`
`PCf/US89/00051
`
`-39-
`
`21. A method as in claim 16 wherein said antibodies are monoclonal
`
`antibodies.
`
`22. A method as in claim 16 wherein the tumor cells comprise a
`carcinoma selected from human breast, renal, gastric and salivary
`gland carcinomas, or other tumor cell ·types expressing the HER2
`receptor.
`
`23. A method of treating tumor cells comprising the steps of:
`administering to a patient a
`therapeutically effective
`amount of antibodies capable of inhibiting growth factor receptor
`function; and
`administering to a patient a therapeutically effective
`amount of a cytotoxic factor.
`
`A method as in claim 23 wherein said cytotoxic factor is
`24.
`selected from the group consisting of TNF-a, TNF-p, IL-l, IFN-7 and
`IL-2.
`
`5
`
`10
`
`15
`
`20
`
`25. A method as in claim 23 wherein said cytotoxic factor is TNF-a
`
`26. A method as in claim 23 wherein said ·antibodies interrupt an
`autocrine growth cycle.
`
`25
`
`30
`
`27. A method as in claim 23 wherein said antibodies specifically
`bind a growth factor receptor.
`
`28. A method as in claim 27 wherein the growth factor receptor is
`selected from the group consisting of the EGF receptor and the HER2
`receptor.
`
`29. A method as in claim 23 wherein said antibodies specifically
`bind a growth factor.
`
`PFIZER EX. 1502
`Page 1001
`
`
`
`W089f06692
`
`PCf/US89f00051
`
`-40-
`
`30. A method as in claim 29 wherein said growth factor is selected
`from the group consistin_g of EGF, TGF-a and TGF-.fJ.
`
`31. A method as in claim 23 wherein said antibodies are monoclonal
`antibodies.
`
`5
`
`32. A method as in claim 23 wherein said antibodies are conjugated
`to a cytotoxic moiety.
`
`33. A method as in claim 23 wherein said antibodies are capable of
`activating complement.
`
`34. A method as in claim 23 wherein said antibodies are capable of
`mediating antibody dependent cellular cytotoxicity.
`
`35. A method as in claim 23 wherein the tumor cells comprise a
`carcinoma selected from human breast, renal, gastric and salivary
`gland carcinomas.
`
`An assay for receptors and other proteins having increased
`36.
`tyrosine kinase activity comprising the steps of:
`(a) exposing cells suspected to be TNF-a sensitive to TNF-a;
`(b)
`isolating those cells which are TNF-a resistant;
`(c)
`screening the isolated cells for increased tyrosine kinase
`activity; and
`(d)
`isolating receptors and other proteins having increased
`tyrosine kinase activity.
`
`37. A composition suitable for administration to a patient having
`a growth factor receptor dependent tumor comprising (a) antibodies
`capable of inhibiting growth factor receptor function, and (b) a
`cytotoxic factor.
`
`10
`
`15
`
`20
`
`25
`
`30
`
`PFIZER EX. 1502
`Page 1002
`
`
`
`W089/06692
`
`PCT /US89/00051
`
`-41-
`
`38. A composition as in claim 37 wherein the cytotoxic factor is
`selected from the group consis.ting of .INF-.a, TNF-p, IL-l, IFN--y and
`IL-2.
`
`5
`
`39. An immunotoxin as in Claim 10 wherein the cytotoxic moiety is
`ricin A chain.
`
`PFIZER EX. 1502
`Page 1003
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`.. __ ~IJJ'HIIl tlfFOitMATION COifTINUID FROM THI HCOifD SHUT
`
`International Aoolication No. PCT /US 8 9/0 0 0 51
`
`v.(iS 08SIIlVATIOifS WHIRl ClllTAIIf CLAIMS Willi FOUND UlfSIAitCHA8U'
`
`Till a lnttmauonal Marcil rtoort hal not been eatablltlltelln rtaoect of certain cl&lme vnder Article 17CJ) Cal for the foiJowlne rtuona:
`.'lt .....• becavM they relata to aubject metter not requlr.d to be ~liM IIJ tlllt Allttlortty, name~r:
`1.(ig Claim nvmbera
`* 16-35, see PCT-rule 39.1(IV); methods for treatment of the
`human or animal body by surgery or therapy, as well as diag(cid:173)
`nostic methods.
`
`t.O Claim nvmben ............ becavaa ,,.,. ralllt to oarta of tilt lnttrnatlonal aoollcatJon tf\at do not comply wHII tilt or.acnbtcl require-
`ments to such an uttnt 11\at no meanintfYI lntametlonal Marcil can bt carrltcl out. ~:
`
`30 CIUft """"*"· .. ..-. Dec~UM they.,..~ c:laima ancs.,.. not cnnecs 1n ~ wt1r1 tne MCCOnCS ancs INrU Mntencn Of
`
`PCT Aula 1.4(a).
`
`VI.[) 08SIIlVATIOifS WHIRl UNITY OF INVIIfTIOif IS LACKING '
`
`Tllla lntamallonal Starc~~~nv Avthorttr found muiUple lltftlltlona In tflla lntamatlonal aoollcallon aa followa:
`
`1.[] Aa au requlr.d addtuonal aaatdl fMa wera tlmelr paid 117 the aopllcant. tllla lnt.matlonal Match rtoort CGYeta au atarcl\alllt clalma
`of the lntamatJonal aoOUcation.
`!.0 At only aome of the r.Qulrad addHlonal Marcil fMS ..,. tlmeiJ paid 117 the aooUcant. IIIIa International Marcil rtoort cowtrt only
`lfloaa clalma of tilt lntamatlonal application for wltlcll fMa wera oatd, apeclftcaU, clalma:
`
`a.[] Np required additional Mtrcll r..a _,. tlmtiJ' paid 117 tilt aopltcant. ConaeqwntiJ, IIIIa International atarcll rtoort Ia rtatnctad to
`the lnftfttlon flrat mentioned In the cl&lma: n II coYtrtelllr claim 11umbera:
`
`•.[] Aa aiiHtrcllabla claima c~vlel bt •••relied without a«ort juttlfyint an additional Itt, tilt International S..rcllln; AutiiOrttJ Clld not
`lftwltt oaJmant of any additional Itt.
`lltmart 011 Prottat
`0 Tilt additional Mtrcll ftta wett accomoanltd by aoollcant'a protett.
`0 No Orottlt accomoanled tilt oayment of addiUonal Marcil ftta.
`
`Fonft PCT/ISA/r!O (avopltmantalallllt (2)) ~ 1NS)
`
`PFIZER EX. 1502
`Page 1012
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`~.-----. .. --~ -
`
`....
`
`... J - · ..
`
`W090/07861
`
`PCf /US89/0385'7
`
`:n
`
`5
`
`10
`
`15
`
`20
`
`25
`
`30
`
`35
`
`original mouse anti-T~~ antibody wa• also used to stain thea~
`cella (Figure 9B,C), giving similar result•.
`For further experiments, cells producing the
`humanized antibody were injected into mico, and the resultant
`ascites collected. Humanized anr.ibody W."!S purified to
`substantial homogeneity from the ascites by passage through
`an affinity column of goat anti-human immunoglobulin
`antibody, prepared on an Affigel-10 support {Bio-Rad
`Laboratorieg, Inc., Richmond, CA) according to standard
`techniques. To determine the affinity o! the humanized
`antibody relative to the original anti-Tac antibody, a
`competitive binding experiment vas performed. About 5 x 10 5
`HUT-192 cells were incubated with known quantitie• (10 - 40
`ng) of the anti-Tee antibody and the humanized anti-Tac
`antibody for 10 min at 4 deg. Then 100 ng of biotinylated
`anti-Tee vas added to the cells and incubated tor 30 min at 4
`~eg. This quanti~y of anti-Tac had previously been
`determined to be sufficient to saturate the binding sites on
`the cells, but not to be in large excess.
`Then the cells
`were washed twice with 2 ml of phosphate buffered saline
`(PBS) containing 0.1\ sodium azide. The cells were then
`incubated for JO min at 4 deg with 250 ng of
`phycoerythrin-conjugated avidin, vhich bound to the
`biotinylated anti-Tac already bound to the cells. The cells
`were washed again as above, fixed in PBS containing 1\
`paraformaldehyde, and analyzed tor fluorescence on a FACSCAN
`cytofluorometer.
`Use of increasing amounts (10 - 40 ng) of the
`anti-Tac antibody as competitor in the first step decreased
`the amount o! biotinylated anti-Tac that could bind to the
`cells in the second step, and therefore the amount of
`phycoerythrin-conjugated avidin that bound in the last step,
`thus decreasing fluorescence (Figure lOA). Equivalent
`amounts (20 ng) of anti-Tac, and humanized anti-Tee used as
`competitor d~creased the fluorescence to approximately the
`same degree (Figure lOB). This shove that theaa antibodies
`have approximately the same affinity (within J to 4 fold),
`because if one had much greater affinity, it would have more
`
`PFIZER EX. 1502
`Page 1045
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`~ ...... _ , . . . . . . . . . . _:;f.
`
`« » ."fiucan‘t?
`
`we’mid'vm
`
`r
`
`'
`
`PCT/US""058$7
`
`I
`H
`9
`s
`A
`s
`A
`I M s A s
`p A
`!: K v T
`p G
`I
`I
`I
`I
`I
`I
`I
`I
`I
`l
`T
`L
`s T
`s
`A
`s
`s
`s A s v G 0 R v T
`p
`L
`
`Ip
`
`I
`I
`I
`
`v L T Q s
`we
`I
`I
`I
`if
`Q M T Q s
`To
`
`1
`
`1
`
`21
`
`21
`
`40
`
`41
`
`60
`
`61
`
`80
`
`81
`
`Q
`
`0
`
`I
`I
`I
`
`R
`I
`R
`
`£
`
`0
`
`T c s A
`s s
`s
`s
`y M H w r Q Q K
`I
`svnu
`1.55%?
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`s Q
`s
`T c R A
`RASQSINTWLA
`I N T w L A w y Q Q K
`-------------------------------
`p K L w
`s N L A
`y T T
`s G v p A
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`y K A s s
`p K L
`s G v p
`s
`L M
`L E
`•
`-------------------
`•
`s R M - A
`s G s G s G T s
`s L T
`}-'
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`I
`1 G s G s c T E
`r T L T
`s s
`F
`I
`•
`0 .
`I
`0
`
`I
`
`'{
`
`x I
`
`s
`
`G T
`I
`G K A
`
`r
`
`r
`
`T
`I
`!, T
`
`y
`I
`y
`
`y
`I
`y
`
`r~‘...‘
`
`,I
`
`‘1¢
`w
`J».
`v'5‘;
`di .-.;~tr
`3:54.
`
`few.
`
`p
`I
`p
`
`L Q
`
`p
`
`r G s
`I
`I
`r G Q
`
`
`
`c H Q R s T
`l· T
`I
`I
`y N s
`s K M
`t: Q Q
`-------------------------
`
`p
`
`y
`
`0
`
`100
`
`101
`
`G T K L E L K
`I
`I
`I
`I
`'
`I
`':' K v
`£ v K
`G
`
`PFIZER EX. 1502
`
`Page 1053
`
`PFIZER EX. 1502
`Page 1053
`
`
`
`
`
`.... ~ .~·
`
`wo 90/07861
`
`.;- •• #
`
`•
`
`PCT IUSB9105857
`
`~/10
`FIGt1RE 4
`
`60
`50
`40
`30
`20
`10
`~CTAG~TGGAGACCGATACCCTCCTGCTATGGGTCCTCCTGCTATGGGTCCCAGGATCAA
`M £ T 0 T L L L W V L L L W V P G S
`eo
`120
`110
`100
`90
`70
`CCGGAGATATTCAGAT~ACCCAGTCTCCATCTACCCTCTCTGCTAGCGTCCCCCATACGG
`I Q M T Q S P S T L S A S V G 0 R
`T G 0
`
`180
`170
`160
`150
`140
`130
`7C~CC~TAACCTG~CTCCCAGCTCAAGTATAAGTTACATCCACTCCTAC~CCACAAGC
`7 T
`•
`:
`C S A S S S
`I
`S Y M H W Y Q Q K
`
`240
`230
`210
`200
`190
`220
`CAGGCAAAGCTCCCAAGCTTCTAATTTATACCACATCCAACCTCGCTTCTCGAGTCCCTG
`P G K A P K L L
`I Y T T S N L A S G V P
`
`300
`290
`280
`270
`260
`250
`CTCCCTTCACTCCCACTCCATCTCGGACCGAGTTCACCCTCACAATCAGCTCTCTCCAGC
`A R r S G S G S G T £
`r T L T
`I S S L Q
`
`360
`350
`340
`330
`320
`310
`CACATCATTTC:CCACTTATTACTGCCATCAAAGGACTACTTACCCACTCACGTTCCCTC
`P 0 0 F A T Y Y C H Q R S T Y P L T F G
`
`400
`390
`380
`370
`AGCCCACCAAGCTCCACCTCAAACCTAACTACACTTTTCTAGA
`Q G T K V E V K
`
`i" _;.:.;,:; ,;~;-::;;·--::~. :.-:;...:~·~_;;:::~·_'::<::~·=~~f)".-~~:~;;~~~·:·.~:·:~~~·~
`
`,
`
`•
`
`•
`
`,
`
`•
`
`•
`
`.
`
`I
`
`•
`
`•
`
`•
`
`i.
`
`.J ..... -·•·•· •4•1
`
`·~:· • •
`
`..,. :•
`
`•
`
`. ~ :.: ::
`
`·: ~ ... ; ~~-
`
`:.: .. '
`
`..... · .·· ..... _ .,
`
`PFIZER EX. 1502
`Page 1055
`
`
`
`
`
`W090701861
`
`PCT/USM/058!1
`
`FIGURE 6
`
`6/10
`
`3FD1 CAAATCTACATCCACACCCATACCCTCCTCCTATCCCTCCTCCTCCTATCCCTCCCACGA
`TCAACCGGAGATATTCACATGACCCACTCTCCATCTACCCTCTCTGCTAGCCTCGGCGAT
`
`3FD2 ATAAATTAGAAGCTTCCGAGCTTTCCCTGCCTTC!GCTGGTACCACTCCATCTAACTTAT
`ACTTCAGCTGGCAGACCAGCTTATGCTCACCCTATCCCCGACGCTAGCACAGAG
`
`3FOJ GCTCCCAAGCTTCTAATTTATAC~CATCCAACCTGCCTTCTCCACTCCCTCCTCGCTTC
`ACTGGCACTCGATCTGGGACCGACTTCACCCTCACAATCAGCTCTCTGCACCCAGATGAT
`TTC
`
`3FD4 TATATCTAGAAAACTCTACTTACCTTTCACCTCCACCTTCCTCCCCTCACCCAACGTCAC
`TCCGTAACTACTCCTTTGATGCCACTAATAACTGGCCAAATCATCTCGCTCCACACACCT
`GA
`
`3FCl
`-------------------+
`-------------------·
`~------------------
`~-------------------
`I
`JFD4
`31'02
`Hind III
`
`3FD3
`
`PFIZER EX. 1502
`Page 1057
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`
`·wo 91/09967
`
`PCT/GB90/0l017
`
`- 1 -
`BDMANrSED ANTrBoorEs
`
`Field of the rnvention
`The present invention r-elates to .bnmaniaed antibody
`molecules, to processes for their production using
`recombinant DNA techn~loqy, and to their therapeutic uses.
`
`The term •humanised antibody molecule• is uaed to describe
`a molecule having an antigen binding site derived from an
`immunoglobulin from a non-human species, and remaining
`immunoglobulin-derived parts of the molecule being derived
`from a human immunoglobulin.
`The antigen binding site
`typically comprises complementarity determining regions
`(CDRs) which determine the binding specificity of the
`antibody molecule and which are carried on appropriate
`framework regions in the variable domains.
`There are 3
`CDRs (CDRl, ·cDR2 and CDR3) in each of the heavy and liqht
`chain variable domains.
`
`rn the description, reference is made to a number of
`publications by number.
`The publications are listed in
`numerical order at the end of the description.
`
`Background of the rnvention
`Natural ; mmnnoglobulins have been known for many years, as
`have the various fragments thereof, such as the Pab,
`(Pab')2 and Fe fragments, which can be derived by
`enzymatic cleavage. Natural immunoglobulins comprise a
`generally Y-shaped molecule having an antigen-binding site
`towards the end of each upper arm.
`The remainder of the
`structure, and particularly the stem of the Y, mediates
`the effector functions associated with immunoglobulins.
`
`Natural immunoglobulins have been used in assay, diagnosis
`and, to a more limited extent, therapy.
`However, such
`uses, especially in therapy, were hindered until recently
`by the polyclonal nature of natural immunoglobulins. A
`significant step towards the realisation of tba potential
`
`PFIZER EX. 1502
`Page 1068
`
`
`
`
`
`. wo 91109967
`
`.. --~ ~-
`
`~ . ,
`
`PCJ'/GB90/0lOJ7
`
`- 3 -
`
`techniques typically involve the uaa of recambinant DNA
`technology to manipulate DNA sequences encoding the
`polypeptide chains of the antibody molecule.
`
`Early methods for humanising MAbs involved production of
`ch~eric antibodies in which an antigen binding site
`comprising the complete variable domains of one antibody
`is linked to constant domains derived from another
`antibody. Methods for carrying out such chimerisation
`procedures are described in EP0120694 (Celltech Limited),
`EP0125023 (Genentech Inc. and City of Hope), EP-A-0 171496
`(Res. Dev. Corp. Japan), EP-A-0 173 494 (Stanford
`University), and wo 86/01533 (Celltech Limited).. This
`latter Celltech application (WO 86/01533) discloses a
`process for preparing an antibody molecule having the
`variable domains from a mouse MAb and the constant domains
`from a human immunoglobulin.
`Such humanised chimeric
`antibodies, however, still contain a significant
`proportion of non-human amino acid sequence, i.e. the
`complete non-human variable domains, and thus may still
`elicit some BAMA response, particularly if administered
`over a prolonged period [Begent et al (ref. 4)]•
`
`In an alternative approach, described in EP-A-0239400
`(Winter), the complementarity determining regions (CDRs)
`of a mouse MAb have been grafted onto the framework
`regions of the variable domains of a human immunoglobulin
`by site directed mutagenesis using long oligonucleotides.
`The present invention rela~es to humanised antibody
`molecules prepared according to this alternative approach,
`i.e. CDR-grafted humanised antibody molecules.
`Such
`CDR-grafted humanised antibodies are much less likely to
`give rise to a BAMA response than humanised chimeri-c
`antibodies in view of the much lower proportion of
`non-human amino acid sequence which they contain.
`
`•
`
`PFIZER EX. 1502
`Page 1070
`
`
`
`I WO 91109967
`
`PCT/GB90/02017
`
`- 4 -
`
`The earliest work on bnmen;sing MAbs by CDR-grafting was
`carried out on MAbs recognising ~ynthetic antigens, such
`as the NP or NIP antigens.
`However, example a in which a
`mouse MAb recognising lysozyme and a rat MAb recognising
`an antigen on human T-cella were bnmenj sed by CDR-grafting
`have been described by Verhoeyen et al (5) and Riecbmann
`et al (6) respectively.
`The preparation of CDR-grafted
`antibody to the antigen on human T cells is also described
`in wo 89/07452 (Medical Research Council).
`
`In Riechmann et al/Medical Research Council it was found
`that transfer of the CDR regions alone· [as defined by
`Kabat refs. (7) and (8)) was not sufficient to provide
`satisfactory antigen binding activity in the CDR-grafted
`product.
`Riechmenn et al found that it was necessary to
`convert a serine residue at position 27 of the human
`sequence to the corresponding rat phenylalanine residue to
`obtain a CDR-grafted product having improved antigen
`binding activity.
`This residue at position 27 of the
`heavy chain is within the structural loop adjacent to
`CDRl.
`A further construct which additionally contained a
`human serine to rat tyrosine change at position 30 of the
`heavy chain did not have a significantly altered binding
`activity over the humanised antibody with the serine to
`phenylalanine change at position 27 alone.
`These results
`indicate that changes to residues of the human sequence
`outside the CDR regions, in particular in the structural
`loop adjacent to CDRl, may be necessary to obtain
`effective antigen binding activity for CDR-grafted
`Even
`antibodies which recognise more complex antigens.
`so.the binding affinity of the best CDR-grafted antibodies
`obtained was still significantly less than the original
`MAb.
`
`Very recently Queen et al (9) have described the
`preparation of a humanised antibody that binds to the
`
`a
`
`t
`
`:
`
`'
`
`PFIZER EX. 1502
`Page 1071
`
`
`
`
`
`W091109967
`
`PCT/GB90/02017
`
`- 6 -
`
`IL-2 receptor.
`The combination of all four cr~ter~a, as
`above, were employed .in designing this bnman i sed antibody,
`the variable region frameworks of the human antibody Eu
`(7) being used as acc•ptor.
`Xn the resultant hnmenised
`antibody the donor CDRs were as defined by Kabat et al (7
`and 8) and ~n addition the mouse donor residues were used
`in place of the human acceptor residues, at positions 27,
`30, 48., 66, 67, 89, 91, 94, 103, 104, 105 and 107 in the
`heavy chain and at positions 48, 60 and 63 in the light
`chain, of the variable region frameworks.
`The humanised
`anti-Tac antibody obtained is reported to have an affinity
`for p55 of 3 x 109 Mrl, about one-third of that of the
`murine MAb.
`
`I
`
`~
`
`We have further investigated the preparation of CDR(cid:173)
`grafted humanised antibody molecules and have identified a
`hierarchy of positions within the framework of the
`variable regions (i.e. outside both the Kabat CDRs and
`structural loops of the variable regions) at which the
`amino acid identities of the ·residues are important for
`obtaining CDR-grafted products with satisfactory binding
`affinity. This has enabled us to establish a protocol
`for obtaining satisfactory CDR-grafted products which may
`be applied very widely irrespective of the level of
`homology between the donor immunoglobulin and acceptor
`framework.
`The set of residues which we have identified
`as being of critical importance does not coincide with the
`residues identified by Queen et al (9).
`
`the Invention
`Accordingly, in a first aspect the invention provides a
`CDR-grafted antibody heavy chain having a variable region
`domain comprising acceptor framework and donor antigen
`binding regions wherein the framework comprises donor
`residues at at least one of positions 6, 23 and/or 24, 48
`and/or 49, 71 and/or 73, 75 and/or 76 and/or 78 and 88 and/
`or 91.
`
`'
`
`PFIZER EX. 1502
`Page 1073
`
`
`
`·wo tJ/09967
`
`PCf/GB90/0l017
`
`.•
`
`- 7 -
`
`In preferred embodiments, the heavy chain framework
`campri.ses donor resi.dues at posi. tiona '23, "21 , 4·9, 'il , '73
`and 78 or at posi.ti.ons 23, 24 and 49.
`The residues at
`positi.ons 71, 73 and 78 of the heavy chain framework are
`preferably either all acceptor or all donor residues.
`
`In particularly preferred embodiments the heavy chain
`framework addi.tionally comprises donor residues at one,
`aame or all of positions 6, 37, 48 and 94. Also it is
`particularly preferred that residues at positions of the
`heavy chain framework which are commonly conserved across
`species, i.e. positions 2, 4, 25, 36, 39, 47, 93, 103,
`104, 106 and 107, if not conserved between donor and
`acceptor, additionally comprise donor residues. Most
`preferably the heavy chain framework additionally
`comprises donor residues at positions 2, 4, 6, 25, 36, 37,
`39, 47, 48, 93, 94, 103, 104, 106 and 107.
`
`In addition the heavy chain framework optionally comprises
`· donor residues at one, some or all of positions:
`1 and 3,
`72 and 76,
`69 (if 48 is different between donor and acceptor),
`38 and 46 (if 48 is the donor residue),
`80 and 20 (if 69 is the donor residua),
`67,
`82 and 18 (if 67 is the donor residue),
`91,
`88, and
`any one or more of 9, 11, 41, 87, 108, 110 and 112.
`
`•
`
`In the first and other aspects of the present invention
`reference is made to CDR-grafted antibody products
`comprising acceptor framework and donor antigen binding
`regions.
`It will be appreciated that the invention is
`widely applicable to the CDR-grafting of antibodies in
`
`PFIZER EX. 1502
`Page 1074
`
`
`
`. wo 91/09967
`
`PCr/GB90/02017
`
`- 8 -
`
`general.
`Thus, the donor and acceptor antibodies may· be
`derived £rom ·"Blli:mal:s of -the 'Bam& ...species -and ·even same
`antibody class or sub-class. More usually, however, the
`donor and acceptor an~ibodies are derived from animals of
`different species. Typically the donor antibody is a
`non-human antibody, such as a rodent MAb, and the acceptor
`antibody is a human antibody.
`
`In the first and other aspects of the present invention,
`the donor antigen binding region typically comprises at
`least one CDR from the donor antibody. Osually·the donor
`antigen binding region comprises at least two and
`preferably all three CDRs of each of the heavy chain
`The CDRs may
`and/or light chain variable regions.
`comprise the Kabat CDRs, the structural loop CDRs or a
`composite of the Kabat and structural loop CDRs and any
`combination of any of these.
`Preferably, the antigen
`binding regions of the CDR-grafted heavy chain variable
`domain comprise CDRs corresponding to the Kabat CDRs at
`CDR2 (residues 50-65) and CDR3 (residues 95-100) and a
`composite of the Kabat and structural loop CDRs at CDRl
`(residues 26-35).
`
`The residue designations given above and elsewhere in the
`present application are numbered according to the Kabat
`numbering [refs. (7) and (8)].
`Thus the resi~e
`designations do not always correspond directly with the
`linear numbering of the amino acid residues.
`~he actual
`linear amino acid sequence may contain fewer or additional
`amino acids than in the strict Kabat numbering
`corresponding to a shortening of, or insertion into, a
`structurai component, whether framework or CDR, of the
`basic variable domain structure.
`For example, the· heavy
`chain variable region of the anti-Tac antibody described
`by Queen et al (9) contains a single amino acid insert
`(residue 52a) after residue 52 of CDR2 and a three amino
`
`'
`
`PFIZER EX. 1502
`Page 1075
`
`
`
`W091/09967
`
`PCf/GB90/02017
`
`9 -
`
`acid insert (residues 82a, 82b and 82c) after framework
`res i dna .82"" -in .:the .ltabat .numberinq.
`The correct Kabat
`numbering of residues may be determined for a given
`antibody by alignment ~t regions of homology of the
`sequence of the antibody with a •standard• Kabat numbered
`sequence.
`
`The invention also provides in a second aspect a CDR(cid:173)
`grafted antibody light chain having a variable region
`domain comprising acceptor framework and donor antigen
`binding regions wherein the.framework comprises donor
`residues at at least one of positions 1 and/or 3 and 46
`and/or 47.
`Preferably the CDR grafted light.chain of the
`second aspect comprises donor residues at positions 46
`and/or 47.
`
`The invention also provides in a third aspect a
`CDR-grafted antibody liqht chain having a variable region
`domain comprising acceptor framework and donor antigen
`binding regions wherein the framework comprises donor
`residues at at least one of positions 46, 48, sa and 71.
`
`In a preferred embodiment of the third aspect, the
`framework comprises donor residues at all of positions 46,
`48, 58 and 71.
`
`In particularly preferred embodiments of the second and
`third aspects, the framework additionally comprises donor
`residues at positions 36, 44, 47, 85 and 87.
`Similarly
`positions of the light chain framework which are commonly
`conserved across species, i.e. positions 2, 4, 6, 35, 49,
`62, 64-69, 98, 99, 101 and 102, if not conserved between
`donor and acceptor, additionally comprise donor residues •
`Most preferably ·the light chain framework additional1y
`comprises donor residues at positions 2, 4, 6, 35, 36, 38,
`44, 47, 49, 62, 64-69, as, 87, 98, 99, 101 and 102.
`
`•
`
`•
`
`PFIZER EX. 1502
`Page 1076
`
`
`
`~---~- ..... _..--. •• "' .• ;c-.(_~-·· ............ ~ ....... : . - - .. - . - .• , ... _.. _ _..
`
`.. ~··- -··~···.
`
`W091/09967
`
`PCr/GB90/02017
`
`10
`
`Xn addit~on the framework of the second or th~d aspects
`optionally comprises donor residues at one, same or all of
`positions:
`1 and 3,
`~,
`60 (if 60 and 54 are able to foDD at potential saltbr~dge),
`70 (if 70 and 24 are able to form a potential saltbr~dge),
`73 and 21 (if 47 is different between donor and acceptor),
`37 and 45 (if 47 is different between donor and acceptor),
`and
`any one or more of 10, 12, 40, 80, 103 and 105.
`
`Preferably, the antigen b~ding regions of the CDR-grafted
`light chain variable domain compr~se CDRs corresponding to
`the Kabat CDR& at CDR1 (res~due 24-34), CDR2 (residues
`50-56) and CDR3 (res~dues 89-97).
`
`The invent~on further provides ~ a fourth aspect a
`CDR-grafted antibody molecule comprising at least one
`CDR-grafted heavy chain and at least one CDR-grafted l~ght
`chain accord~ng to the f~st and second or first and th~rd
`aspects of the ~vention.
`
`The humanised antibody molecules and chains of the present
`invention may comprise:
`a complete antibody molecule,
`having full length heavy and light chainsJ
`a fragment
`thereof, such as a Fab, (Fab')2 or FV fragmentJ
`a light
`chain or heavy chain monomer or dimerJ or a single chain
`antibody, e.g. a s~gle chain FV in which heavy and light
`chain variable reg~ons are jo~ned by a peptide linkerJ or
`any other CDR-grafted molecule with the same specificity
`as the orig~nal donor antibody.
`Similarly the
`CDR-grafted heavy and light chain variable region may be
`combined w~th other antibody domains as appropr~ate.
`
`t
`
`~
`
`e
`
`PFIZER EX. 1502
`Page 1077
`
`
`
`~..-.. • ..,_...,.t...._,_~_.·.<II;L>r_r .. a_•••··:.~..:. .... : •. ,. ... '·• .• ·-,. -·.
`
`• •
`
`. wo 91109"7
`
`PCf/GB90/0l01 7
`
`•
`
`•
`
`·'
`
`- 11 -
`
`Also the heavy or light chains or hnmanised antibody
`molecules ·of the ·present 'inventi--on -may ilave -attached to
`them an effector or reporter molecule.
`For instance, it
`may have a macrocycle~ for chelating a heavy metal atom,
`or a toxin, &uch as ricin, attached to it by a covalent
`bridging structure. Alternatively, the procedures of
`recombinant DNA technology may be used to produce an
`fmmn,noglobulin molecule in which the Fe fragment or CB3
`domain of a complete immunoglobulin molecule has been
`replaced by, or has attached thereto by peptide linkage, a
`functional non-immunoglobulin protein, such as an enzyme
`or toxin molecule.
`
`Any appropriate acceptor variable region framework
`sequences may be used having regard to class/type of the
`donor antibody from which the antigen binding regions are
`derived.
`Preferably, the type of acceptor framework used
`is of the same/similar class/type as the donor antibody.
`Conveniently, the framework may be chosen to maximise/
`optimise homology with the donor.antibody sequence
`particularly at positions close or adjacent to the CDRs.
`However, a high level of homology between donor and
`acceptor sequences is not important for application of the
`present invention.
`The present invention identifies a
`hierarchy of framework residue positions at which donor
`residues may be important or desirable for obtaining a
`CDR-grafted antibody product having satisfactory binding
`properties.
`The CDR-grafted products usually have
`binding affinities of at least 10S Mrl, preferably at
`least about 108 Mrl, or especially in the range 10B-1o12
`Jr 1. ·. In principle, the pres eat invention is applicable
`to any combination of donor and acceptor antibodies
`irrespective of the level of homology between their ·
`sequences.
`A protocol for applying the invention to any
`particular donor-acceptor antibody pair is given
`hereinafter.
`Examples of.human frameworks which may be
`
`PFIZER EX. 1502
`Page 1078
`
`
`
`~·~-·-- . . . . . - .... ~ ..... ~. · - · · · •· -~ ..... • •• -
`
`-•• !. .....
`
`. wo 91/09967
`
`PCr/GB90/02017
`
`- 12 -
`
`used are KOL, BEWM, REI, EU, LAY and POM (refs. 4 and 5)
`·and the l.J.ke;
`for instance ·KOL ·and 'lmWM for the heavy
`chain and REI for the l.J.ght chain and EtJ, LAY and POM for
`both the heavy chain and the light chain.
`
`Also the constant region domains of the produc~s of the
`invention may be selected having regard to the proposed
`function of the antibody i.n particular the effector
`functions which may be required.
`Por exampl.e, the
`constant region domains may be human IgA, IgE, IgG or·IgM
`domains.
`In particular, IgG human constant region
`domains may be used, especially of the IgGl and IgG3
`isotypes, when the humanised antibody molecule is intended
`for therapeutic uses, and antibody effector functions are
`required. . Alternatively, IgG2 and IgG4 isotypes may be
`used when the humanised antibody molecule is intended for
`therapeutic purposes and antibody effector functions are
`not required, e.g. for simple blocking of l.ymphokine
`activity.
`
`However, the reme;nder of the antibody molecules need not
`comprise only proteJ.n sequences from immunoglobulins.
`For instance, a gene may be constructed in which a DNA
`sequence encoding part of a human immunoglobulin chain is
`·fused to a DNA sequence encoding the amino acid sequence
`of a functional polypeptide such as an effe~tor or
`reporter molecule.
`
`Preferably the CDR-grafted antibody heavy and light chain
`and antibody mol.ecule products are produced by recombinant
`DNA technology.
`
`Thus in further aspects the invention also includes DNA
`sequences coding for the CDR-grafted heavy and light
`chains, cloning and expression vectors ~ontaining the DNA
`sequences, host cells transformed with the DNA sequences
`
`PFIZER EX. 1502
`Page 1079
`
`
`
`~1 .... ~·~)o. ...... _, ................ ~.r·•t·•-•t..'.l- .••. '
`
`...... _, ......
`
`• ·
`
`- .,_
`
`. wo 91/09967
`
`. ,
`
`- 13 -
`
`PCT/GB90/02017
`
`and processes for producing the CDR-grafted chains and
`antibody molecules comprising expressing the DNA sequences
`in the transformed host cells.
`
`The general methode by which the vectors may be
`constructed, transfection methods and culture methods are
`well known per se and for.m no part of the invention.
`Such
`methods are shown, for instance, in refe~encas 10 and 11.
`
`The DNA sequences which encode the donor amino acid
`sequence may be obtained by methods wall known in the
`For example the donor coding sequences may be
`art.
`obtained by genomic cloning, or eDNA cloning from suitable
`hybridoma cell lines.
`Positive clones may be screened
`using appropriate probes for the heavy and light chain
`genes in question. Also PCR cloning may be used.
`
`DNA coding for acceptor, e.g. human acceptor, sequences
`may be obtained in any appropriate way.
`For example DNA
`sequences coding for preferred human acceptor frameworks
`such as KOL, REI, EO and NEWM, are widely available to
`workers in the art.
`
`The standard techniques of molecular biology may be used
`to prepare DNA sequences coding for the CDR-grafted
`products. Desired DNA sequences may be synthesised
`completely or in part using oligonucleotide synthesis
`techniques.
`Site-directed mutagenesis and polymerase
`chain reaction (PCR) techniques may be used as
`appropriate.
`For example oligonucleotide directed
`synthesis as described by Jones et al (ref. 20) may be
`used. Also oligonucleotide directed mutagenesis of a
`pre-exising variable region as, for example, described by
`Verhoeyen et al (ref. 5) or Riechmann et al (ref. 6) may
`be used. Also enzymatic filling in of gapped
`
`•
`
`PFIZER EX. 1502
`Page 1080
`
`
`
`
`
`. wo 91109967
`
`PCJ'/GB90/02017
`
`- 15 -
`
`The CDR-grafted product may comprise only heavy or light
`chain derived polypeptide, in which case only a heavy
`chain or light chain polypeptide coding sequence is used
`to transfect the host cells.
`For production of products comprising both heavy and light
`chains, the cell line may be transfected with two vectors,
`the first vector may contain an operon encoding a light
`chain-derived polypeptide and the second vector containing
`an operon encoding a heavy chain-derived polypeptide.
`Preferably, the vectors are identical, except in so far as
`the coding sequences and selectable markers are concerned,
`so as to ensure as far as possible that each polypeptide
`chain is equally expressed. Alternatively, a.single
`vector may be used, the vector including the sequences
`encoding both light chain- and heavy chain-derived
`polypeptides.
`
`The DNA in the coding sequences for the light and heavy
`chains may comprise eDNA or genomic DNA or both.
`However, it is preferred that the DNA sequence encoding
`the heavy or light chain comprises at least partially,
`genomic DNA, preferably a fusion of eDNA and genomic DNA.
`
`The present invention is applicable to antibodies of any
`appropriate specificity. Advantageously, however, the
`invention may be applied to the human