Pfizer v. Genentech
`IPR201(cid:26)-01488
`Genentech Exhibit 20(cid:21)(cid:19)
`
`

`

`4286
`
`Immunology: Carteretal.
`
`Proc. Natl. Acad. Sci. USA 89 (1992)
`
`A
`
`B
`
`muMAb4D5 V_
`40
`30
`20
`10
`P
`s ITC KASQODVNTAVAW Y QQ K
`DIVM TQ Ss HK FMS TS VGODRV
`\TGTGAATACTGCTGTAGCCTGGTA‘\TCAACAGAAACCA.
`*
`+e ee ee
`*
`probe
`<
`eet
`GCTGATATCGTGATGACCCAGTCCCA.
`\CCTCTGTGGGCGA‘
`GCTGATATCCAGATGA’
`
`
`\CCCAGTCCCCGAGCTCCCTGTCCGCCTCTGTGGGCGATAGGGTCACCATCACCTGCCGTGCCAGTCAGGATGTGAATACTGCTGTAGCCTGGTATCAACA\
`AGAAACCA
`Q K
`P
`DIQOMTQS PSSLUSASVGODORVTIT C_RAS Q DVN TA VAW Y Q
`Vp-CDR1
`huMAb4D5-5 V_
`Fic. 1. Nucleotide and amino
`70
`#
`#
`60
`50
`GTDFTFTIs Ss VQ
`oS acid sequences of mumAb4DS and
`GHS PKLLIY¥YSASFRYTGVPODRFTGNR
`\TAGATCTGGGACGGATTTCACTTTCACCATCAGCA.
`ee
`* *
`+t
`eae
`eek Fe
`*
`humAb4DS-5 V, (A) and Vy (B)
`\CTACTGA‘
`\TTTACTCGGCA’
`\GTOCCTTICTCGCTICTCTGGATCCAGATCTGGGACGGATTTCACTCTGACCATCAGCAGTCTGCAGCCGGAA.
`(numbered according to ref. 26).
`GKAPKLLIY SAS FLESGVPSRFSGSRSGTDFTLTISSLQP E
`The CDRresidues according to a
`Vp-CDR2
`sequence definition (26) and a
`structural definition (22) are un-
`derlined and overlined, respec-
`tively. The 5’ and 3’ ends of the
`oligonucleotides used for gene
`conversion mutagenesis are
`shown by arrows and mismatches
`30
`20
`10
`muMAb4D5 Vy
`eveLeesGcGPELVKPGASLKLSCTASGFNIKODTY¥IHWV K
`between genes are shownbyas-
`\GCTTCTGGCTTCAACA’
`'ATATACACTGGGTGAAA
`GCGTACGCTCAC
`ee
`Re
`*
`*
`ee
`*
`*
`=
`+e *
`_terisks. The asparagine-linked gly-
`’ACAC:
`aaa
`GOGTA\
`\CATTAAAGACACCTATATACACTGGGTGCGT==cgsylation site (#) in mumAb4D5
`EVQLUVESGGGLVQPGGESLRLSCAA S GFNI K_D Tf
`¥ IH WV R
`Vy-CDR1
`Vi,is used in some mumAb4D5
`huMAb4D65-5 Vij
`molecules derived from the corre-
`70
`60
`a
`50
`40
`PK FQODKATITAODTS SNTA\CACAGCC
`sponding hybridoma. However,
`QRPEQGLEWIGRIY¥Y PTNGYTR YD\TTTAS\TCCTACGAATGGTTATACTAGATA’
`\GACACA"
`¥ee REE
`* eee kee
`Oe
`=<
`‘+ eeeee
`+
`eee
`are
`mumAb4DS5 variants, which are
`‘AAGGGCCTGGAATGGGTTGCAAGGATTTATCCTACGAATGGTTATACTAGATATGCCGA’
`CAGGCCCOGGGT)
`\TAGCGTCAA\
`\TCCAAAAACACAGCC
`glycosylated or aglycosylated in
`QAPGKGULEWVA _R IY PTN GY TR YAODSVKGRFTISADTS KNTA
`Vy-CDR2
`VL, are indistinguishable in their
`110
`c
`100 a
`90
`c
`a
`80
`binding affinity for the p1854ER2
`MDYWGQGaASVTVS S85
`YLQvSsS R ULUTS EDTAVYY¥CSERWGGODGF Y
`\TGGACTACTGGGGTCAAGGAGCCTCGGTCACCGTCTCCTCG
`ECDandin their antiproliferative
`ATTATIGTTCIAGATGGGGAGGGGAC
`T
`ry
`+
`ee
`pat
`=
`eee eS
`"ATGCTATGGA(
`\CGTGTGGGGTCAAGGAACCCTGGTCA\
`\TGAACA( \TGGGGAGGGGACGGCTTCT)
`
`activity with SK-BR-3 cells (C.K.,
`vVvwoeagocfttutuUvtvs s&s
`YLQMNSLRAEDTAV YY C S R_WGGD GF Y AM D
`M. Spellman, and B. Hutchins,
`Vy-CDR3
`unpublished data).
`
`#s
`
`bA
`
`100
`90
`DLAVYYcQQHYTTPPTFGGGTKVETI XK
`GACCTGGCAGTTTATTACTGTCAGCAACATTATACTACTCCTICCCACGTTCGGAGGGGGTACCAAGGTGGAGATCAAA
`ee
`ee
`<a
`+e
`ss
`GACTTCGCAACTTATTACIGTCAGCAACATTATACTACTCCTICCCACGTTCGGACAGGGTACCAAGGTGGAGATCAAA
`DFATYYcCQQHY TTP PTFGQGTKVETI K
`Vy-CDR3
`
`dues (25, 26) incorporating restriction sites for directional
`cloning shownbyunderlining andlisted after the sequences:
`V_ sense, 5’-TCCGATATCCAGCTGACCCAGTCTCCA-3’
`EcoRV; V, antisense, 5'-GTTTGATCTCCAGCTTGG-
`TACCHSCDCCGAA-3’ Asp718; Vy sense, 5'’-AGGTSM-
`ARCTGCAGSAGTCWGG-3' Pst I; Vy antisense, S5’-
`TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG-3’
`BstEII; where H is A, C, or T; S is C or G; Dis A, G, or T;
`Mis AorC; Ris A or G; Wis A or T. The PCR products were
`cloned into pUC119 (27) and five clones for each V domain
`were sequencedbythe dideoxynucleotide chain-termination
`method (28).
`Molecular Modeling. Models of mumAb4DS5 Vy and V,
`domains were constructed by using seven Fab crystal struc-
`tures from the Brookhaven Protein Data Bank(entries 2FB4,
`2RHE, 2MCP, 3FAB, 1FBJ, 2HFL, and 1RED) (29). Vy and
`V of each structure were superimposed on 2FB4 by using
`main-chain atom coordinates (INSIGHT program, Biosym
`Technologies, San Diego). The distances from each 2FB4 Ca
`to the analogous Ca in each of the superimposedstructures
`wascalculated. For residues with all Ca—Ca distances <1A,
`the average coordinates for individual N, Ca, C, O, and CB
`atoms were calculated and then corrected for resultant de-
`viations from standard bond geometry by 50 cycles of energy
`minimization (DISCOVER program, Biosym Technologies) us-
`ing the AMBERforcefield (30) and fixed Ca atoms. Side chains
`of FR residues were then incorporated, followed by inclusion
`of five of the six CDR loops (except Vy—CDR3) using
`tabulations of CDR conformations(23) as a guide. Side-chain
`conformations were chosen on the basis of Fab crystal
`structures, rotamer libraries (31), and packing consider-
`ations. Three possible conformations of Vy-CDR3 were
`taken from a search ofsimilar sized loops in the Brookhaven
`Protein Data Bank or were modeled by using packing and
`solvent exposure considerations. Models were then sub-
`jected to 5000 cycles of energy minimization.
`A modelof the humAb4DS wasgenerated by using consen-
`sus sequences derived from the most abundant human sub-
`classes—namely, V;_ x subgroup I and Vj; subgroupIII (26).
`The six CDRswere transferred from the mumAb4DS model
`onto a human Fab model. All humAb4DS variants contain
`
`humanreplacements of mumAb4DSresiduesatthree positions
`within CDRsas defined by sequence variability (26) but not as
`defined by structural variability (22): V|-CDR1 K24R, V,-
`CDR2 R54L and V,;-CDR2 T56S.1 Differences between
`mumAb4DSand the human consensus FRresidues (Fig. 1)
`were individually modeled to investigate their possible influ-
`ence on CDRconformation and/or binding to p1854£®2 ECD.
`Construction of Chimeric Genes. Genes encoding the chi-
`meric mAb4DSlight and heavy chains were separately as-
`sembled in previously described phagemid vectors contain-
`ing the human cytomegalovirus enhancer and promoter, a 5’
`intron, and simian virus 40 polyadenylylation signal (32).
`Briefly, gene segments encoding mumAb4DS V, (Fig. 1A)
`and REI humanx,light-chain C,, (33) were precisely joined
`as were genes for mumAb4D5 Vy (Fig. 1B) and human IgG1
`C region (34) by subcloning (35) and site-directed mutagen-
`esis as described (36). The IgG1 isotype was chosen, asitis
`the preferred humanisotype for supporting ADCC and CDC
`by using matched sets of chimeric (15) or humanizedanti-
`bodies (17). The PCR-generated V; and Vy, fragments (Fig.
`1) were subsequently mutagenized so that they faithfully
`represent the sequence of mumAb4DS determined at the
`protein level: Vy, QIE; V_, V104L and T109A. The human
`IgG1 C regionsare identical to those reported (37) except for
`the mutations E359D and M361L (Eu numbering; ref. 26),
`whichweinstalled to convert the antibody from the naturally
`rare A allotype to the much more common non-A allotype
`(26). This was an attempt to reduce the risk of anti-allotype
`antibodies interfering with therapy.
`Construction of Humanized Genes. Genes encoding chi-
`meric mAb4DSlight-chain and heavy-chain Fd fragment (Vy
`and Cy1 domains) were subcloned together into pUC119 (27)
`to create pAK1 and were simultaneously humanized in a
`single step (43). Briefly, sets of six contiguous oligonucleo-
`tides were designed to humanize Vy and V, (Fig. 1). These
`oligonucleotides are 28-83 nucleotides long, contain 0-19
`mismatchesto the murine antibody template, and are con-
`
`Wariants are denoted by the amino acid residue and number
`followed by the replacement aminoacid.
`
`

`

`Immunology: Carteret al.
`
`Proc. Natl. Acad. Sci. USA 89 (1992)
`
`4287
`
`strained to have8 or 9 perfectly matched residues at each end
`to promote efficient annealing andligation of adjacentoligo-
`nucleotides. The sets of Vy and V, humanization oligonu-
`cleotides (5 pmol each) were phosphorylated with either ATP
`or [y-°2P]ATP(36) and separately annealed with 3.7 pmol of
`pAK1 template in 40 yl of 10 mM Tris-HCl (pH 8.0) and 10
`mM MgCl, by cooling from 100°C to ~20°C over ~20 min.
`The annealed oligonucleotides were joined by incubation
`with T4 DNAligase (12 units; New England Biolabs) in the
`presenceof 2 wl of 5SmM ATP and2 pl of 0.1 M dithiothreitol
`for 10 min at 14°C. After electrophoresis on a 6% acrylamide
`sequencinggel, the assembled oligonucleotides were located
`by autoradiography and recovered by electroelution. The
`assembled oligonucleotides (~0.3 pmol each) were simulta-
`neously annealed to 0.15 pmol of single-stranded deoxyuri-
`dine-containing pAK1prepared as described (38)in 10 pl of
`40 mM Tris-HCl (pH 7.5) and 16 mM MgCl, as described
`above. Heteroduplex DNAwasconstructed by extending the
`primers with T7 DNA polymerase and transformed into
`Escherichia coli BMH 71-18 mutL as described (36). The
`resultant phagemid DNA poolwasenrichedfirst for human
`V,byrestriction purification using Xho I and then for human
`Vy byrestriction selection using Stu I as described (36, 39).
`Resultant clones containing both human V, and human Vy
`genes were identified by nucleotide sequencing (28) and
`designated pAK2. Additional humanized variants were gen-
`erated by site-directed mutagenesis (36). The mumAb4D5 V;_
`and Vy gene segments in the transient expression vectors
`described above were then precisely replaced with their
`humanized versions.
`Expression and Purification of mAb4D5 Variants. Appro-
`priate mAb4DS5light- and heavy-chain cDNA expression
`vectors were cotransfected into adenovirus-transformed hu-
`man embryonic kidney cell line 293 by a high-efficiency
`procedure (32). Media were harvested daily for up to 5 days
`and the cells were refed with serum-free medium. Antibodies
`were recovered from the media and affinity purified on
`protein A-Sepharose CL-4B (Pharmacia) as described by the
`manufacturer. The eluted antibody was buffer-exchanged
`into phosphate-buffered saline by G25 gelfiltration, concen-
`trated by ultrafiltration (Amicon), sterile-filtered, and stored
`at 4°C. The concentration of antibody was determined by
`both total IgG and antigen binding ELISAs. The standard
`used was humAb4D5-5, whose concentration had been de-
`termined by amino acid composition analysis.
`Cell Proliferation Assay. The effect of mAb4DSvariants on
`proliferation of the human mammary adenocarcinomacell
`line SK-BR-3 was investigated as described (6) by using
`saturating mAb4DSconcentrations.
`
`Affinity Measurements. mAb4D5 variant antibodies and
`p185#=®2 ECD werepreparedas described(40) and incubated
`in solution until equilibrium was found to be reached. The
`concentration of free antibody was then determined by
`ELISA using immobilized p1854=®? ECD and was used to
`calculate affinity (Kg) as described (41). The solution-phase
`equilibrium between p1854=®? ECD and mAb4DS variants
`was found notto be grossly perturbed during the immobilized
`ECD ELISA measurementoffree antibody.
`
`RESULTS
`
`Humanization of mumAb4D5. The mumAb4DS5 V, and Vy
`gene segmentswere first cloned by PCR and sequenced(Fig. 1).
`The V region genes were then simultaneously humanized by
`gene conversion mutagenesis using preassembled oligonucleo-
`tides. A 311-mer oligonucleotide containing 39 mismatches to
`the template directed 24 simultaneous amino acid changes
`required to humanize mumAb4DS5 V,. Humanization of
`mumAb4DS Vy required 32 amino acid changes, which were
`installed with a 361-mer containing 59 mismatches to the
`mumAb4DStemplate. Twoofeight clones sequencedprecisely
`encode humAb4D5-5, although oneof these clones contained a
`single nucleotide imperfection. The six other clones were es-
`sentially humanized but contained a small numberof errors: <3
`nucleotide changes and <1 single nucleotide deletion per kilo-
`base. Additional humanizedvariants (Table 1) were constructed
`bysite-directed mutagenesis of humAb4DS-5.
`Expression levels of humAb4DSvariants were 7-15 ng/ml
`as judged by ELISA using immobilized p1854£®2 ECD.
`Successive harvestsof five 10-cm plates allowed 200-500 ug
`of each variant to be produced in a week. Antibodiesaffinity
`purified on protein A gave a single band on a Coomassie
`blue-stained SDS/polyacrylamide gel of mobility consistent
`with the expected mass of ~150 kDa. Electrophoresis under
`reducing conditions gave two bands consistent with the
`expected mass of free heavy (48 kDa) andlight (23 kDa)
`chains (data not shown). N-terminal sequenceanalysis (10
`cycles) gave the mixed sequence expected (see Fig. 1) from
`an equimolar combination of light and heavy chains.
`humAb4D5Variants. In general, FR residues were chosen
`from consensus human sequences (26) and CDRresidues
`were chosen from mumAb4DS5. Additional variants were
`constructed by replacing selected human residues in
`humAb4D5-1 with their mumAb4DS counterparts. These are
`Vu residues 71, 73, 78, 93, plus 102 and V, residues 55 plus
`66. Vy residue 71 has previously been proposed byothers
`(24) to be critical to the conformation of Vy—-CDR2. Amino
`acid sequencedifferences between humAb4D%Svariant mol-
`ecules are shownin Table 1 together with their p1854#=®? ECD
`
`Table 1.
`
`mAb4DS5
`variant
`humAb4DS5-1
`humAb4D5-2
`humAb4DS-3
`humAb4D5-4
`humAb4D5-5
`humAb4DS5-6
`humAb4DS-7
`humAb4DS5-8
`humAb4D5
`
`71
`(FR3)
`R
`Ala
`Ala
`Ala
`Ala
`Ala
`Ala
`Ala
`Ala
`
`73
`(FR3)
`D
`D
`Thr
`Thr
`Thr
`Thr
`Thr
`Thr
`Thr
`
`p1854ER2 ECDbindingaffinity and anti-proliferative activities of mAb4D5 variants
`Vy residue
`VL residue
`78
`(FR3)
`L
`L
`Ala
`L
`Ala
`Ala
`Ala
`Ala
`Ala
`
`93
`(FR3)
`A
`A
`Ser
`Ser
`Ser
`Ser
`Ser
`Ser
`Ser
`
`Relative cell
`| Ka
`66
`55
`102
`proliferation
`nM
`(FR3)
`(CDR2)
`(CDR3)
`102
`25
`G
`E
`Vv
`101
`4.7
`G
`E
`Vv
`66
`4.4
`G
`E
`Vv
`56
`0.82
`Arg
`E
`Vv
`48
`1.1
`Arg
`E
`Vv
`51
`0.22
`Arg
`Tyr
`Vv
`53
`0.62
`Arg
`E
`Tyr
`54
`0.10
`Arg
`Tyr
`Tyr
`37
`0.30
`Arg
`Tyr
`Tyr
`Human and murineresidues are shownin one-letter and three-letter amino acid codes, respectively. Kg values for the p1854=®2 ECD were
`determined by the method of Friguet etal. (41) and the standard error of each estimate is +10%. Proliferation of SK-BR-3 cells incubated for
`96 hr with mAb4D%Svariants is shownas a percentage of the untreated control as described (7). Data represent the maximal antiproliferative
`effect for each variant (see Fig. 2) calculated as the meanoftriplicate determinations at a mAb4D5 concentration of 8 ug/ml. Data are all taken
`from the same experimentand the estimated standard error is +15%.
`
`

`

`4288
`
`Immunology: Carteretal.
`
`
`proliferation
`
`Percentofcontrolcell
`
`huMAb4D5-8
`
`4
`
`12
`8
`[MAb4DSvariant] jig/ml
`
`16
`
`Proc. Natl. Acad. Sci. USA 89 (1992)
`
`placementofR71 in humAb4D5-1 with the corresponding murine
`residue, A71 (humAb4D5-2). In contrast, replacing Vj; L78 in
`humAb4DS-4 with the murine residue A78 (humAb4D5-5) does
`not significantly change theaffinity for the p185#=®2 ECD or
`changeantiproliferative activity, suggesting that residue 78 is not
`of critical functional significance to humAb4D5 in interacting
`with p185HER2 ECD.
`V, residue 66 is usually a glycine in human and murine
`«-chain sequences (26) but an arginine occupies this position
`in the mumAb4DS« light chain. The side chain of residue 66
`is likely to affect the conformation of V;-CDR1 and V,-
`CDR2 andthe hairpin turn at residues 68-69 (Fig. 3). Con-
`sistent with the importanceofthis residue, the mutation V;_
`G66R (humAb4DS5-3 — humAb4D5-5)increases the affinity
`for the p1854=®2 ECD by4-fold with a concomitant increase
`in antiproliferative activity.
`From molecular modeling, it appears that the side chain of
`mumAb4DS5 V, Y55 mayeitherstabilize the conformation of
`Vi-CDR3 or provide aninteraction at the Vj—Vy interface.
`The latter function may be dependenton the presence of Viz
`Y102. In the context of humAb4D5-5 the mutations V;, ES5SY
`(humAb4DS5-6) and Vy V102Y (humAb4DS5-7) individually
`increase the affinity for p1854=®2 ECD by 5-fold and 2-fold,
`respectively, whereas together (humAb4D5-8) they increase
`the affinity by 11-fold. This is consistent with either proposed
`role of Vi Y55 and Vy Y102.
`Immune Function of humAb4D5-8. humAb4D5-8
`efficiently mediates ADCC against SK-BR-3 breast carcinoma
`cells, which overexpress p1854=? at high levels as anticipated
`from its IgG1 isotype (Table 2). In contrast, humAb4D5-8 is
`very inefficient in mediating ADCC against the normal lung
`epithelium cell line WI-38, which expresses p185#=F2 at 100-
`fold lower levels than SK-BR-3 cells (Table 2). The murine
`parent antibodyis not very effective in mediating ADCCagainst
`either SK-BR-3 or WI-38 cells.
`
`DISCUSSION
`
`mumAb4DSis potentially useful for human therapysince it is
`cytostatic toward human breast and ovarian tumorlines over-
`expressing p1854=®2, Here we have humanized mumAb4DSin
`an attemptto improveits potential clinical efficacy by reducing
`its immunogenicity andtailoring the Fc region to support ADCC
`and possibly CDC.
`Rapid humanization of humAb4D5was facilitated by the
`gene conversion mutagenesis strategy developed here using
`long preassembled oligonucleotides. This method uses less
`
`Fic. 3. Stereoview of a-car-
`bon tracing for model of hum-
`Ab4DS5-8 V, and Vy. The CDR
`residues (26) are shown in boldface
`and side chains of Vy; residues
`A71, T73, A78, S93, and Y102 and
`V_ residues Y55 and R66 (see Ta-
`ble 1) are shown.
`
`Inhibition of SK-BR-3 proliferation by mAb4D5variants.
`Fic. 2.
`Relative cell proliferation was determined as described (7) and data
`(average oftriplicate determinations) are presented as a percentage
`ofresults with untreated cultures for mumAb4D5, humAb4D5-8, and
`humAb4DS5-1.
`
`binding affinity and maximal antiproliferative activities
`against SK-BR-3cells. Very similar Ka values were obtained
`for binding mAb4D5variants to either SK-BR-3 cells (C.K.
`and N. Dua,unpublisheddata) or to p185#=®2 ECD (Table 1).
`The most potent humanizedvariant designed by molecular
`modeling, humAb4D5-8, contains five FR residues from
`mumAb4D5. This antibody binds the p185#=®2 ECD 3-fold
`more tightly than does mumAb4DSitself (Table 1) and has
`comparable antiproliferative activity with SK-BR-3 cells
`(Fig. 2). In contrast, humAb4DS-1 is the most humanized but
`least potent mumAb4DSvariant, created by simplyinstalling
`the mumAb4DS5 CDRsinto the consensus human sequences.
`humAb4DS5-1 binds the p1854=®? ECD 80-fold less tightly
`than does the murine antibody and hasno detectableantipro-
`liferative activity at the highest antibody concentration in-
`vestigated (16 ug/ml).
`The antiproliferative activity of humAb4D5 variants
`against p1854=®? overexpressing SK-BR-3 cells is not simply
`correlated with their bindingaffinity for the p185#=22 ECD—
`e.g., installation of three murine residues into the Vy domain
`of humAb4DS5-2 (D73T, L78A, and A93S) to create
`humAb4D5-3 does not changetheantigenbindingaffinity but
`does confersignificant antiproliferative activity (Table 1).
`The importance of Vy residue 71 (24) is supported by the
`
`observed 5-fold increase in affinity for p1854ER2 ECD onre-
`
`

`

`Immunology: Carteret al.
`
`Proc. Natl. Acad. Sci. USA 89 (1992)
`
`4289
`
`25:1
`12.5:1
`6.25:1
`3:13:1
`
`25:1
`12.5:1
`6.25:1
`3.13:1
`
`Antibody concentration, 100 ng/ml
`<1.0
`9.3
`7.5
`<1.0
`11.1
`4.7
`<1.0
`8.9
`0.9
`<1.0
`8.5
`4.6
`Antibody concentration, 10 ng/ml
`<1.0
`3.1
`6.1
`<1.0
`1.7
`5.5
`13
`2.2
`2.0
`<1.0
`0.8
`2.4
`
`40.6
`36.8
`35.2
`19.6
`
`33.4
`26.2
`21.0
`13.4
`
`10.
`
`11.
`
`12.
`
`13.
`
`14.
`
`16.
`
`17.
`
`18.
`19.
`
`20.
`
`21.
`
`22.
`23.
`
`24.
`
`25.
`
`26.
`
`271.
`
`29.
`
`31.
`32.
`
`33.
`
`35.
`
`36.
`
`37.
`
`38.
`
`39.
`
`41.
`
`42.
`
`43.
`
`Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A. &
`Table 2. Selectivity of ADCC mediated by mAb4D5Svariants
`McGuire, W.L. (1987) Science 235, 177-182.
`Effector/
`SK-BR-3
`WI-38
`Slamon,D. J., Godolphin, W., Jones, L. A., Holt, J. A., Wong, S. G.,
`Keith, D. E., Levin, W. J., Stuart, S. G., Udove, J., Ullrich, A. & Press,
`
`target.—©§_<>
`M.F. (1989) Science 244, 707-712.
`ratio
`mumAb4D5 humAb4DS5-8 mumAb4D5 humAb4D5-8
`Fendly, B. M., Winget, M., Hudziak, R. M., Lipari, M. T., Napier,
`M. A. & Ullrich, A. (1990) Cancer Res. 50, 1550-1558.
`Hudziak, R. M., Lewis, G. D., Winget, M., Fendly, B. M., Shepard,
`H. M. & Ullrich, A. (1989) Mol. Cell. Biol. 9, 1165-1172.
`Lupu,R., Colomer, R., Zugmaier, G., Sarup, J., Shepard, M., Slamon,
`D. & Lippman, M.E.(1990) Science 249, 1552-1555.
`Shepard, H. M. & Lewis, G. D. (1988) J. Clin. Immunol. 8, 333-395.
`Miller, R. A., Oseroff, A. R., Stratte, P. T. & Levy, R. (1983) Blood 62,
`988-995.
`Schroff, R. W., Foon, K. A., Beatty, S. M., Oldham, R. K. & Morgan,
`A. C., Jr. (1985) Cancer Res. 45, 879-885.
`Morrison, S. L., Johnson, M. J., Herzenberg, L. A. & Oi, V. T. (1984)
`Proc. Natl. Acad. Sci. USA 81, 6851-6855.
`Boulianne, G. L., Hozumi, N. & Shulman, M. J. (1984) Nature (London)
`312, 643-646.
`Neuberger,M.S., Williams, G. T., Mitchell, E. B., Jouhal, S. S., Flana-
`gan, J. G. & Rabbitts, T. H. (1985) Nature (London) 314, 268-270.
`Briggemann,M., Williams, G. T., Bindon, C. I., Clark, M. R., Walker,
`M. R., Jefferis, R., Waldmann, H. & Neuberger, M. S. (1987) J. Exp.
`Med. 166, 1351-1361.
`Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. & Winter, G.
`(1986) Nature (London) 321, 522-525.
`Riechmann,L., Clark, M., Waldmann, H. & Winter, G. (1988) Nature
`(London) 332, 323-327.
`Verhoeyen,M., Milstein, C. & Winter, G. (1988) Science 239, 1534-1536.
`Hale, G., Dyer, M. J. S., Clark, M. R., Phillips, J. M., Marcus, R.,
`Riechmann,L., Winter, G. & Waldmann,H. (1988) Lanceti, 1394-1399.
`Queen, C., Schneider, W. P., Selick, H. E., Payne, P. W., Landolfi,
`N. F., Duncan, J. F., Avdalovic, N. M., Levitt, M., Junghans, R. P. &
`Waldmann,T. A. (1989) Proc. Natl. Acad. Sci. USA 86, 10029-10033.
`Mian,I. S., Bradwell, A. R. & Olson, A. J. (1991) J. Mol. Biol. 217,
`133-151.
`Chothia, C. & Lesk, A. M. (1987) J. Mol. Biol. 196, 901-917.
`Chothia, C., Lesk, A. M., Tramontano, A., Levitt, M., Smith-Gill, S. J.,
`Air, G., Sheriff, S., Padlan, E. A., Davies, D., Tulip, W. R., Colman,
`P. M., Spinelli, S., Alzari, P. M. & Poljak, R. J. (1989) Nature (London)
`342, 877-883.
`Tramontano, A., Chothia, C. & Lesk, A. M. (1990) J. Mol. Biol. 215,
`175-182.
`Orlandi, R., Gissow, D. H., Jones, P. T. & Winter, G. (1989) Proc. Natl.
`Acad. Sci. USA 86, 3833-3837.
`Kabat, E. A., Wu, T. T., Reid-Miller, M., Perry, H. M. & Gottesmann,
`K. S. (1987) Sequences ofProteins ofImmunologicalInterest (Natl. Inst.
`Health, Bethesda, MD).
`Vieira, J. & Messing, J. (1987) Methods Enzymol. 153, 3-11.
`Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci.
`USA 74, 5463-5467.
`Bernstein, F. C., Koetzle, T. F., Williams, G. J. B., Meyer, E. F.,
`Brice, M. D., Rodgers, J. R., Kennard, O., Shimanouchi, T. & Tasumi,
`M. (1977) J. Mol. Biol. 112, 535-542.
`Weiner, S. J., Kollman, P. A., Case, D. A., Singh, U. C., Ghio, C.,
`Alagona,G., Profeta, S., Jr., & Winer, P. (1984) J. Am. Chem.Soc. 106,
`765-784.
`Ponder, J. W. & Richards, F. M. (1987) J. Mol. Biol. 193, 775-791.
`Gorman, C. M., Gies, D. R. & McCray, G. (1990) DNA Protein Eng.
`Technol. 2, 3-10.
`Palm, W. & Hilschmann,N. (1975) Hoppe-Seyler Z. Physiol. Chem. 356,
`167-191.
`Capon, D. J., Chamow, S. M., Mordenti, J., Marsters, S. A., Gregory,
`T., Mitsuya, H., Byrn, R. A., Lucas, C., Wurm, F. M., Groopman,
`J. E., Broder, S. & Smith, D. H. (1989) Nature (London) 337, 525-531.
`Boyle, A. (1990) in Current Protocols in Molecular Biology, eds. Ausu-
`bel, F. A., Brent, R., Kingston, R. E., Moore, D. D., Seidman,J. G.,
`Smith, J. A. & Struhl, K. (Wiley-Interscience/Greene, New York),
`Chap.3, pp. 3.0.1-3.18.7.
`Carter, P. (1991) in Mutagenesis: A Practical Approach, ed. McPherson,
`M. J. (IRL, Oxford, U.K.), Chap. 1, pp. 1-25.
`Ellison, J. W., Berson, B. J. & Hood, L. E. (1982) Nucleic Acids Res. 13,
`4071-4079.
`Kunkel, T. A., Roberts, J. D. & Zakour, R. A. (1987) Methods Enzymol.
`154, 367-382.
`Wells, J. A., Cunningham, B. C., Graycar, T. P. & Estell, D. A. (1986)
`Philos. Trans. R. Soc. London Ser. A 317, 415-423.
`Fendly, B. M., Kotts, C., Vetterlein, D., Lewis, G. D., Winget, M.,
`Carver, M. E., Watson,S. R., Sarup, J., Saks, S., Ullrich, A. & Shepard,
`H. M.(1990) J. Biol. Response Modif. 9, 449-455.
`Friguet, B., Chaffotte, A. F., Djavadi-Ohaniance, L. & Goldberg, M. E.
`(1985) J. Immunol. Methods 77, 305-319.
`Rostapshov, V. M., Chernov, I. P., Azhikina, T. L., Borodin, A. M. &
`Sverdlov, E. D. (1989) FEBS Lett. 249, 379-382.
`Carter, P., Garrard, L. & Henner, D. (1992) Methods (San Diego), in
`press.
`
`Sensitivity to ADCC of human cell lines WI-38 (normal lung
`epithelium) and SK-BR-3 (breast tumor), which express 0.6 and 64
`pg of p185HER2 per yg of cell protein, respectively, as determined by
`ELISA (40). ADCCassays were carried out as described (15) using
`interleukin 2 activated human peripheral blood mononuclear cells as
`effector cells and either WI-38 or SK-BR-3 target cells in 96-well
`microtiter plates for 4 hr at 37°C at different antibody concentrations.
`Values given represent percentage specific cell lysis as determined
`by *1Cr release. The estimated standard error in these quadruplicate
`determinations was +10%.
`
`than half the amount of synthetic DNA, as does total gene
`synthesis, and does not require convenientrestrictionsites in
`the target DNA. Our method appearsto be simpler and more
`reliable than a similar protocol recently reported (42). Tran-
`sient expression of humAb4DS5 in human embryonic kidney
`293 cells permitted the isolation of 0.2- to 0.5-mg humAb4D5
`variants for rapid characterization by growth inhibition and
`antigen binding affinity assays. Furthermore, different com-
`binations of light and heavy chain were readily tested by
`cotransfection of corresponding cDNA expression vectors.
`The crucial role of molecular modeling in the humanization
`of mumAb4DS5is illustrated by the designed variant
`humAb4D5-8, which binds the p185#=®? ECD 250-fold more
`tightly than the simple CDR loop swapvariant humAb4D5-1.
`It has previously been shownthatthe antigen bindingaffinity
`of a humanized antibody can be increased by mutagenesis
`based on molecular modeling (17, 20). Here we have designed
`a humanized antibody that binds its antigen 3-fold more
`tightly than the parent antibody andis almost as potent in
`blocking the proliferation of SK-BR-3 cells. While this result
`is gratifying, assessmentof the success of molecular model-
`ing must await the outcomeof ongoing x-ray crystallographic
`structure determination.
`humAb4D5-8 also supports cytotoxicity via ADCC against
`SK-BR-3 tumorcells in the presence ofhuman effectorcells but
`is not effective in directing the killing of normal (WI-38)cells,
`which express p1854E®? at much lowerlevels. This augurs well
`for the ongoing treatment of human cancers overexpressing
`p185#ER2 by using humAb4DS5-8.
`
`WethankBill Henzel for N-terminal sequence analysis of mAb4D5
`variants; Nancy Simpson for sequencing the cDNAsfor mumAb4D5
`V-region genes; Maria Yang for providing the C,-containing clone;
`Susie Wong for performing amino acid composition analysis; Irene
`Figari for performing the ADCC assays; Mark Vasser, Parkash
`Jhurani, Peter Ng, and Leonie Meimafor synthesizing oligonucleo-
`tides; Bob Kelley for helpful discussions; and Tony Kossiakoff for
`support.
`
`1. Coussens, L., Yang-Feng, T. L., Liao, Y.-C., Chen, E., Gray, A.,
`McGrath, J., Seeburg, P. H., Libermann, T. A., Schlessinger, J.,
`Francke, U., Levinson, A. & Ullrich, A. (1985) Science 230, 1132-1139.
`2. Yamamoto, T., Ikawa, S., Akiyama, T., Semba, K., Nomura, N.,
`Miyajima, N., Saito, T. & Toyoshima, K. (1986) Nature (London) 319,
`230-234.
`3. King, C. R., Kraus, M. H. & Aaronson,S. A.(1985) Science 229, 974-976.
`
`