 1991). All.
`retained their capacity to bind antigen, although the affin(cid:173)
`ity was usually diminished. In most cases it was deemed
`necessary to. alter certain amino acids in the human framework
`residues (FRs) • Both chimeric and CDR grafted antibodies have
`proved superior to the mouse antibodies in the clinic (Hale
`et al., 1988; LoBuglio et al., 1989; Mathieson et a1., 1990).
`However, a general teaching of which amino acids have to be
`changed, is not known and not completely predictable in any
`case.
`
`EP 088 994 proposes the construction of recombinant D~
`vectors comprising of a DNA sequence which codes for a vari(cid:173)
`able domain of a light or a heavy chain of an immunoglobulin
`specific for a predetermined ligand. The application does not
`contemplate variations in the sequence of the variable
`domain.
`
`EP 102 634 describes ~he cloning and expression in bacterial
`host organisms of genes coding for the whole or a part of
`human IgG heavy chain polypeptide, but does not contemplate
`variations in the sequence of the polypeptide.
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1525
`
`
`
`W092/l5683
`
`PCfiEP92/00480
`
`..
`
`EP 239 400 proposes that humanized antibodies cart be obtained
`by replacing the antigen-binding site (hypervariable regions)
`of any human antibody by an antigen-binding site of a non-hu(cid:173)
`man, for example of a mouse or a rat antibody by genetechno(cid:173)
`logical met"hods.
`
`Thus, following this teaching, human or humanized antibodies
`can be manufactured having specific antigen-binding sites
`which were not available up to now in antibodies originating
`from humans.
`
`Chimeric antibodies can be obtained by replacing not only the
`CDRs but the whole variable regions of the light and heavy
`chains. Chimeric antibodies, however, can still be immuno-
`genic. Chimeric antibodies are, however, very useful for
`diagnostic purposes and optimizing humanized antibodies.
`
`It could be shown that the affinity of the antigen-binding
`sites can be influenced by selective exchange of some sing+e
`amino acids within the variable regions which are not
`directly part of the CORs (Reichmann et al., 1988).
`
`As consequence in the worst case, the binding affinity of the
`antigen can be completely lost if one works according to the
`teaching of the EP 239 400. This fact could be demonstrated
`by the inventors of the instant invention, who failed in
`constructing a correspondingly humanized antibody which was
`directed to epitopes of the EGF-receptor.
`
`Therefore, it ~st be considered that the success of such a
`humanization depends on the constitution and conformation of
`the used variable regions and their interactions with the
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1526
`
`
`
`W092/15683
`
`PCf/EP92/00480
`
`- 8 -
`
`.corresponding antigen-binding site. Thus, it is not com(cid:173)
`pletely predictable whether or which modifications within the
`variable domains of the antibody are necessary in order to
`obtain or to improve the binding of the antigen to the anti(cid:173)
`body.
`
`..
`
`•
`
`SUMMARY OF THE INVENTION
`
`Thus, the invention has the object of providing a humanized
`monoclonal antibody which is, in particular, directed to the
`EGF-receptor, comprising an antigen-binding site of non-human
`sources and the FRs of the variable regions and constant
`regions of human origins, which are, if necessary, modified
`in a way that the specificity of the binding site can be
`conserved or restored.
`
`In particular, the invention has the object of characterizing
`the hypervariable regions of the antigen-binding site of an
`antibody against the EGF-receptor and providing these CDRs
`within a humanized monoclonal antibody defined as above.
`
`This antibody and its chimeric variant can play an important
`role.as a therapeutic or diagnostic agent in order to combat
`tumors, as melanoma, glioma or carcinoma.
`
`It has been found, that effective and specific humanized
`monoclonal antibodies can be easily obtained by using a
`consensus sequence of at least the heavy chain variable
`regions of human immunoglobulins. In particular, all those
`consensus· ·sequences are suitable which have a good Cat least
`60-70 %, particularly 65-70 %) identity compared with the
`variable regions of the original non-human antibodies.
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1527
`
`
`
`wo 92/15683
`
`PCf /EP92/00480
`
`-9-
`
`~urthermore, it has been found, that these consensus
`sequences have to be modified only to a low extent whereas
`sometimes much more modifications have to be· undertaken using
`variable regions of naturally occurring human antibodies.
`Often no or only a few modifications in the amino acid
`sequence are necessary according to the invention in order to
`receive a good specific antigen binding. Thus, only a few
`amino acids must be replaced in getting a perfect binding of
`the EGF-receptor to the preferred humanized antibody accord-
`ing to the invention, whereas no binding can be obtained here
`according to the teaching of the EP 239 400. The modifica-
`tions which are necessary according to the invention can be
`indicated with 0 to 10 %, or preferably, 1 to 5 % related to
`the exchange of amino acids.
`
`A humanized monoclonal antibody according to the invention
`has the following advantage: a consensus sequence which is a
`sequence according to the most common occurrence of amino
`acid on a distinct position of a chain of human immunoglobu-
`lin of a defined class or subclass or subgroup, can be syn~
`thesized as a whole or as a part without problems. There is
`no dependence on the detailed knowledge or availability of
`. certain .individual antibodies or antibody fragments. That
`means that a wide range of individually and naturally occur~
`ring antibody fragments can be . covered by providing a very
`restricted number of consensus sequences which are cloned
`into corresponding expression vectors. A consensus sequence
`may be favorable with respect to the immunogenicity in com(cid:173)
`parison wi~h individual natural sequences which are known to
`be sometimes epitopes for other antibodies (for example
`anti-idiotypic antibodies) .
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1528
`
`
`
`W092/15683
`
`PCf/EP92/00480
`
`- 10-
`
`Although o~ly one preferred embodiment was made, a general
`principal teaching is disclosed according to the instant
`invention. It is not a mere accident with respect to the
`large number of possible sequences and combinations of
`sequences in the variable and hypervariable domains that the
`described teaching regarding the consensus sequence succeeded
`in constructing a humanized antibody directed to the EGF-re(cid:173)
`ceptor.
`
`FurtheDmore, it has been found, that the heavy chains of the
`variable domains provide a greater contribution to the anti(cid:173)
`gen-binding site than the corresponding light chains. There(cid:173)
`fore, it is not necessary to modify in the same manner the
`light chain of a humanized antibody having a consensus
`sequence. This is an interesting aspect because it is_ -known
`that the light chains in some known natural ~tibodies play
`the more important role than the corresponding heavy chains
`(see Williams et al., 1990).
`
`Finally and above all, the invention provides for the first
`time the characterization, cloning and amplification by means
`of genetic engineering the antigen-binding site of a murine
`antibody against the EGF-receptor (MAb 425). Corresponding
`oligonucleotides could be synthesized which code for that
`antigen-binding site and for the whole variable domain of a
`humanized and chimeric monoclonal antibody. The invention
`provides, moreover, correspondingly effective expression
`vectors which can be used for the transformation of suitable
`eukaryotic cells.
`
`5 -
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1529
`
`
`
`W092/15683
`
`-12
`
`PCT/EP92100480 .··
`
`Thus, the invention relates to a humanized monoclonal anti~
`body comprising antigen bindings sites CCDRs) of non-human
`origin, and the FRs of variable regions and constant regions
`of light and heavy chains of human origin, characterized in
`that at least the FRs of the variable regions of the heavy
`chain comprise a modified consensus sequence of different
`variable regions of a distinct class or subgroup of a human
`immunoglobulin.
`
`In particular, the invention relates to a humanized mono(cid:173)
`clonal antibody, wherein the FRs of the consensus sequen~e
`has a homology of at least 70 % compared with the amino acid
`sequence of the FRs of the variable region of the non-human
`antibody from which the antigen-binding sites originate.
`
`In particular, the invention relates to a humanized mono(cid:173)
`clonal antibody, having the following properties:
`
`(a) binds to human EGF-receptors;
`(b) inhibits binding of EGF to EGF-receptor;
`(c) inhibits the EGF-dependent tyrosine kinase activity of
`EGF-receptor;
`(d) inhibits the growth of EGF-sensitive cells •.
`
`In particular, the invention relates to a humanized mono-
`. clonal antibody, wherein the hypervariable regions of the
`antigen-binding sites comprise the following amino acid
`sequences:
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`...
`
`PFIZER EX. 1502
`Page 1530
`
`
`
`W092/15683
`
`PCf/EP92/00480
`
`- 12-
`
`liqht chain
`
`CDR-1
`
`CDR-2
`
`CDR-3
`
`-Ser-Ala-Ser-Ser-Ser-Val-Thr-Tyr-Met-Tyr-
`-Asp-Thr-Ser-Asn-Leu-Ala-Ser-
`-Gln-Gln-Trp-Ser-Ser-His-Ile-Phe-Thr-
`
`heavy chain
`
`CDR-1
`
`CDR-2
`
`CDR-3
`
`-Ser-His-Trp-Met-His-
`-Glu-Phe-Asn-Pro-Ser-Asn-Gly-Arg-Thr-Asn-Tyr-Asn-Glu-
`Lys-Phe-Lys-Ser(cid:173)
`-Arg-Asp-Tyr-Asp-Tyr-Asp-Gly-Arg-Tyr-Phe-Asp-Tyr-
`
`In particular, the invention relates to a humanized mono-
`clonal antibody, wherein the FRs of the variable regions
`which are not related to the antigen-binding sites comprise
`the following amino acid sequence:
`
`light chain
`
`5
`
`10
`
`15
`
`20
`
`FR-1
`
`FR-2
`
`25
`
`FR-3
`
`-Asp-Ile-Gln-Met-Thr-Gln-Ser-Pro-Ser-Ser-Leu-Ser~Ala-
`Ser-Val-Gly-Asp-Arg-Val-Thr-Ile-Thr-cys-
`-Trp-Tyr-Gln-Gln-Lys-Pro-Gly-Lys-Ala-Pro-Lys-Leu-Leu-
`Ile-Tyr-
`-Gly-Val-Pro-Ser-Arg-Phe-Ser-Gly-Ser-Gly-Ser-Gly-Thr(cid:173)
`Asp-Tyr{Phe,Trp,His)-Thr-Phe-Thr-Ile-Ser-Ser-Leu-Gln(cid:173)
`
`FR-4
`
`Pro-Glu~Asp-Ile-Ala-Thr-Tyr-Tyr-Cys-
`-Phe-Gly-Gln-Gly-Thr-Lys-Val-Glu-Ile-Lys-
`
`30
`
`PFIZER EX. 1502
`Page 1531
`
`
`
`WO 92/15683
`
`PCf /EP92/00480
`
`- 13-
`
`heavy chain
`
`5
`
`10
`
`FR-1
`
`FR-2
`
`FR-3
`
`FR-4
`
`-Gln-Val-Gln-Leu-Val-Gln-Ser-Gly-Ala-Glu-Val-Lys-Lys-
`Pro-Gly-Ala-Ser-Val-Lys-Val-Ser-cys-Lys-Ala-Ser-Gly(cid:173)
`Tyr-Thr-Phe-Thr(Ser)-
`
`-Trp-Val-Arg(His)-Gln-Ala(Lys,His)-Pro(Val)~Gly-Gln-
`Gly-Leu-Glu-Trp-Ile(Val,Leu)-Gly-
`-Lys(Arg,His)-Ala(Val,Pro-Gly)-Thr-Met-Thr-
`Val(Ala,Pro,Gly)-Asp-Thr-Ser-Thr-Asn-Thr-Ala-Tyr-Met(cid:173)
`Glu(Asn)-Leu-Ser-Ser-Leu-Arg-Ser-Glu-Asp-Thr-Ala-Val(cid:173)
`Tyr-Tyr-cys-Ala-Ser-
`-Trp-Gly-Gln-Gly-Thr-Leu-Val-Thr-Val-Ser-Ser-,
`
`and wherein the amino acids listed in the brackets are alter-
`natives.
`
`15
`
`In particular, the invention relates to a humanized mono(cid:173)
`clonal antibody; wherein the constant regions of the heavy
`chain comprise the amino acid sequence of a gamma-1 chain,
`and the constant regions of the light chain comprise the
`amino acid·sequence of a kappa chain of a human immunoglobu(cid:173)
`lin.
`
`In particular~ the invention relates to a humanized mono-
`clonal antibody; comprising a derivate of an amino acid
`sequence modified by amino acid deletion, substitution,
`addition .or inversion within the variable and constant
`regions wherein the biological function of specific binding
`to the. antigen is preserved ..
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1532
`
`
`
`W092/I5683
`
`PCf/EP92/00480
`
`- 14-
`
`Furthermore, the invention relates to an expression vector,
`suitable for transformation of host cells, characterized in
`that it comprises a DNA sequence coding for the variable
`· and/or constant regions of the light and/or heavy chains of a
`humanized antibody.
`
`Furthermore, the invention relates to humanized or chimeric
`monoclonal antibody, comprising hypervariable regions (CDRs)
`of antigen-binding sites of murine origin and the FRs of the
`variable regions of human or murine origin and constant
`regions of light and heavy chains of human origin, character(cid:173)
`ized in that the hypervariable regions comprise the following
`amino acid sequences,
`
`5.
`
`10
`
`15
`
`light chain
`
`CDR-1.
`
`CDR-2
`
`CDR-3
`
`-Ser-Ala-Ser-Ser-Ser-Val-T~-Tyr-Met-Tyr-
`
`-Asp-Thr-Ser~n-Leu-Ala-Ser-
`-Gln-Gln-Trp-Ser-Ser-His-Ile-Phe-Thr-
`
`heavy chain
`
`CDR-1
`
`CDR-2
`
`CDR-3
`
`-Ser-His-Trp~et-His-
`
`-~lu-Phe-Asn-Pro-Ser-Asn-Gly-Arg-Thr-Asn-Tyr-Asn-Glu-
`Lys-Phe-Lys-Ser(cid:173)
`-Arg-Asp-Tyr-Asp-Tyr-Asp-Gly-Arg-Tyr-Phe-ASp-Tyr-,
`
`and wherein the constant regions of the heavy chain comprise
`the amino acid sequence of a gamma-1 chain, and the constant
`regions of the light chain comprise the amino acid sequence
`of a kappa chain of a human immunoglobulin.
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1533
`
`
`
`W092/J5683
`
`PCf/EP92/00480
`
`- 15-
`
`In particular, the invention relates to a humanized mono- '
`clonal antibody according to claim 12, wherein the FRs of the
`variable regions which are not related to the antigen-binding
`sites, are of human origin and comprise the following amino
`acid sequence,
`
`light chai.n
`
`FR-1
`
`FR-2
`
`FR-3
`
`FR-4
`
`-Asp-Ile-Gln-Met-Thr-Gln-Ser-Pro-Ser-Ser-Leu-Ser-Ala(cid:173)
`Ser-Val-Gly-Asp-Arg-Val-Thr-Ile-Thr-cys(cid:173)
`-Trp-Tyr-Gln-Gln-Lys-Pro-Gly-Lys-Ala-Pro-Lys-Leu-Leu(cid:173)
`Ile-Tyr(cid:173)
`
`Gly-Val-Pro-Ser-Arg-Phe-Ser-Gly-Ser-Gly-Ser~Gly-Thr
`Asp-Tyr(Phe,Trp,His)-Thr-Phe-Thr-Ile-Ser-Ser-Leu-Gln(cid:173)
`Pro-Glu-Asp-Ile-Ala-Thr-Tyr-Tyr-Cys(cid:173)
`-Phe-Gly-Gln-Gly-Thr-Lys-Val-Glu-Ile-Lys-
`
`5
`
`10
`
`15
`
`20
`
`FR-1
`
`FR-2
`
`25
`
`FR-3
`
`-Gln-Val-Gln~Leu-Val-Gln-Ser-Gly-Ala-Glu-Val-Lys-Lys-
`Pro-Gly-Ala-Ser-Val-Lys-Val-Ser-Cys-Lys-Ala-Ser-Gly(cid:173)
`Tyr-Thr-Phe-Thr(Ser)-
`-Trp-Val-Arg(His}-Gln~Ala(Lys,His)-Pro(Val)-Gly-Gln~
`Gly-Leu-Glu-Trp-Ile(Val,Leu)-Gly-
`-Lys(Arg,His)-Ala(Val,Pro,Gly)-Thr-Met-Thr(cid:173)
`Val(Ala,Pro,Gly)-Asp-Thr-Ser-Thr-Asn-Thr-Ala-Tyr-Met(cid:173)
`Glu(Asn)-Leu-Ser-Ser-Leu-Arg-Ser-Glu-Asp-Thr-Ala-Val(cid:173)
`
`Tyr~Tyr-Cys-Ala-Ser-
`
`FR-4
`
`-Trp~Gly-Gln-Gly-Thr-Leu-Val-Thr-Val-Ser-Ser-
`
`30
`
`PFIZER EX. 1502
`Page 1534
`
`
`
`W092/15683
`
`PCf/EP92/00480
`
`- 16-
`
`In particular, the invention relates to a chimeric monoclonal
`antibody according to Claim 12, wherein the FRs of the vari(cid:173)
`able regions which are not related to the antigen-binding
`site, are of murine origin and comprise the following amino
`acid sequences:
`
`llght chain
`
`FR-1
`
`FR-2
`
`FR-3
`
`FR-4
`
`-Gln-Ile-Val-Leu-Thr-Gln-Ser-Pro-Ala-I1e-Met-Ser-Ala(cid:173)
`Ser-Pro-Gly-Glu-Lys-Val-Thr-Met-Thr-cys(cid:173)
`-Trp-Tyr-Gln-Gln-Lys-Pro-Gly-Ser-Ser-Pro-Arg-Leu-Leu(cid:173)
`Ile-Tyr(cid:173)
`-Gly-Val-Pro-Val-Arg-Phe-Ser-Gly-Ser-Gly-Ser-Gly-Thr(cid:173)
`Ser-Tyr-Ser-Leu-Thr-Ile-Ser-Arg-Met-Glu-Ala-Glu-Asp(cid:173)
`Ala-Ala-Thr-Tyr-Tyr-cys(cid:173)
`-Phe-Gly-Ser-Gly-Thr-Lys-Leu-Glu-Ile-Lys-
`
`heavy chain
`
`s
`
`10
`
`15
`
`-Gln-Val-Gln-Leu-Gln-Gln-Pro-Gly-Ala-Glu-Leu-Val-Lys(cid:173)
`Pro-Gly-Ala-Ser-Val-Lys-Leu-Ser-cys-Lys-Ala-Ser-Gly(cid:173)
`Tyr-Thr-Phe-Thr-
`-Trp-Val-Lys-Gln-Arg-Ala-Gly-Gln-Gly-Leu-Glu-Trp-Ile-
`Gly-:-
`-Lys-Ala-Thr-Leu-Thr-Val-Asp-Lys-Ser-Ser-Ser-Thr-Ala(cid:173)
`Tyr-Met-Gln-Leu-Ser-Ser-Leu-Thr-Ser-Glu-Asp-Ser-Ala(cid:173)
`Val-Tyr-Tyr-Cys-Ala-Ser-
`-Trp-Gly-Gln-Gly-Thr-Thr-Leu-Thr-Val-Ser-Ser-
`
`20
`
`FR-1
`
`FR-2
`
`25
`
`FR-3
`
`FR-4
`
`30
`
`PFIZER EX. 1502
`Page 1535
`
`
`
`wo 92/15683
`
`PCf /EP92/00480
`
`~ 17-
`
`Moreover, the invention relates to an expression vector,
`suitable for transformation of host cells, characterized in
`that it comprises DNA sequences coding for the variable
`and/or constant regions of the light and/or heavy chains of a
`humanized or chimeric monoclonal antibody.
`
`Furthermore, the invention relates to a process for the
`preparation of a humanized monoclo